Loading Mouse GIF
Loading...

Strain Name:
C57BL/6J-MtgxR1669Btlr/Mmmh
Stock Number:
039705-MU
Citation ID:
RRID:MMRRC_039705-MU
Other Names:
R1669 (G1), C57BL/6J-MtgxR1669Btlr
Major Collection:

Strain Information

Hfe
Name: homeostatic iron regulator
Synonyms: MR2
Type: Gene
Species: Mouse
Chromosome: 13
NCBI: 15216
HGNC: HGNC:4886
Homologene: 88330
Cds2
Name: CDP-diacylglycerol synthase 2
Synonyms: 5730460C18Rik, D2Wsu127e, 5730450N06Rik
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 110911
HGNC: HGNC:1801
Homologene: 37854
Evl
Name: Ena-vasodilator stimulated phosphoprotein
Synonyms: b2b2600Clo
Type: Gene
Species: Mouse
Chromosome: 12
NCBI: 14026
VEGA: 12
Homologene: 56752
Rtn4rl1
Name: reticulon 4 receptor-like 1
Synonyms: Ngr3, Ngrh2, Ngrl2
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 237847
Homologene: 18611
Cacna1h
Name: calcium channel, voltage-dependent, T type, alpha 1H subunit
Synonyms: alpha13.2, Cav3.2, T-type Cav3.2
Type: Gene
Species: Mouse
Chromosome: 17
NCBI: 58226
HGNC: HGNC:1395
Homologene: 56913
Lyst
Name: lysosomal trafficking regulator
Synonyms: D13Sfk13
Type: Gene
Species: Mouse
Chromosome: 13
NCBI: 17101
VEGA: 13
HGNC: HGNC:1968
Homologene: 61
Mmp10
Name: matrix metallopeptidase 10
Synonyms: stromelysin 2
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 17384
VEGA: 9
HGNC: HGNC:7156
Homologene: 20546
Genetic Alterations
ENU-induced transitions at the following base pair locations (GRCm38):
  • A to T, chromosome 1 at 34,732,158 bp
  • A to G, chromosome 1 at 172,074,905 bp
  • T to G, chromosome 2 at 34,730,682 bp
  • T to C, chromosome 2 at 76,724,463 bp
  • T to A, chromosome 2 at 89,993,800 bp
  • T to C, chromosome 2 at 113,841,912 bp
  • T to A, chromosome 2 at 126,917,794 bp
  • T to A, chromosome 2 at 132,295,519 bp
  • C to T, chromosome 2 at 145,613,592 bp
  • C to A, chromosome 3 at 25,436,134 bp
  • A to G, chromosome 3 at 56,890,577 bp
  • G to A, chromosome 3 at 89,067,242 bp
  • C to T, chromosome 3 at 153,876,720 bp
  • A to G, chromosome 3 at 159,522,924 bp
  • T to A, chromosome 4 at 116,999,643 bp
  • C to T, chromosome 4 at 118,211,494 bp
  • C to T, chromosome 4 at 120,947,498 bp
  • T to C, chromosome 4 at 123,189,076 bp
  • T to C, chromosome 4 at 137,593,893 bp
  • T to G, chromosome 4 at 143,654,346 bp
  • C to A, chromosome 4 at 144,158,438 bp
  • A to G, chromosome 4 at 154,156,131 bp
  • T to A, chromosome 5 at 12,508,084 bp
  • T to C, chromosome 5 at 34,351,280 bp
  • T to A, chromosome 5 at 95,958,741 bp
  • C to A, chromosome 5 at 115,656,016 bp
  • T to A, chromosome 6 at 43,174,821 bp
  • A to T, chromosome 6 at 85,950,026 bp
  • G to A, chromosome 6 at 112,722,904 bp
  • T to C, chromosome 6 at 125,647,906 bp
  • A to T, chromosome 6 at 130,115,629 bp
  • T to A, chromosome 6 at 141,987,689 bp
  • A to G, chromosome 6 at 142,656,686 bp
  • C to A, chromosome 7 at 87,295,889 bp
  • A to G, chromosome 7 at 100,938,423 bp
  • A to T, chromosome 7 at 104,059,309 bp
  • T to A, chromosome 7 at 108,880,713 bp
  • C to T, chromosome 8 at 13,885,704 bp
  • A to G, chromosome 9 at 7,277,926 bp
  • A to T, chromosome 9 at 7,505,525 bp
  • G to T, chromosome 9 at 31,167,733 bp
  • C to T, chromosome 9 at 107,517,496 bp
  • A to G, chromosome 9 at 110,981,650 bp
