Strain Name:
C57BL/6J-MtgxR1669Btlr/Mmmh
Stock Number:
039705-MU
Citation ID:
RRID:MMRRC_039705-MU
Other Names:
R1669 (G1), C57BL/6J-MtgxR1669Btlr
Major Collection:

Gene Information

Hfe
Name: homeostatic iron regulator
Synonyms: MR2
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 13
NCBI: 15216
HGNC: HGNC:4886
Homologene: 88330
Cds2
Name: CDP-diacylglycerol synthase (phosphatidate cytidylyltransferase) 2
Synonyms: 5730460C18Rik, 5730450N06Rik, D2Wsu127e
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 2
NCBI: 110911
HGNC: HGNC:1801
Homologene: 37854
Evl
Name: Ena-vasodilator stimulated phosphoprotein
Synonyms: b2b2600Clo
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 12
NCBI: 14026
VEGA: 12
Homologene: 56752
Rtn4rl1
Name: reticulon 4 receptor-like 1
Synonyms: Ngrl2, Ngrh2, Ngr3
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 11
NCBI: 237847
Homologene: 18611
Cacna1h
Name: calcium channel, voltage-dependent, T type, alpha 1H subunit
Synonyms: T-type Cav3.2, Cav3.2, alpha13.2
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 17
NCBI: 58226
HGNC: HGNC:1395
Homologene: 56913
Lyst
Name: lysosomal trafficking regulator
Synonyms: D13Sfk13
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 13
NCBI: 17101
VEGA: 13
HGNC: HGNC:1968
Homologene: 61
Mmp10
Name: matrix metallopeptidase 10
Synonyms: stromelysin 2
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 9
NCBI: 17384
VEGA: 9
HGNC: HGNC:7156
Homologene: 20546
Ptprf
Name: protein tyrosine phosphatase, receptor type, F
Synonyms: LAR, RPTP-LAR
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 4
NCBI: 19268
HGNC: HGNC:9670
Homologene: 20623
Dop1b
Name: DOP1 leucine zipper like protein B
Synonyms: Dopey2, 0610038M01Rik, 2610510B01Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 16
NCBI: 70028
VEGA: 16
HGNC: HGNC:1291
Homologene: 21068
Prkdc
Name: protein kinase, DNA activated, catalytic polypeptide
Synonyms: XRCC7, DNA-PK, DOXNPH, slip, dxnph, DNAPDcs, DNA-PKcs
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 16
NCBI: 19090
HGNC: HGNC:9413
Homologene: 5037
Lrrc2
Name: leucine rich repeat containing 2
Synonyms: 2400002D05Rik, 4933431K03Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 9
NCBI: 74249
Homologene: 23454
Scn8a
Name: sodium channel, voltage-gated, type VIII, alpha
Synonyms: NMF335, Nav1.6, mnd-2, NaCh6, motor end-plate disease, nmf2, seal, ataxia 3, mnd2, nur14, nmf58, C630029C19Rik, med, nmf335
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 15
NCBI: 20273
Homologene: 7927
Usp48
Name: ubiquitin specific peptidase 48
Synonyms: Usp31, D330022K21Rik, 2810449C13Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 4
NCBI: 170707
Homologene: 12988
Usp25
Name: ubiquitin specific peptidase 25
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 16
NCBI: 30940
VEGA: 16
Homologene: 8374
Ezr
Name: ezrin
Synonyms: ezrin, p81, cytovillin, Vil2
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 17
NCBI: 22350
Homologene: 55740
Slc12a2
Name: solute carrier family 12, member 2
Synonyms: mBSC2, sy-ns, Nkcc1, sodium/potassium/chloride cotransporters
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 18
NCBI: 20496
VEGA: 18
Homologene: 20283
Chaf1a
Name: chromatin assembly factor 1, subunit A (p150)
Synonyms: CAF-1
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 17
NCBI: 27221
VEGA: 17
HGNC: HGNC:1910
Homologene: 4003
Gapvd1
Name: GTPase activating protein and VPS9 domains 1
Synonyms: 2010005B09Rik, 4432404J10Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 2
NCBI: 66691
Homologene: 32637
Dact1
