Strain Name:
C57BL/6J-MtgxR1665Btlr/Mmmh
Stock Number:
039701-MU
Citation ID:
RRID:MMRRC_039701-MU
Other Names:
R1665 (G1), C57BL/6J-MtgxR1665Btlr
Major Collection:

Strain Information

Dct
Name: dopachrome tautomerase
Synonyms: tyrosinase-related protein-2, TRP-2, Tyrp-2, Tyrp2, TRP2
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 14
NCBI: 13190
VEGA: 14
HGNC: HGNC:2709
Homologene: 1447
Htr4
Name: 5 hydroxytryptamine (serotonin) receptor 4
Synonyms: 5-HT4L, 5-HT4
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 18
NCBI: 15562
VEGA: 18
HGNC: HGNC:5299
Homologene: 20243
Rc3h1
Name: RING CCCH (C3H) domains 1
Synonyms: roquin, 5730557L09Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 1
NCBI: 381305
Homologene: 19036
Slit3
Name: slit guidance ligand 3
Synonyms: Slit1, b2b2362.1Clo
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 11
NCBI: 20564
Homologene: 2303
Mfn1
Name: mitofusin 1
Synonyms: 6330416C07Rik, 2310002F04Rik, D3Ertd265e, HR2
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 3
NCBI: 67414
Homologene: 11481
Ehmt1
Name: euchromatic histone methyltransferase 1
Synonyms: 9230102N17Rik, KMT1D
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 2
NCBI: 77683
Homologene: 11698
Lrig3
Name: leucine-rich repeats and immunoglobulin-like domains 3
Synonyms: 9030421L11Rik, 9130004I02Rik, 9430095K15Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 10
NCBI: 320398
VEGA: 10
Homologene: 62452
Map1b
Name: microtubule-associated protein 1B
Synonyms: MAP5, Mtap-5, Mtap5, LC1, Mtap1b
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 13
NCBI: 17755
VEGA: 13
HGNC: HGNC:6836
Homologene: 38111
Timmdc1
Name: translocase of inner mitochondrial membrane domain containing 1
Synonyms: 2810021C21Rik, 4930455C21Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 16
NCBI: 76916
HGNC: HGNC:1321
Homologene: 9578
Kif20a
Name: kinesin family member 20A
Synonyms: Rabkinesin-6, Rab6kifl
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 18
NCBI: 19348
VEGA: 18
HGNC: HGNC:9787
Homologene: 38093
Med13l
Name: mediator complex subunit 13-like
Synonyms: 2210413I17Rik, 6330591G05Rik, Trap240L, 9030618F05Rik, Thrap2
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 5
NCBI: 76199
Homologene: 25256
Mllt10
Name: myeloid/lymphoid or mixed-lineage leukemia; translocated to, 10
Synonyms: Af10, D630001B22Rik, B130021D15Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 2
NCBI: 17354
Homologene: 20973
Nfkb1
Name: nuclear factor of kappa light polypeptide gene enhancer in B cells 1, p105
Synonyms: NF kappaB1, p50 subunit of NF kappaB, p50/p105, p50, nuclear factor kappaB p50, NF-kappaB, NF-kappaB p50
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 3
NCBI: 18033
HGNC: HGNC:7794
Homologene: 2971
Wdr59
Name: WD repeat domain 59
Synonyms: 5430401O09Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 8
NCBI: 319481
Homologene: 38685
Dab2ip
Name: disabled 2 interacting protein
Synonyms: 2310011D08Rik, AIP1
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 2
NCBI: 69601
Homologene: 13058
Zc3h4
Name: zinc finger CCCH-type containing 4
Synonyms: LOC330474, Bwq1, Kiaa1064-hp
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 7
NCBI: 330474
Homologene: 87150
Smad1
Name: SMAD family member 1
Synonyms: Madr1, Smad 1, Madh1
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 8
NCBI: 17125
HGNC: HGNC:6767
Homologene: 21196
Hsd17b4
Name: hydroxysteroid (17-beta) dehydrogenase 4
Synonyms: 17[b]-HSD, MFE-2, perMFE-2, multifunctional protein 2, D-bifunctional protein, Mfp-2, MFP2
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 18
NCBI: 15488
HGNC: HGNC:5213
Homologene: 358
Kpna6
Name: karyopherin subunit alpha 6
Synonyms: IPOA7, NPI-2, importin alpha 7
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 4
NCBI: 16650
HGNC: HGNC:6399
Homologene: 22472
Caml
Name: calcium modulating ligand
Synonyms: Caml
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 13
NCBI: 12328
HGNC: HGNC:1471
Homologene: 1323
Nr2c1
Name: nuclear receptor subfamily 2, group C, member 1
