MMRRC:039701-MU

G to T, chromosome 1 at 17,621,502 bp
C to T, chromosome 1 at 39,623,204 bp
T to A, chromosome 1 at 69,538,814 bp
T to A, chromosome 1 at 127,817,656 bp
T to C, chromosome 1 at 152,533,575 bp
T to A, chromosome 1 at 160,959,423 bp
T to C, chromosome 1 at 190,937,467 bp
A to T, chromosome 2 at 18,208,790 bp
A to G, chromosome 2 at 24,877,464 bp
T to A, chromosome 2 at 35,720,278 bp
C to A, chromosome 2 at 76,830,856 bp
C to T, chromosome 2 at 110,733,898 bp
T to C, chromosome 2 at 111,306,771 bp
T to C, chromosome 2 at 111,408,753 bp
T to C, chromosome 2 at 146,035,319 bp
T to G, chromosome 3 at 32,534,322 bp
A to C, chromosome 3 at 32,590,039 bp
A to G, chromosome 3 at 79,515,149 bp
C to T, chromosome 3 at 96,651,738 bp
T to C, chromosome 3 at 135,594,957 bp
T to C, chromosome 4 at 42,970,215 bp
T to A, chromosome 4 at 129,657,471 bp
C to T, chromosome 4 at 151,985,704 bp
A to T, chromosome 5 at 5,736,498 bp
A to T, chromosome 5 at 35,603,027 bp
A to T, chromosome 5 at 96,598,909 bp
T to A, chromosome 5 at 118,749,748 bp
A to T, chromosome 6 at 18,434,983 bp
T to A, chromosome 6 at 52,736,912 bp
A to T, chromosome 6 at 57,978,461 bp
T to C, chromosome 6 at 73,124,778 bp
T to G, chromosome 6 at 141,839,577 bp
A to G, chromosome 7 at 16,429,580 bp
T to A, chromosome 7 at 25,092,724 bp
C to T, chromosome 7 at 29,036,078 bp
G to T, chromosome 7 at 90,475,971 bp
T to C, chromosome 7 at 107,074,274 bp
G to T, chromosome 7 at 140,704,794 bp
G to T, chromosome 8 at 70,078,930 bp
T to C, chromosome 8 at 79,372,029 bp
G to A, chromosome 8 at 104,737,555 bp
A to G, chromosome 8 at 111,479,362 bp
A to G, chromosome 8 at 119,601,100 bp
C to T, chromosome 9 at 38,367,566 bp
A to T, chromosome 9 at 44,316,775 bp
G to A, chromosome 9 at 69,759,822 bp
T to A, chromosome 10 at 42,426,577 bp
T to A, chromosome 10 at 42,798,728 bp
A to C, chromosome 10 at 61,302,887 bp
T to G, chromosome 10 at 79,711,518 bp
T to A, chromosome 10 at 94,188,183 bp
T to C, chromosome 10 at 125,997,701 bp
G to A, chromosome 11 at 3,675,885 bp
A to G, chromosome 11 at 4,919,792 bp
A to T, chromosome 11 at 35,234,906 bp
A to G, chromosome 11 at 104,721,114 bp
A to T, chromosome 11 at 118,121,495 bp
GTACATACATACATACATACATACATACA to GTACATACATACATACATACATACATACATACA, chromosome 12 at 40,185,261 bp
G to A, chromosome 12 at 50,394,926 bp
T to A, chromosome 12 at 70,255,113 bp
T to C, chromosome 13 at 12,579,261 bp
C to A, chromosome 13 at 55,631,971 bp
T to A, chromosome 13 at 99,431,929 bp
A to G, chromosome 13 at 100,693,573 bp
C to T, chromosome 14 at 33,099,182 bp
T to A, chromosome 14 at 55,786,351 bp
T to A, chromosome 14 at 118,034,251 bp
A to G, chromosome 14 at 122,459,527 bp
T to C, chromosome 15 at 47,696,789 bp
A to G, chromosome 15 at 97,806,525 bp
G to T, chromosome 15 at 98,256,915 bp
C to A, chromosome 16 at 17,776,488 bp
A to C, chromosome 16 at 38,510,717 bp
A to G, chromosome 17 at 8,898,870 bp
A to G, chromosome 17 at 21,509,504 bp
G to A, chromosome 17 at 24,377,842 bp
A to G, chromosome 17 at 73,188,004 bp
A to T, chromosome 17 at 74,021,481 bp
T to A, chromosome 18 at 34,628,591 bp
G to A, chromosome 18 at 50,160,215 bp
T to C, chromosome 18 at 62,412,234 bp
C to A, chromosome 18 at 77,185,570 bp
T to C, chromosome 19 at 4,087,107 bp
A to T, chromosome 19 at 13,529,838 bp
T to C, chromosome 19 at 20,727,461 bp

Genotype Determination

Genotyping Protocol(s)
Center protocol and contact for technical support will be shipped with mice.

Strain Description [Including phenotype, strain background, strain development and suggested control mice]

Phenotype

G1 male heterozygous mice are viable and fertile. The G1 mice were not characterized prior to archiving.