Name: dishevelled-binding antagonist of beta-catenin 1
Synonyms: Frodo, THYEX3, Dapper1, Frodo1, Frd1
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 12
NCBI: 59036
Homologene: 9613
Ap3d1
Name: adaptor-related protein complex 3, delta 1 subunit
Synonyms: Bolvr, mBLVR1
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 10
NCBI: 11776
VEGA: 10
HGNC: HGNC:568
Homologene: 2926
Ash1l
Name: ASH1 like histone lysine methyltransferase
Synonyms: E430018P19Rik, chromatin remodeling factor, 8030453L17Rik, KMT2H
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 3
NCBI: 192195
Homologene: 10225
Ano10
Name: anoctamin 10
Synonyms: Tmem16k
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 9
NCBI: 102566
VEGA: 9
Homologene: 14314
Dusp11
Name: dual specificity phosphatase 11 (RNA/RNP complex 1-interacting)
Synonyms: 2010300F21Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 6
NCBI: 72102
HGNC: HGNC:3066
Homologene: 31183
Hpcal4
Name: hippocalcin-like 4
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 4
NCBI: 170638
Homologene: 9441
Aplp2
Name: amyloid beta (A4) precursor-like protein 2
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 9
NCBI: 11804
VEGA: 9
HGNC: HGNC:598
Homologene: 20396
Rnf4
Name: ring finger protein 4
Synonyms: Gtrgeo8
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 5
NCBI: 19822
Homologene: 37711
Slc12a7
Name: solute carrier family 12, member 7
Synonyms: Kcc4
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 13
NCBI: 20499
VEGA: 13
Homologene: 21312
Cpsf3
Name: cleavage and polyadenylation specificity factor 3
Synonyms: 73 kDa
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 12
NCBI: 54451
VEGA: 12
HGNC: HGNC:2326
Homologene: 6499
Ncstn
Name: nicastrin
Synonyms: 9430068N19Rik, Nct, D1Dau13e, nicastrin
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 1
NCBI: 59287
Homologene: 41029
Morc2a
Name: microrchidia 2A
Synonyms: 8430403M08Rik, Zcwcc1
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 11
NCBI: 74522
Homologene: 8966
Hectd3
Name: HECT domain E3 ubiquitin protein ligase 3
Synonyms: 1700064K09Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 4
NCBI: 76608
Homologene: 18426
Cxcl13
Name: chemokine (C-X-C motif) ligand 13
Synonyms: ANGIE2, BLC, 4631412M08Rik, BCA-1, Scyb13
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 5
NCBI: 55985
Homologene: 48431
Spink5
Name: serine peptidase inhibitor, Kazal type 5
Synonyms: LEKT1, 2310065D10Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 18
NCBI: 72432
Homologene: 4987
Bicdl1
Name: BICD family like cargo adaptor 1
Synonyms: 2210403N09Rik, Ccdc64, BICDR-1
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 5
NCBI: 75665
Homologene: 18013
Sppl2a
Name: signal peptide peptidase like 2A
Synonyms: 2010106G01Rik, C130089K23Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 2
NCBI: 66552
Homologene: 36411
Cacna2d2
Name: calcium channel, voltage-dependent, alpha 2/delta subunit 2
Synonyms: a2d2
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 9
NCBI: 56808
HGNC: HGNC:1400
Homologene: 4400
Ttn
Name: titin
Synonyms: mdm, 2310036G12Rik, D830007G01Rik, shru, L56, 2310074I15Rik, 2310057K23Rik, connectin, D330041I19Rik, 1100001C23Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 2
NCBI: 22138
Homologene: 130650
Nlgn1
Name: neuroligin 1
Synonyms: 6330415N05Rik, Nlg1, NL1
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 3
NCBI: 192167
Homologene: 56690
Msh4
Name: mutS homolog 4
Synonyms: mMsh4, 4930485C04Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 3
NCBI: 55993
HGNC: HGNC:7327
Homologene: 1830
Depdc1a