Synonyms: TR2, Tr2-11, 4831444H07Rik, Eenr
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 10
NCBI: 22025
HGNC: HGNC:7971
Homologene: 55731
Tmem126b
Name: transmembrane protein 126B
Synonyms: 1110001A23Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 7
NCBI: 68472
Homologene: 10222
Angel2
Name: angel homolog 2
Synonyms: 5730410O10Rik, 2610307I21Rik, D1Ertd654e, D1Ertd396e
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 1
NCBI: 52477
Homologene: 16932
C2cd2l
Name: C2 calcium-dependent domain containing 2-like
Synonyms: 1300006O23Rik, Tmem24
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 9
NCBI: 71764
VEGA: 9
Homologene: 8876
Taf1c
Name: TATA-box binding protein associated factor, RNA polymerase I, C
Synonyms: mTAFI95
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 8
NCBI: 21341
Homologene: 21163
Gnb4
Name: guanine nucleotide binding protein (G protein), beta 4
Synonyms: 6720453A21Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 3
NCBI: 14696
Homologene: 69140
Lclat1
Name: lysocardiolipin acyltransferase 1
Synonyms: ALCAT1, AGPAT8, Lycat
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 17
NCBI: 225010
Homologene: 33167
Muc15
Name: mucin 15
Synonyms: D730046L02Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 2
NCBI: 269328
Homologene: 51680
Tax1bp1
Name: Tax1 (human T cell leukemia virus type I) binding protein 1
Synonyms: D6Ertd404e, 1200003J11Rik, TXBP151, T6BP, D6Ertd772e, 1700069J21Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 6
NCBI: 52440
Homologene: 4395
Morc2a
Name: microrchidia 2A
Synonyms: 8430403M08Rik, Zcwcc1
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 11
NCBI: 74522
Homologene: 8966
Sec63
Name: SEC63 homolog, protein translocation regulator
Synonyms: 5730478J10Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 10
NCBI: 140740
Homologene: 5220
Zic5
Name: zinc finger protein of the cerebellum 5
Synonyms: odd-paired related, Opr, 1700049L20Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 14
NCBI: 65100
Homologene: 11301
Ryr1
Name: ryanodine receptor 1, skeletal muscle
Synonyms: calcium release channel isoform 1, Ryr, skrr
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 7
NCBI: 20190
Homologene: 68069
Prf1
Name: perforin 1 (pore forming protein)
Synonyms: perforin, Prf-1, Pfp, Pfn
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 10
NCBI: 18646
VEGA: 10
HGNC: HGNC:9360
Homologene: 3698
Abca3
Name: ATP-binding cassette, sub-family A member 3
Synonyms: ABC-C, Abc3, 1810036E22Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 17
NCBI: 27410
HGNC: HGNC:33
Homologene: 37437
Trim9
Name: tripartite motif-containing 9
Synonyms: C030048G07Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 12
NCBI: 94090
VEGA: 12
Homologene: 9045
Ttn
Name: titin
Synonyms: connectin, L56, mdm, 1100001C23Rik, 2310036G12Rik, 2310074I15Rik, 2310057K23Rik, D330041I19Rik, D830007G01Rik, shru
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 2
NCBI: 22138
Homologene: 130650
Dnah6
Name: dynein, axonemal, heavy chain 6
Synonyms: A730004I20Rik, Dnahc6
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 6
NCBI: 330355
HGNC: HGNC:2951
Homologene: 15221
Ccdc125
Name: coiled-coil domain containing 125
Synonyms: 5830436D01Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 13
NCBI: 76041
VEGA: 13
Homologene: 27932
Dnah17
Name: dynein, axonemal, heavy chain 17
Synonyms: LOC382552, 2810003K23Rik, Dnahcl1, Dnahc17
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 11
NCBI: 69926
HGNC: HGNC:2946
Homologene: 72102
Pde10a
Name: phosphodiesterase 10A
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 17
NCBI: 23984
HGNC: HGNC:8772
Homologene: 4852
Ces2a
Name: carboxylesterase 2A
Synonyms: 9130231C15Rik, Ces6
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 8
NCBI: 102022
HGNC: HGNC:1864
Homologene: 136396
Wdfy4
Name: WD repeat and FYVE domain containing 4
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 14
NCBI: 545030
Homologene: 83473
Cabp2
