Strain Name:
Stock Number:
Citation ID:
Other Names:
R1730 (G1), C57BL/6J-MtgxR1730Btlr
Major Collection:

Gene Information

Name: protein phosphatase 2, regulatory subunit B, delta
Synonyms: 1300017E19Rik, MDS026, D7Ertd753e
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 7
NCBI: 52432
Homologene: 81915
Name: septin 4
Synonyms: cell division control-related protein 2b, Pnutl2, Bh5, septin H5, Gm11492, ARTS, Sept4
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 11
NCBI: 18952
Homologene: 6107
Name: engrailed 1
Synonyms: Mo-en.1, En-1, engrailed-1
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 1
NCBI: 13798
Homologene: 50663
Name: G protein-coupled receptor 37-like 1
Synonyms: CAG-18, D0Kist8
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 1
NCBI: 171469
Homologene: 3500
Name: gamma-aminobutyric acid receptor associated protein
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 11
NCBI: 56486
Homologene: 134119
Name: potassium inwardly-rectifying channel, subfamily J, member 5
Synonyms: Kir3.4, GIRK4
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 9
NCBI: 16521
Homologene: 20248
Name: histocompatibility 2, D region locus 1
Synonyms: H-2D
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 17
NCBI: 14964
Homologene: 128352
Name: jumonji, AT rich interactive domain 2
Synonyms: Jmj, jumonji
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 13
NCBI: 16468
Homologene: 31279
Name: lysine (K)-specific demethylase 5B
Synonyms: PLU-1, Plu1, 2010009J12Rik, Rb-Bp2, 2210016I17Rik, D1Ertd202e, Jarid1b
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 1
NCBI: 75605
Homologene: 48448
Name: GATA zinc finger domain containing 2A
Synonyms: 1110066C11Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 8
NCBI: 234366
Homologene: 9766
Name: GLI-Kruppel family member GLI2
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 1
NCBI: 14633
Homologene: 12725
Name: ataxia telangiectasia mutated
Synonyms: C030026E19Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 9
NCBI: 11920
Homologene: 30952
Name: cyclin-dependent kinase 18
Synonyms: Pctk3
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 1
NCBI: 18557
Homologene: 1949
Name: Trk-fused gene
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 16
NCBI: 21787
Homologene: 4426
Name: nuclear receptor subfamily 5, group A, member 2
Synonyms: Ftf, LRH-1, D1Ertd308e, UF2-H3B
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 1
NCBI: 26424
Homologene: 20827
Name: BCL2-associated athanogene 3
Synonyms: Bis, Bcl-2-interacting death suppressor
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 7
NCBI: 29810
Homologene: 3162
Name: chemokine (C-X-C motif) receptor 4
Synonyms: PB-CKR, fusin, CD184, Cmkar4, Sdf1r, b2b220Clo
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 1
NCBI: 12767
Homologene: 20739
Name: capping protein regulator and myosin 1 linker 1
Synonyms: 1110037D04Rik, Lrrc16, Carmil, Lrrc16a
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 13
NCBI: 68732
Homologene: 9757
Name: AF4/FMR2 family, member 1
Synonyms: Af4, Rob, 9630032B01Rik, Mllt2h
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 5
NCBI: 17355
Homologene: 4340
Name: excision repair cross-complementing rodent repair deficiency, complementation group 6
Synonyms: CS group B correcting gene, CSB, C130058G22Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 14
NCBI: 319955
VEGA: 14
Homologene: 133552
Name: coiled-coil domain containing 93
Synonyms: 9230102M16Rik, 4633402D15Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 1
NCBI: 70829
Homologene: 10393
Name: zinc finger CCCH type containing 11A
Synonyms: 1110003F06Rik, 5730454B08Rik, G630041M05Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 1
NCBI: 70579
Homologene: 8888
Name: abnormal spindle microtubule assembly
Synonyms: Sha1, Aspm, D330028K02Rik, MCPH5, Calmbp1
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 1
NCBI: 12316
Homologene: 7650
Name: exportin 6
Synonyms: Ranbp20, C230091E20Rik, 2610005L19Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 7
NCBI: 74204
Homologene: 12544
Name: G1 to S phase transition 1
Synonyms: Gst-1, Gst-1, G1st
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 16
NCBI: 14852
Homologene: 68226
Name: cyclin D binding myb like transcription factor 1
Synonyms: Dmp1
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 5
NCBI: 23857