Name: DEP domain containing 1a
Synonyms: 5830484J08Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 3
NCBI: 76131
Homologene: 9834
Sorcs1
Name: sortilin-related VPS10 domain containing receptor 1
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 19
NCBI: 58178
Homologene: 10967
Cd180
Name: CD180 antigen
Synonyms: Ly78, RP105
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 13
NCBI: 17079
HGNC: HGNC:6726
Homologene: 4077
Zfp608
Name: zinc finger protein 608
Synonyms: 4932417D18Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 18
NCBI: 269023
VEGA: 18
Homologene: 18485
Srgap3
Name: SLIT-ROBO Rho GTPase activating protein 3
Synonyms: Arhgap14, D130026O08Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 6
NCBI: 259302
Homologene: 56686
Slc1a1
Name: solute carrier family 1 (neuronal/epithelial high affinity glutamate transporter, system Xag), member 1
Synonyms: EAAT3, D130048G10Rik, EAAC1, MEAAC1
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 19
NCBI: 20510
Homologene: 20881
Oog3
Name: oogenesin 3
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 4
NCBI: 100012
Homologene: 129883
Slc16a12
Name: solute carrier family 16 (monocarboxylic acid transporters), member 12
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 19
NCBI: 240638
Homologene: 130007
Gm6614
Name: predicted gene 6614
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 6
NCBI: 625716
Homologene: 87075
Itgb4
Name: integrin beta 4
Synonyms: CD104
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 11
NCBI: 192897
HGNC: HGNC:6158
Homologene: 179
Mroh2b
Name: maestro heat-like repeat family member 2B
Synonyms: 4930455B06Rik, Heatr7b2
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 15
NCBI: 223825
VEGA: 15
Homologene: 128807
Vwf
Name: Von Willebrand factor
Synonyms: 6820430P06Rik, B130011O06Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 6
NCBI: 22371
Homologene: 466
Myh2
Name: myosin, heavy polypeptide 2, skeletal muscle, adult
Synonyms: MyHC-IIa, Myhsf1, Myhs-f, Myhs-f1, MHC2A
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 11
NCBI: 17882
HGNC: HGNC:7572
Homologene: 23019
Ros1
Name: Ros1 proto-oncogene
Synonyms: c-ros, Ros-1
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 10
NCBI: 19886
Homologene: 2207
Sema3d
Name: sema domain, immunoglobulin domain (Ig), short basic domain, secreted, (semaphorin) 3D
Synonyms: 4631426B19Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 5
NCBI: 108151
Homologene: 23664
Gm10267
Name: predicted gene 10267
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 18
NCBI: 100042855
Homologene: 104911
Kdm1b
Name: lysine (K)-specific demethylase 1B
Synonyms: 4632428N09Rik, Aof1
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 13
NCBI: 218214
Homologene: 14695
Abcc9
Name: ATP-binding cassette, sub-family C (CFTR/MRP), member 9
Synonyms: SUR2B, Sur2, SUR2A
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 6
NCBI: 20928
HGNC: HGNC:60
Homologene: 56521
Rasal3
Name: RAS protein activator like 3
Synonyms: A430107D22Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 17
NCBI: 320484
Homologene: 18901
C4b
Name: complement component 4B (Chido blood group)
Synonyms: Ss, C4
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 17
NCBI: 12268
Homologene: 36030
Klra8
Name: killer cell lectin-like receptor, subfamily A, member 8
Synonyms: Ly49h, Cmv-1, Cmv1, Ly49u129
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 6
NCBI: 16639
Homologene: 110821
Arhgef4
Name: Rho guanine nucleotide exchange factor (GEF) 4
Synonyms: 9330140K16Rik, Asef, C230030N03Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 1