  • A to C, chromosome 9 at 122,257,183 bp
  • A to T, chromosome 10 at 52,161,811 bp
  • A to G, chromosome 10 at 80,710,836 bp
  • G to A, chromosome 11 at 3,675,885 bp
  • A to G, chromosome 11 at 44,456,500 bp
  • G to A, chromosome 11 at 67,191,339 bp
  • C to T, chromosome 11 at 70,728,397 bp
  • A to G, chromosome 11 at 75,265,927 bp
  • G to A, chromosome 11 at 115,991,330 bp
  • T to A, chromosome 12 at 21,305,331 bp
  • GTACATACATACATACATACATACATACA to GTACATACATACATACATACATACATACATACA, chromosome 12 at 40,185,261 bp
  • G to A, chromosome 12 at 50,394,926 bp
  • C to T, chromosome 12 at 71,318,773 bp
  • A to G, chromosome 12 at 108,679,904 bp
  • G to A, chromosome 13 at 13,644,087 bp
  • A to T, chromosome 13 at 21,659,286 bp
  • A to T, chromosome 13 at 23,706,127 bp
  • A to T, chromosome 13 at 41,311,794 bp
  • C to T, chromosome 13 at 47,068,548 bp
  • C to T, chromosome 13 at 73,795,113 bp
  • T to C, chromosome 13 at 99,229,561 bp
  • C to T, chromosome 13 at 102,705,490 bp
  • C to A, chromosome 15 at 4,908,493 bp
  • T to C, chromosome 15 at 78,793,953 bp
  • G to A, chromosome 15 at 79,620,677 bp
  • T to G, chromosome 15 at 101,011,120 bp
  • T to C, chromosome 15 at 102,927,160 bp
  • A to T, chromosome 16 at 14,707,044 bp
  • T to A, chromosome 16 at 15,734,058 bp
  • T to C, chromosome 16 at 77,076,531 bp
  • T to A, chromosome 16 at 93,769,660 bp
  • T to C, chromosome 16 at 96,159,808 bp
  • T to C, chromosome 17 at 6,739,313 bp
  • T to A, chromosome 17 at 18,062,944 bp
  • T to C, chromosome 17 at 21,879,964 bp
  • C to A, chromosome 17 at 25,383,471 bp
  • T to C, chromosome 17 at 32,403,098 bp
  • C to T, chromosome 17 at 34,729,680 bp
  • C to A, chromosome 17 at 47,733,790 bp
  • T to A, chromosome 17 at 52,893,968 bp
  • C to A, chromosome 17 at 56,063,339 bp
  • T to C, chromosome 18 at 15,062,460 bp
  • T to A, chromosome 18 at 43,969,278 bp
  • T to C, chromosome 18 at 44,157,300 bp
  • C to T, chromosome 18 at 54,987,739 bp
  • T to C, chromosome 18 at 57,904,235 bp
  • A to G, chromosome 19 at 8,772,131 bp
  • C to T, chromosome 19 at 11,701,014 bp
  • A to T, chromosome 19 at 12,901,288 bp
  • C to A, chromosome 19 at 28,911,794 bp
  • T to A, chromosome 19 at 34,680,381 bp
  • A to C, chromosome 19 at 50,475,422 bp
Genotype Determination
Phenotype
G1 male heterozygous mice are viable and fertile. The G1 mice were not characterized prior to archiving.
Strain GQC Summary
The MMRRC Centers have developed a Strain GQC pipeline using MiniMUGA array genotyping to provide additional information on strain backgrounds for MMRRC strains. For more information on whether data may be available, or to request genotyping for a strain of interest, please contact MMRRC_GeneticQC@med.unc.edu. Older strains may not have this information available.
Suggested Control Mice
Littermates of all relevant genotypes.
Donor
Bruce Beutler, M.D., University of Texas Southwestern Medical Center.
Primary Reference
MUTAGENETIX record for R1669 (G1). B. Beutler and colleagues, Center for the Genetics of Host Defense, UT Southwestern, Dallas, TX.
Strain Development
C57BL/6J mice were injected with ENU, resulting in G0 mice that were bred back to C57BL/6J. Sperm was archived from G1 male mice that produced viable G2 mice.