Name: calcium binding protein 2
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 19
NCBI: 29866
HGNC: HGNC:1385
Homologene: 8487
Gm11639
Name: predicted gene 11639
Synonyms: Gm11639, Efcab15
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 11
NCBI: 105242472
Spata31g1
Name: SPATA31 subfamily G member 1
Synonyms: 1700022I11Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 4
NCBI: 67317
Homologene: 52406
Csmd3
Name: CUB and Sushi multiple domains 3
Synonyms: 4930500N14Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 15
NCBI: 239420
Homologene: 65982
Fras1
Name: Fraser extracellular matrix complex subunit 1
Synonyms: bl, E130113P14Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 5
NCBI: 231470
Homologene: 23516
Or4k39
Name: olfactory receptor family 4 subfamily K member 39, pseudogene 1
Synonyms: GA_x6K02T2Q125-72459956-72460837, MOR248-25_p, MOR248-17P, Olfr1285
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 2
NCBI: 545447
Slco1a4
Name: solute carrier organic anion transporter family, member 1a4
Synonyms: Oatp2, Slc21a5, Oatp1a4
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 6
NCBI: 28250
Homologene: 130782
Zfp53
Name: zinc finger protein 53
Synonyms: zfas8, KRAZ1, Zfp-53, Zfp118, D030067O06Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 17
NCBI: 24132
VEGA: 17
Homologene: 135946
Or10a2
Name: olfactory receptor family 10 subfamily A member 2
Synonyms: GA_x6K02T2PBJ9-9453401-9454354, MOR263-2, P4, Olfr714
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 7
NCBI: 259035
Homologene: 72055
Steap1
Name: six transmembrane epithelial antigen of the prostate 1
Synonyms: Prss24, 2410007B19Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 5
NCBI: 70358
Homologene: 8256
Map3k19
Name: mitogen-activated protein kinase kinase kinase 19
Synonyms: Ysk4
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 1
NCBI: 22625
Homologene: 19318
Aldh1a7
Name: aldehyde dehydrogenase family 1, subfamily A7
Synonyms: Aldh-pb, Ahd2-like
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 19
NCBI: 26358
HGNC: HGNC:402
Homologene: 137245
Tm6sf2
Name: transmembrane 6 superfamily member 2
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 8
NCBI: 107770
Homologene: 77694
Itga10
Name: integrin, alpha 10
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 3
NCBI: 213119
HGNC: HGNC:6135
Homologene: 2697
Cttnbp2
Name: cortactin binding protein 2
Synonyms: ORF4, Cortbp2, 9130022E09Rik, 4732477G22Rik, 3010022N24Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 6
NCBI: 30785
Homologene: 14125
Ripk3
Name: receptor-interacting serine-threonine kinase 3
Synonyms: Rip3, 2610528K09Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 14
NCBI: 56532
VEGA: 14
Homologene: 31410
Rgl1
Name: ral guanine nucleotide dissociation stimulator,-like 1
Synonyms: Rgl
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 1
NCBI: 19731
Homologene: 9039
Or4g16
Name: olfactory receptor family 4 subfamily G member 16
Synonyms: GA_x6K02T2Q125-72357646-72358581, MOR245-12, Olfr1279
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 2
NCBI: 258388
Homologene: 121520
Hdac7
Name: histone deacetylase 7
Synonyms: 5830434K02Rik, Hdac7a
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 15
NCBI: 56233
Homologene: 9124
Vmn1r25
Name: vomeronasal 1 receptor 25
Synonyms: V1rc8
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 6
NCBI: 113865
Homologene: 137652
Or8c10
Name: olfactory receptor family 8 subfamily C member 10
Synonyms: GA_x6K02T2MYUG-19447-18473, MOR170-14, MOR170-8, GA_x6K02T2PVTD-32060891-32061865, Olfr899, Olfr250
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 9
NCBI: 404312
VEGA: 9
Homologene: 74151
Fnip2
Name: folliculin interacting protein 2
Synonyms: D630023B12Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 3
NCBI: 329679
Homologene: 46417
Pou2f2
Name: POU domain, class 2, transcription factor 2
Synonyms: Oct2b, Oct2a, Oct-2, Otf-2, Otf2, Oct2d, Oct2c
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 7
NCBI: 18987
HGNC: HGNC:9213