NCBI: 226970
HGNC: HGNC:684
Homologene: 49414
Olfr1361
Name: olfactory receptor 1361
Synonyms: MOR256-12, GA_x6K02T2QHY8-11577590-11578528
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 13
NCBI: 258534
Homologene: 88362
Fam227a
Name: family with sequence similarity 227, member A
Synonyms: 4933432B09Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 15
NCBI: 75729
Homologene: 123434
Zfp366
Name: zinc finger protein 366
Synonyms: DC-SCRIPT
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 13
NCBI: 238803
Homologene: 17637
Wrap73
Name: WD repeat containing, antisense to Trp73
Synonyms: 2610044M17Rik, 5330425N03Rik, Wdr8, DD57
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 4
NCBI: 59002
Homologene: 9857
Kctd1
Name: potassium channel tetramerisation domain containing 1
Synonyms: 4933402K10Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 18
NCBI: 106931
VEGA: 18
Homologene: 65999
Olfr1261
Name: olfactory receptor 1261
Synonyms: MOR234-3, GA_x6K02T2Q125-51425355-51426275
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 2
NCBI: 258466
Homologene: 138310
Gm13088
Name: predicted gene 13088
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 4
NCBI: 277668
Homologene: 129883
Mmp13
Name: matrix metallopeptidase 13
Synonyms: interstitial collagenase, collagenase-1, Collagenase-3, Clg, Mmp1, MMP-13
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 9
NCBI: 17386
VEGA: 9
HGNC: HGNC:7159
Homologene: 20548
P2ry6
Name: pyrimidinergic receptor P2Y, G-protein coupled, 6
Synonyms: P2Y6, 2010204J23Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 7
NCBI: 233571
HGNC: HGNC:8543
Homologene: 14289
Ublcp1
Name: ubiquitin-like domain containing CTD phosphatase 1
Synonyms: 8430435I17Rik, 4930527B16Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 11
NCBI: 79560
Homologene: 16796
Slc24a3
Name: solute carrier family 24 (sodium/potassium/calcium exchanger), member 3
Synonyms: NCKX3
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 2
NCBI: 94249
Homologene: 41390
Olfr643
Name: olfactory receptor 643
Synonyms: MOR13-2, GA_x6K02T2PBJ9-6793628-6792684
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 7
NCBI: 259081
Homologene: 17491
Olfr13
Name: olfactory receptor 13
Synonyms: GA_x6K02T2P3E9-4384160-4383228, MOR261-6
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 6
NCBI: 18310
Homologene: 27232
Kcnh8
Name: potassium voltage-gated channel, subfamily H (eag-related), member 8
Synonyms: Kv12.1, C130090D05Rik, ELK1
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 17
NCBI: 211468
Homologene: 14332
Olfr1447
Name: olfactory receptor 1447
Synonyms: MOR202-3, GA_x6K02T2RE5P-3231251-3230331
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 19
NCBI: 258698
Homologene: 74233
Nox4
Name: NADPH oxidase 4
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 7
NCBI: 50490
HGNC: HGNC:7891
Homologene: 41065
Prkd1
Name: protein kinase D1
Synonyms: Pkcm, PKD1, Prkcm
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 12
NCBI: 18760
VEGA: 12
HGNC: HGNC:9407
Homologene: 55680
Vmn2r124
Name: vomeronasal 2, receptor 124
Synonyms: Gm7196, Vmn2r-ps113
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 17
NCBI: 637021
Homologene: 115024
Lca5l
Name: Leber congenital amaurosis 5-like
Synonyms: 4921526F01Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 16
NCBI: 385668
HGNC: HGNC:1255
Homologene: 47978
Arhgap11a
Name: Rho GTPase activating protein 11A
Synonyms: 6530401L14Rik, GAP (1-12)
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 2
NCBI: 228482
Homologene: 8862