Disclaimer: If MMRRC Strain Genetic Quality Control (GQC; based on MiniMUGA genotyping and analysis) has been completed for this strain, the information might differ from the genetic background information provided by the submitter. MiniMUGA genetic analysis is done on a strain’s tissue samples taken when archived by or ordered from the assigned MMRRC Center.

Colony and Husbandry Information

Colony Surveillance Program and Current Health Reports

Mice recovered from a cryo-archive will have health surveillance performed on recipient females. Health reports will be provided prior to shipment. If you require additional health status information, please email mmrrc@missouri.edu.
Coat Color
Black
MMRRC Breeding System
Random intra-strain mating
Breeding Scheme(s)
When maintaining a live colony, heterozygous mice may be bred together, bred with wild-type siblings, or bred with C57BL/6J inbred mice.
Overall Breeding Performance
Undetermined; during development, mating was done with heterozygous males; viability, fertility and other breeding statistics for heterozygous females and homozygotes are unverified, but presumably would be similar to the C57BL/6J background strain
Average litter size
Undetermined
Recommended wean age
3 weeks

Order Request Information

Limited quantities of breeder mice (recovered litter) are available from a cryoarchive; recovered litter usually available to ship in 3 to 4 months.

Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

Distribution of this strain requires submission of the MMRRC Conditions of Use (COU). A link to the COU web form will be provided via email after an order has been placed; the form should be completed then or the email forwarded to your institutional official for completion.

The donor or their institution limits the distribution to non-profit institutions only.

Additional charges may apply for any special requests. Shipping costs are in addition to the basic distribution/resuscitation fees. Information on shipping costs and any additional charges will be provided by the supplying MMRRC facility.

Click button to Request this one strain. (Use the MMRRC Catalog Search to request more than one strain.)
MMRRC Item # Description Distribution Fee / Unit (US $)
*Shipping & Handling not included*
Units Notes
039705-MU-RESUS Litter recovered from cryo-archive $5,475.00 / Non-Profit Litter Recovered litter4; additional fees for any special requests.
Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

Some MMRRC strains were submitted by the donor as cryopreserved germplasm, and because these strains were not cryopreserved by the MMRRC, we have not assessed the quality, nor genotype, of this material. Our expertise in reviving mice from various qualities of frozen sperm and embryos, using methods like IVF and ICSI, gives us confidence in successful recoveries in most cases. However, due to the uncertain quality of these samples, we'll limit revival attempts to two per order. Additional attempts are available for a fee, on top of standard charges, if requested. It's important to note that some strains may lack the expected mutation, so we can't assure successful order fulfillment until we attempt to revive the strain.

1 The distribution fee covers the expense of rederiving mice from a live mouse; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

2 An aliquot contains a sufficient number of embryos (in one or more vials or straws and based on the transfer success rate of the MMRRC facility) to transfer into one to three recipients. The MMRRC makes no guarantee concerning embryo transfer success experienced in the recipient investigator's laboratory. Neither gender nor genotype ratios are guaranteed.

3 An aliquot is one straw or vial with sufficient sperm to recover at least one litter of mice, as per provided protocols, when performed at the MMRRC facility. The MMRRC makes no guarantee concerning the success of these procedures when performed outside the MMRRC facilities.

4 The distribution fee covers the expense of resuscitating mice from the cryo-archive; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

To request material from the MMRRC: Please fill out our on-line request form (accessible from the catalog search results page, or click the Request this Strain button in the fees section). If you have questions or need assistance completing this form, you may call Customer Service at (800) 910-2291 (in USA or Canada) or (530) 757-5710 (international calls). Before you call, please have with you: the MMRRC item number, quantity needed, Bill-to and Ship-to contact information.