Strain GQC Summary

Gene Specific Genotyping:

To request gene-specific and other genotyping services for a strain, please contact the distribution MMRRC Center for more information.

Background Genetic Quality:

The MMRRC has developed a Genetic Quality Control pipeline using the MiniMUGA array to provide additional information to identify and validate genetic backgrounds of MMRRC strains. For more information on whether genetic background data is available, please contact MMRRC_GeneticQC@med.unc.edu. Note: that MiniMUGA genetic background data is not available on all strains, but can be ordered if desired.

Suggested Control Mice

Littermates of all relevant genotypes.

Strain Origin

Donor

Bruce Beutler, M.D., University of Texas Southwestern Medical Center.

Primary Reference

MUTAGENETIX record for R1665 (G1). B. Beutler and colleagues, Center for the Genetics of Host Defense, UT Southwestern, Dallas, TX.

Strain Development

C57BL/6J mice were injected with ENU, resulting in G0 mice that were bred back to C57BL/6J. Sperm was archived from G1 male mice that produced viable G2 mice.

Disclaimer: If MMRRC Strain Genetic Quality Control (GQC; based on MiniMUGA genotyping and analysis) has been completed for this strain, the information might differ from the genetic background information provided by the submitter. MiniMUGA genetic analysis is done on a strain’s tissue samples taken when archived by or ordered from the assigned MMRRC Center.

Colony and Husbandry Information Expand All

Health Status Report

Colony Surveillance Program and Current Health Reports

Mice recovered from a cryo-archive will have health surveillance performed on recipient females. Health reports will be provided prior to shipment. If you require additional health status information, please email mmrrc@missouri.edu.

Appearance

Coat Color

Black

Breeding

MMRRC Breeding System

Random intra-strain mating

Breeding Scheme(s)

When maintaining a live colony, heterozygous mice may be bred together, bred with wild-type siblings, or bred with C57BL/6J inbred mice.

Overall Breeding Performance

Undetermined; during development, mating was done with heterozygous males; viability, fertility and other breeding statistics for heterozygous females and homozygotes are unverified, but presumably would be similar to the C57BL/6J background strain

Reproductive Statistics

Average litter size

Undetermined

Recommended wean age

3 weeks

Order Information Expand All

Availability Level

Limited quantities of breeder mice (recovered litter) are available from a cryoarchive; recovered litter usually available to ship in 3 to 4 months.

Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

Conditions of Distribution [Including applicable technology transfer agreements]

Distribution of this strain requires submission of the MMRRC Conditions of Use (COU). A link to the COU web form will be provided via email after an order has been placed; the form should be completed then or the email forwarded to your institutional official for completion.

The donor or their institution limits the distribution to non-profit institutions only.

Fees

Additional charges may apply for any special requests. Shipping costs are in addition to the basic distribution/resuscitation fees. Information on shipping costs and any additional charges will be provided by the supplying MMRRC facility.

Click button to Request this one strain. (Use the MMRRC Catalog Search to request more than one strain.)

MMRRC Item #	Description	Distribution Fee / Unit (US $) Shipping & Handling not included	Units	Notes
039701-MU-RESUS	Litter recovered from cryo-archive	$5,475.00 / Non-Profit	Litter	Recovered litter⁴; additional fees for any special requests.
Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

Some MMRRC strains were submitted by the donor as cryopreserved germplasm, and because these strains were not cryopreserved by the MMRRC, we have not assessed the quality, nor genotype, of this material. Our expertise in reviving mice from various qualities of frozen sperm and embryos, using methods like IVF and ICSI, gives us confidence in successful recoveries in most cases. However, due to the uncertain quality of these samples, we'll limit revival attempts to two per order. Additional attempts are available for a fee, on top of standard charges, if requested. It's important to note that some strains may lack the expected mutation, so we can't assure successful order fulfillment until we attempt to revive the strain.

¹ The distribution fee covers the expense of rederiving mice from a live mouse; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

² An aliquot contains a sufficient number of embryos (in one or more vials or straws and based on the transfer success rate of the MMRRC facility) to transfer into one to three recipients. The MMRRC makes no guarantee concerning embryo transfer success experienced in the recipient investigator's laboratory. Neither gender nor genotype ratios are guaranteed.

³ An aliquot is one straw or vial with sufficient sperm to recover at least one litter of mice, as per provided protocols, when performed at the MMRRC facility. The MMRRC makes no guarantee concerning the success of these procedures when performed outside the MMRRC facilities.

⁴ The distribution fee covers the expense of resuscitating mice from the cryo-archive; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

To request material from the MMRRC: Please fill out our on-line request form (accessible from the catalog search results page, or click the Request this Strain button in the fees section). If you have questions or need assistance completing this form, you may call Customer Service at (800) 910-2291 (in USA or Canada) or (530) 757-5710 (international calls). Before you call, please have with you: the MMRRC item number, quantity needed, Bill-to and Ship-to contact information.

Strain Detail Sheet

Strain Information Expand All

Colony and Husbandry Information Expand All

Order Information Expand All