Zfp69
Name: zinc finger protein 69
Synonyms: LOC381549, Zfp63, KRAB2
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 4
NCBI: 381549
Homologene: 45693
Card10
Name: caspase recruitment domain family, member 10
Synonyms: Bimp1, CARMA3
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 15
NCBI: 105844
Homologene: 8728
Kif1c
Name: kinesin family member 1C
Synonyms: D11Bwg1349e, Orch3, B430105J22Rik, N-3 kinsin
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 11
NCBI: 16562
HGNC: HGNC:6317
Homologene: 4821
Olfr518
Name: olfactory receptor 518
Synonyms: MOR268-5, GA_x6K02T2PBJ9-11211854-11210853
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 7
NCBI: 258303
HGNC: HGNC:8162
Homologene: 133601
Pgc
Name: progastricsin (pepsinogen C)
Synonyms: 2210410L06Rik, Upg1, Upg-1
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 17
NCBI: 109820
HGNC: HGNC:8890
Homologene: 55669
Snai2
Name: snail family zinc finger 2
Synonyms: Snail2, Slugh, Slug
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 16
NCBI: 20583
VEGA: 16
Homologene: 31127
Nedd9
Name: neural precursor cell expressed, developmentally down-regulated gene 9
Synonyms: HEF1, Cas-L, E230025G09Rik, CasL
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 13
NCBI: 18003
VEGA: 13
HGNC: HGNC:7733
Homologene: 4669
Zfp995
Name: zinc finger protein 995
Synonyms: 2210404O09Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 17
NCBI: 70081
Homologene: 133253
Lsmem1
Name: leucine-rich single-pass membrane protein 1
Synonyms: Gm889, LOC380755
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 12
NCBI: 380755
VEGA: 12
Homologene: 18800
F830104G03Rik
Name: RIKEN cDNA F830104G03 gene
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 3
Coprs
Name: coordinator of PRMT5, differentiation stimulator
Synonyms: COPR5, 2410022L05Rik, MGC11316, 1700029I03Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 8
NCBI: 66423
Homologene: 10180
Hoxc13
Name: homeobox C13
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 15
NCBI: 15422
HGNC: HGNC:5125
Homologene: 7770
Tmem223
Name: transmembrane protein 223
Synonyms: 0610006I08Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 19
NCBI: 66836
VEGA: 19
Homologene: 136402
Oosp3
Name: oocyte secreted protein 3
Synonyms: Gm97, LOC225923
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 19
NCBI: 225923
Genetic Alterations
ENU-induced transitions at the following base pair locations (GRCm38):
  • A to T, chromosome 1 at 34,732,158 bp
  • A to G, chromosome 1 at 172,074,905 bp
  • T to G, chromosome 2 at 34,730,682 bp
  • T to C, chromosome 2 at 76,724,463 bp
  • T to A, chromosome 2 at 89,993,800 bp
  • T to C, chromosome 2 at 113,841,912 bp
  • T to A, chromosome 2 at 126,917,794 bp
  • T to A, chromosome 2 at 132,295,519 bp
  • C to T, chromosome 2 at 145,613,592 bp
  • C to A, chromosome 3 at 25,436,134 bp
  • A to G, chromosome 3 at 56,890,577 bp
  • G to A, chromosome 3 at 89,067,242 bp
  • C to T, chromosome 3 at 153,876,720 bp
  • A to G, chromosome 3 at 159,522,924 bp
  • T to A, chromosome 4 at 116,999,643 bp
  • C to T, chromosome 4 at 118,211,494 bp
  • C to T, chromosome 4 at 120,947,498 bp
  • T to C, chromosome 4 at 123,189,076 bp
  • T to C, chromosome 4 at 137,593,893 bp
  • T to G, chromosome 4 at 143,654,346 bp
  • C to A, chromosome 4 at 144,158,438 bp
  • A to G, chromosome 4 at 154,156,131 bp
  • T to A, chromosome 5 at 12,508,084 bp
  • T to C, chromosome 5 at 34,351,280 bp
  • T to A, chromosome 5 at 95,958,741 bp
  • C to A, chromosome 5 at 115,656,016 bp
  • T to A, chromosome 6 at 43,174,821 bp