Homologene: 55674
Prkd1
Name: protein kinase D1
Synonyms: Pkcm, PKD1, Prkcm
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 12
NCBI: 18760
VEGA: 12
HGNC: HGNC:9407
Homologene: 55680
Cfap61
Name: cilia and flagella associated protein 61
Synonyms: 4930529M08Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 2
NCBI: 78774
Thoc5
Name: THO complex 5
Synonyms: PK1.3, 1700060C24Rik, Fmip, A430085L24Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 11
NCBI: 107829
Homologene: 37836
Pi15
Name: peptidase inhibitor 15
Synonyms: P24TI, P25TI, SugarCrisp
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 1
NCBI: 94227
HGNC: HGNC:8946
Homologene: 22935
Klhl22
Name: kelch-like 22
Synonyms: 2610318I18Rik, Kelchl
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 16
NCBI: 224023
Homologene: 23784
Foxb1
Name: forkhead box B1
Synonyms: Hfh-e5.1, C43, TWH, Fkh5, Mf3, Foxb1b, Foxb1a
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 9
NCBI: 64290
VEGA: 9
HGNC: HGNC:3799
Homologene: 8138
H1f7
Name: H1.7 linker histone
Synonyms: 1700026P10Rik, H1T2, H1fnt, H1-7
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 15
NCBI: 70069
VEGA: 15
Ero1b
Name: endoplasmic reticulum oxidoreductase 1 beta
Synonyms: 1700065B09Rik, 1300013B24Rik, Ero1lb
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 13
NCBI: 67475
VEGA: 13
Homologene: 8740
Or5b121
Name: olfactory receptor family 5 subfamily B member 121
Synonyms: GA_x6K02T2RE5P-3862389-3863336, MOR202-44, Olfr1480
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 19
NCBI: 404339
Homologene: 110492
Or13a26
Name: olfactory receptor family 13 subfamily A member 26
Synonyms: GA_x6K02T2PBJ9-42850324-42851256, MOR253-3, Olfr541
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 7
NCBI: 258964
Homologene: 138322
Bsg
Name: basigin
Synonyms: neurothelin, CD147, 5A11/Basigin, EMMPRIN, HT-7, gp 42
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 10
NCBI: 12215
HGNC: HGNC:1116
Homologene: 1308
Srd5a2
Name: steroid 5 alpha-reductase 2
Synonyms: 5ART2
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 17
NCBI: 94224
VEGA: 17
Homologene: 37292
Afg1l
Name: AFG1 like ATPase
Synonyms: Lace1
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 10
NCBI: 215951
Homologene: 5782
Creg2
Name: cellular repressor of E1A-stimulated genes 2
Synonyms: A830098L22Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 1
NCBI: 263764
Homologene: 17827
Ikzf2
Name: IKAROS family zinc finger 2
Synonyms: Helios, Zfpn1a2, A730095J18Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 1
NCBI: 22779
Homologene: 22659
Thap3
Name: THAP domain containing, apoptosis associated protein 3
Synonyms: 2210418H06Rik, 2010013E08Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 4
NCBI: 69876
Homologene: 18413
Lsmem1
Name: leucine-rich single-pass membrane protein 1
Synonyms: LOC380755, Gm889
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 12
NCBI: 380755
VEGA: 12
Homologene: 18800
Acox3
Name: acyl-Coenzyme A oxidase 3, pristanoyl
Synonyms: pristanoyl-CoA oxidase, PCOX, EST-s59
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 5
NCBI: 80911
HGNC: HGNC:121
Homologene: 37792
Gm7276
Name: predicted gene 7276
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 18
NCBI: 108168393
VEGA: 18
Genetic Alterations
ENU-induced transitions at the following base pair locations (GRCm38):
  • G to T, chromosome 1 at 17,621,502 bp
  • C to T, chromosome 1 at 39,623,204 bp
  • T to A, chromosome 1 at 69,538,814 bp
  • T to A, chromosome 1 at 127,817,656 bp
  • T to C, chromosome 1 at 152,533,575 bp
  • T to A, chromosome 1 at 160,959,423 bp
  • T to C, chromosome 1 at 190,937,467 bp
  • A to T, chromosome 2 at 18,208,790 bp
  • A to G, chromosome 2 at 24,877,464 bp
  • T to A, chromosome 2 at 35,720,278 bp
  • C to A, chromosome 2 at 76,830,856 bp
  • C to T, chromosome 2 at 110,733,898 bp
  • T to C, chromosome 2 at 111,306,771 bp
  • T to C, chromosome 2 at 111,408,753 bp
  • T to C, chromosome 2 at 146,035,319 bp
  • T to G, chromosome 3 at 32,534,322 bp