Homologene: 8017
Name: calmodulin regulated spectrin-associated protein family, member 2
Synonyms: 1600013L13Rik, 4930541M15Rik, Camsap1l1
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 1
NCBI: 67886
Homologene: 18927
Name: Ttk protein kinase
Synonyms: Esk1, Mps1
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 9
NCBI: 22137
Homologene: 2489
Name: nuclear factor related to kappa B binding protein
Synonyms: A530090G11Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 9
NCBI: 235134
Homologene: 4492
Name: RAD17 checkpoint clamp loader component
Synonyms: MmRad24, 9430035O09Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 13
NCBI: 19356
VEGA: 13
Homologene: 32117
Name: pleckstrin homology like domain, family B, member 1
Synonyms: LL5A, D330037A14Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 9
NCBI: 102693
Homologene: 15903
Name: DEAD box helicase 18
Synonyms: 2310005B10Rik, DEAD (Asp-Glu-Ala-Asp) box polypeptide 18
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 1
NCBI: 66942
Homologene: 6697
Name: tryptophanyl-tRNA synthetase
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 12
NCBI: 22375
Homologene: 3084
Name: importin 9
Synonyms: 0710008K06Rik, Imp9
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 1
NCBI: 226432
Homologene: 5874
Name: cannabinoid receptor 1 (brain)
Synonyms: CB1, CB1R
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 4
NCBI: 12801
Homologene: 7273
Name: CD55 molecule, decay accelerating factor for complement
Synonyms: Daf-GPI, complement-glycosylphosphatidylinositol, GPI-DAF, Cromer blood group, Daf1
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 1
NCBI: 13136
Homologene: 479
Name: protein tyrosine phosphatase, receptor type, C
Synonyms: T200, B220, CD45, Lyt-4, Ly-5
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 1
NCBI: 19264
Homologene: 2126
Name: DENN/MADD domain containing 1B
Synonyms: F730008N07Rik, 4632404N19Rik, 4930467M19Rik, 6820401H01Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 1
NCBI: 329260
Homologene: 11739
Name: polymeric immunoglobulin receptor
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 1
NCBI: 18703
Homologene: 1984
Name: nuclear receptor interacting protein 1
Synonyms: RIP140, 6030458L20Rik, 8430438I05Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 16
NCBI: 268903
Homologene: 2606
Name: prostaglandin F2 receptor negative regulator
Synonyms: CD9P-1, 4833445A08Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 3
NCBI: 19221
Homologene: 7908
Name: centrosomal protein 63
Synonyms: CD20R, ET2, D9Mgc41, D9Mgc48e
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 9
NCBI: 28135
Homologene: 11861
Name: SET domain containing 1A
Synonyms: KMT2F
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 7
NCBI: 233904
Homologene: 52251
Name: synaptotagmin II
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 1
NCBI: 20980
Homologene: 22516
Name: cadherin 19, type 2
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 1
NCBI: 227485
Homologene: 23286
Name: leucine-rich repeat-containing G protein-coupled receptor 6
Synonyms: A530037C04Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 1
NCBI: 329252
Homologene: 49680
Name: desmoglein 2
Synonyms: D18Ertd293e
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 18
NCBI: 13511
Homologene: 1464
Name: PMS1 homolog 1, mismatch repair system component
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 1
NCBI: 227099
Homologene: 449
Name: cytochrome b5 reductase 1
Synonyms: B5R.1, 1500005G05Rik, Nqo3a2
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 1
NCBI: 72017
Homologene: 96059
Name: family with sequence similarity 72, member A
Synonyms: 2700049P18Rik, P17
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 1
NCBI: 108900
Homologene: 82352
Name: innate immunity activator
Synonyms: 5730559C18Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 1
NCBI: 67313
Homologene: 10103
Name: par-6 family cell polarity regulator gamma
Synonyms: 2410049N21Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 18
NCBI: 93737
VEGA: 18
Homologene: 36487
Name: neuron navigator 1
Synonyms: POMFIL3, 9930003A20Rik, C230080M11Rik, unc53H1, steerin-1
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 1
NCBI: 215690
Homologene: 10719
Name: UDP-glucose glycoprotein glucosyltransferase 1
Synonyms: A930007H10Rik, C820010P03Rik, 0910001L17Rik, Ugcgl1