  • A to T, chromosome 6 at 85,950,026 bp
  • G to A, chromosome 6 at 112,722,904 bp
  • T to C, chromosome 6 at 125,647,906 bp
  • A to T, chromosome 6 at 130,115,629 bp
  • T to A, chromosome 6 at 141,987,689 bp
  • A to G, chromosome 6 at 142,656,686 bp
  • C to A, chromosome 7 at 87,295,889 bp
  • A to G, chromosome 7 at 100,938,423 bp
  • A to T, chromosome 7 at 104,059,309 bp
  • T to A, chromosome 7 at 108,880,713 bp
  • C to T, chromosome 8 at 13,885,704 bp
  • A to G, chromosome 9 at 7,277,926 bp
  • A to T, chromosome 9 at 7,505,525 bp
  • G to T, chromosome 9 at 31,167,733 bp
  • C to T, chromosome 9 at 107,517,496 bp
  • A to G, chromosome 9 at 110,981,650 bp
  • A to C, chromosome 9 at 122,257,183 bp
  • A to T, chromosome 10 at 52,161,811 bp
  • A to G, chromosome 10 at 80,710,836 bp
  • G to A, chromosome 11 at 3,675,885 bp
  • A to G, chromosome 11 at 44,456,500 bp
  • G to A, chromosome 11 at 67,191,339 bp
  • C to T, chromosome 11 at 70,728,397 bp
  • A to G, chromosome 11 at 75,265,927 bp
  • G to A, chromosome 11 at 115,991,330 bp
  • T to A, chromosome 12 at 21,305,331 bp
  • GTACATACATACATACATACATACATACA to GTACATACATACATACATACATACATACATACA, chromosome 12 at 40,185,261 bp
  • G to A, chromosome 12 at 50,394,926 bp
  • C to T, chromosome 12 at 71,318,773 bp
  • A to G, chromosome 12 at 108,679,904 bp
  • G to A, chromosome 13 at 13,644,087 bp
  • A to T, chromosome 13 at 21,659,286 bp
  • A to T, chromosome 13 at 23,706,127 bp
  • A to T, chromosome 13 at 41,311,794 bp
  • C to T, chromosome 13 at 47,068,548 bp
  • C to T, chromosome 13 at 73,795,113 bp
  • T to C, chromosome 13 at 99,229,561 bp
  • C to T, chromosome 13 at 102,705,490 bp
  • C to A, chromosome 15 at 4,908,493 bp
  • T to C, chromosome 15 at 78,793,953 bp
  • G to A, chromosome 15 at 79,620,677 bp
  • T to G, chromosome 15 at 101,011,120 bp
  • T to C, chromosome 15 at 102,927,160 bp
  • A to T, chromosome 16 at 14,707,044 bp
  • T to A, chromosome 16 at 15,734,058 bp
  • T to C, chromosome 16 at 77,076,531 bp
  • T to A, chromosome 16 at 93,769,660 bp
  • T to C, chromosome 16 at 96,159,808 bp
  • T to C, chromosome 17 at 6,739,313 bp
  • T to A, chromosome 17 at 18,062,944 bp
  • T to C, chromosome 17 at 21,879,964 bp
  • C to A, chromosome 17 at 25,383,471 bp
  • T to C, chromosome 17 at 32,403,098 bp
  • C to T, chromosome 17 at 34,729,680 bp
  • C to A, chromosome 17 at 47,733,790 bp
  • T to A, chromosome 17 at 52,893,968 bp
  • C to A, chromosome 17 at 56,063,339 bp
  • T to C, chromosome 18 at 15,062,460 bp
  • T to A, chromosome 18 at 43,969,278 bp
  • T to C, chromosome 18 at 44,157,300 bp
  • C to T, chromosome 18 at 54,987,739 bp
  • T to C, chromosome 18 at 57,904,235 bp
  • A to G, chromosome 19 at 8,772,131 bp
  • C to T, chromosome 19 at 11,701,014 bp
  • A to T, chromosome 19 at 12,901,288 bp
  • C to A, chromosome 19 at 28,911,794 bp
  • T to A, chromosome 19 at 34,680,381 bp
  • A to C, chromosome 19 at 50,475,422 bp
Genotype Determination
Phenotype
G1 male heterozygous mice are viable and fertile. The G1 mice were not characterized prior to archiving.
Strain Development
C57BL/6J mice were injected with ENU, resulting in G0 mice that were bred back to C57BL/6J. Sperm was archived from G1 male mice that produced viable G2 mice.
Suggested Control Mice
Wild-type littermates or C57BL/6J mice
Donor
Bruce Beutler, M.D., University of Texas Southwestern Medical Center.
Primary Reference
MUTAGENETIX record for R1669 (G1). B. Beutler and colleagues, Center for the Genetics of Host Defense, UT Southwestern, Dallas, TX.