  • A to C, chromosome 3 at 32,590,039 bp
  • A to G, chromosome 3 at 79,515,149 bp
  • C to T, chromosome 3 at 96,651,738 bp
  • T to C, chromosome 3 at 135,594,957 bp
  • T to C, chromosome 4 at 42,970,215 bp
  • T to A, chromosome 4 at 129,657,471 bp
  • C to T, chromosome 4 at 151,985,704 bp
  • A to T, chromosome 5 at 5,736,498 bp
  • A to T, chromosome 5 at 35,603,027 bp
  • A to T, chromosome 5 at 96,598,909 bp
  • T to A, chromosome 5 at 118,749,748 bp
  • A to T, chromosome 6 at 18,434,983 bp
  • T to A, chromosome 6 at 52,736,912 bp
  • A to T, chromosome 6 at 57,978,461 bp
  • T to C, chromosome 6 at 73,124,778 bp
  • T to G, chromosome 6 at 141,839,577 bp
  • A to G, chromosome 7 at 16,429,580 bp
  • T to A, chromosome 7 at 25,092,724 bp
  • C to T, chromosome 7 at 29,036,078 bp
  • G to T, chromosome 7 at 90,475,971 bp
  • T to C, chromosome 7 at 107,074,274 bp
  • G to T, chromosome 7 at 140,704,794 bp
  • G to T, chromosome 8 at 70,078,930 bp
  • T to C, chromosome 8 at 79,372,029 bp
  • G to A, chromosome 8 at 104,737,555 bp
  • A to G, chromosome 8 at 111,479,362 bp
  • A to G, chromosome 8 at 119,601,100 bp
  • C to T, chromosome 9 at 38,367,566 bp
  • A to T, chromosome 9 at 44,316,775 bp
  • G to A, chromosome 9 at 69,759,822 bp
  • T to A, chromosome 10 at 42,426,577 bp
  • T to A, chromosome 10 at 42,798,728 bp
  • A to C, chromosome 10 at 61,302,887 bp
  • T to G, chromosome 10 at 79,711,518 bp
  • T to A, chromosome 10 at 94,188,183 bp
  • T to C, chromosome 10 at 125,997,701 bp
  • G to A, chromosome 11 at 3,675,885 bp
  • A to G, chromosome 11 at 4,919,792 bp
  • A to T, chromosome 11 at 35,234,906 bp
  • A to G, chromosome 11 at 104,721,114 bp
  • A to T, chromosome 11 at 118,121,495 bp
  • GTACATACATACATACATACATACATACA to GTACATACATACATACATACATACATACATACA, chromosome 12 at 40,185,261 bp
  • G to A, chromosome 12 at 50,394,926 bp
  • T to A, chromosome 12 at 70,255,113 bp
  • T to C, chromosome 13 at 12,579,261 bp
  • C to A, chromosome 13 at 55,631,971 bp
  • T to A, chromosome 13 at 99,431,929 bp
  • A to G, chromosome 13 at 100,693,573 bp
  • C to T, chromosome 14 at 33,099,182 bp
  • T to A, chromosome 14 at 55,786,351 bp
  • T to A, chromosome 14 at 118,034,251 bp
  • A to G, chromosome 14 at 122,459,527 bp
  • T to C, chromosome 15 at 47,696,789 bp
  • A to G, chromosome 15 at 97,806,525 bp
  • G to T, chromosome 15 at 98,256,915 bp
  • C to A, chromosome 16 at 17,776,488 bp
  • A to C, chromosome 16 at 38,510,717 bp
  • A to G, chromosome 17 at 8,898,870 bp
  • A to G, chromosome 17 at 21,509,504 bp
  • G to A, chromosome 17 at 24,377,842 bp
  • A to G, chromosome 17 at 73,188,004 bp
  • A to T, chromosome 17 at 74,021,481 bp
  • T to A, chromosome 18 at 34,628,591 bp
  • G to A, chromosome 18 at 50,160,215 bp
  • T to C, chromosome 18 at 62,412,234 bp
  • C to A, chromosome 18 at 77,185,570 bp
  • T to C, chromosome 19 at 4,087,107 bp
  • A to T, chromosome 19 at 13,529,838 bp
  • T to C, chromosome 19 at 20,727,461 bp
Genotype Determination
Phenotype
G1 male heterozygous mice are viable and fertile. The G1 mice were not characterized prior to archiving.
Strain Development
C57BL/6J mice were injected with ENU, resulting in G0 mice that were bred back to C57BL/6J. Sperm was archived from G1 male mice that produced viable G2 mice.
Suggested Control Mice
Wild-type littermates or C57BL/6J mice
MMRRC Genetic QC Summary
The MMRRC Centers have developed a genetic QC pipeline using MiniMUGA array genotyping to provide additional information on strain backgrounds for MMRRC congenic and inbred strains. For more information on when data may be available, or to request genotyping for a strain of interest, please contact mmrrc@missouri.edu. Older strains may not have this information.
Donor
Bruce Beutler, M.D., University of Texas Southwestern Medical Center.
Primary Reference
MUTAGENETIX record for R1665 (G1). B. Beutler and colleagues, Center for the Genetics of Host Defense, UT Southwestern, Dallas, TX.