Colony and Husbandry Information

Colony Surveillance Program and Current Health Reports

Mice recovered from a cryo-archive will have health surveillance performed on recipient females. Health reports will be provided prior to shipment. If you require additional health status information, please email mmrrc@missouri.edu .
Coat Color
Black
MMRRC Breeding System
Random intra-strain mating
Breeding Scheme(s)
When maintaining a live colony, heterozygous mice may be bred together, bred with wild-type siblings, or bred with C57BL/6J inbred mice.
Overall Breeding Performance
Undetermined; during development, mating was done with heterozygous males; viability, fertility and other breeding statistics for heterozygous females and homozygotes are unverified, but presumably would be similar to the C57BL/6J background strain
Average litter size
Undetermined
Recommended wean age
3 weeks

Order Request Information

Limited quantities of breeder mice (recovered litter) are available from a cryoarchive; recovered litter usually available to ship in 3 to 4 months.

Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

Distribution of this strain requires submission of the MMRRC Conditions of Use (COU). A link to the COU web form will be provided via email after an order has been placed; the form should be completed then or the email forwarded to your institutional official for completion.

The donor or their institution limits the distribution to non-profit institutions only.

Additional charges may apply for any special requests. Shipping costs are in addition to the basic distribution/resuscitation fees. Information on shipping costs and any additional charges will be provided by the supplying MMRRC facility.

Click button to Request this one strain. (Use the MMRRC Catalog Search to request more than one strain.)
MMRRC Item # Description Distribution Fee / Unit (US $) Units Notes
039705-MU-RESUS Litter recovered from cryo-archive $5,475.00 / Non-Profit Litter Recovered litter4; additional fees for any special requests.
Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

Some MMRRC strains were submitted by the donor as cryopreserved germplasm, and because these strains were not cryopreserved by the MMRRC, we have not assessed the quality of this material. We have extensive experience with recovery of mice from cryopreserved sperm and embryos of varying quality, including using techniques such as IVF and ICSI, and are confident that we will have success in most, if not all, cases. However, because of the unknown quality of these frozen samples, we will restrict recovery efforts to two attempts for each order. Subsequent attempts can be performed on a fee-for-service basis, in addition to the standard fees, upon request.

1 The distribution fee covers the expense of rederiving mice from a live mouse; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

2 An aliquot contains a sufficient number of embryos (in one or more vials or straws and based on the transfer success rate of the MMRRC facility) to transfer into one to three recipients. The MMRRC makes no guarantee concerning embryo transfer success experienced in the recipient investigator's laboratory. Neither gender nor genotype ratios are guaranteed.

3 An aliquot is one straw or vial with sufficient sperm to recover at least one litter of mice, as per provided protocols, when performed at the MMRRC facility. The MMRRC makes no guarantee concerning the success of these procedures when performed outside the MMRRC facilities.

4 The distribution fee covers the expense of resuscitating mice from the cryo-archive; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

To request material from the MMRRC: Please fill out our on-line request form (accessible from the catalog search results page, or click the Request this Strain button in the fees section). If you have questions or need assistance completing this form, you may call Customer Service at (800) 910-2291 (in USA or Canada) or (530) 757-5710 (international calls). Before you call, please have with you: the MMRRC item number, quantity needed, Bill-to and Ship-to contact information.