Colony and Husbandry Information

Colony Surveillance Program and Current Health Reports

Mice recovered from a cryo-archive will have health surveillance performed on recipient females. Health reports will be provided prior to shipment. If you require additional health status information, please email mmrrc@missouri.edu .
Coat Color
Black
MMRRC Breeding System
Random intra-strain mating
Breeding Scheme(s)
When maintaining a live colony, heterozygous mice may be bred together, bred with wild-type siblings, or bred with C57BL/6J inbred mice.
Overall Breeding Performance
Undetermined; during development, mating was done with heterozygous males; viability, fertility and other breeding statistics for heterozygous females and homozygotes are unverified, but presumably would be similar to the C57BL/6J background strain
Average litter size
Undetermined
Recommended wean age
3 weeks

Order Request Information

Limited quantities of breeder mice (recovered litter) are available from a cryoarchive; recovered litter usually available to ship in 3 to 4 months.

Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

Distribution of this strain requires submission of the MMRRC Conditions of Use (COU). A link to the COU web form will be provided via email after an order has been placed; the form should be completed then or the email forwarded to your institutional official for completion.

The donor or their institution limits the distribution to non-profit institutions only.

Additional charges may apply for any special requests. Shipping costs are in addition to the basic distribution/resuscitation fees. Information on shipping costs and any additional charges will be provided by the supplying MMRRC facility.

Click button to Request this one strain. (Use the MMRRC Catalog Search to request more than one strain.)
MMRRC Item # Description Distribution Fee / Unit (US $)
*Shipping & Handling not included*
Units Notes
039701-MU-RESUS Litter recovered from cryo-archive $5,475.00 / Non-Profit Litter Recovered litter4; additional fees for any special requests.
Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

Some MMRRC strains were submitted by the donor as cryopreserved germplasm, and because these strains were not cryopreserved by the MMRRC, we have not assessed the quality, nor genotype, of this material. Our expertise in reviving mice from various qualities of frozen sperm and embryos, using methods like IVF and ICSI, gives us confidence in successful recoveries in most cases. However, due to the uncertain quality of these samples, we'll limit revival attempts to two per order. Additional attempts are available for a fee, on top of standard charges, if requested. It's important to note that some strains may lack the expected mutation, so we can't assure successful order fulfillment until we attempt to revive the strain.

1 The distribution fee covers the expense of rederiving mice from a live mouse; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

2 An aliquot contains a sufficient number of embryos (in one or more vials or straws and based on the transfer success rate of the MMRRC facility) to transfer into one to three recipients. The MMRRC makes no guarantee concerning embryo transfer success experienced in the recipient investigator's laboratory. Neither gender nor genotype ratios are guaranteed.

3 An aliquot is one straw or vial with sufficient sperm to recover at least one litter of mice, as per provided protocols, when performed at the MMRRC facility. The MMRRC makes no guarantee concerning the success of these procedures when performed outside the MMRRC facilities.

4 The distribution fee covers the expense of resuscitating mice from the cryo-archive; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

To request material from the MMRRC: Please fill out our on-line request form (accessible from the catalog search results page, or click the Request this Strain button in the fees section). If you have questions or need assistance completing this form, you may call Customer Service at (800) 910-2291 (in USA or Canada) or (530) 757-5710 (international calls). Before you call, please have with you: the MMRRC item number, quantity needed, Bill-to and Ship-to contact information.