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 1
NCBI: 320011
Homologene: 10586
Name: kelch-like 20
Synonyms: D930050H05Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 1
NCBI: 226541
Homologene: 8699
Name: sushi domain containing 4
Synonyms: E430021N18Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 1
NCBI: 96935
Homologene: 23062
Name: olfactomedin-like 2B
Synonyms: 1110018N05Rik, 4832415H08Rik, photomedin-2
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 1
NCBI: 320078
Homologene: 18546
Name: protein phosphatase 1, regulatory subunit 12B
Synonyms: 1810037O03Rik, 9530009M10Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 1
NCBI: 329251
Homologene: 135710
Name: ubiquitin-conjugating enzyme E2T
Synonyms: 2700084L22Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 1
NCBI: 67196
Homologene: 40929
Name: STEAP family member 3
Synonyms: 1010001D01Rik, pHyde
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 1
NCBI: 68428
Homologene: 10084
Name: troponin I, skeletal, slow 1
Synonyms: 2700018B22Rik, ssTnI
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 1
NCBI: 21952
Homologene: 2462
Name: titin
Synonyms: connectin, L56, 1100001C23Rik, mdm, D830007G01Rik, 2310036G12Rik, 2310074I15Rik, 2310057K23Rik, D330041I19Rik, shru
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 2
NCBI: 22138
Homologene: 130650
Name: crumbs family member 1, photoreceptor morphogenesis associated
Synonyms: A930008G09Rik, 7530426H14Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 1
NCBI: 170788
Homologene: 8092
Name: E74-like factor 3
Synonyms: jen, ESX, ESE-1
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 1
NCBI: 13710
Homologene: 3265
Name: collagen, type XII, alpha 1
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 9
NCBI: 12816
Homologene: 3217
Name: arginyl aminopeptidase (aminopeptidase B)
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 1
NCBI: 215615
Homologene: 10628
Name: predicted gene 4847
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 1
NCBI: 226604
Homologene: 101040
Name: mannose receptor, C type 1
Synonyms: CD206, MR
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 2
NCBI: 17533
Homologene: 37622
Name: maltase-glucoamylase
Synonyms: 6030407P20Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 6
NCBI: 232714
Homologene: 130099
Name: MAP kinase-activated protein kinase 2
Synonyms: MAPKAP kinase 2, Rps6kc1, MK2
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 1
NCBI: 17164
Homologene: 56412
Name: myosin, heavy chain 7B, cardiac muscle, beta
Synonyms: Myh14
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 2
NCBI: 668940
Homologene: 66117
Name: olfactory receptor 371
Synonyms: GA_x6K02T2NUPS-13298842-13299780, MOR141-3
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 8
NCBI: 258858
Homologene: 65998
Name: secretin receptor
Synonyms: 6530402O03Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 1
NCBI: 319229
Homologene: 68290
Name: EGF domain-specific O-linked N-acetylglucosamine (GlcNAc) transferase
Synonyms: A130022J15Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 6
NCBI: 101351
Homologene: 65276
Name: zinc finger protein 804B
Synonyms: LOC207618
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 5
NCBI: 207618
Homologene: 52304
Name: family with sequence similarity 131, member B
Synonyms: 6530406I18Rik, 6330503C03Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 6
NCBI: 76156
Homologene: 8797
Name: cadherin 7, type 2
Synonyms: CDH7L1, 9330156F07Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 1
NCBI: 241201
Homologene: 68391
Name: calcium channel, voltage-dependent, L type, alpha 1S subunit
Synonyms: Cchl1a3, fmd, mdg, sj, muscle dysgenesis, Cav1.1, DHPR alpha1s
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 1
NCBI: 12292
Homologene: 37257
Name: regulating synaptic membrane exocytosis 1
Synonyms: RIM1, RIM1a, C030033M19Rik, RIM1alpha
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 1
NCBI: 116837
Homologene: 128399
Name: obscurin, cytoskeletal calmodulin and titin-interacting RhoGEF
Synonyms: LOC380698, OTTMUSG00000005786
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 11
NCBI: 380698
Homologene: 70869
Name: TBC1 domain family, member 17
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 7
NCBI: 233204
Homologene: 11656
Name: protein tyrosine phosphatase, receptor type, f polypeptide (PTPRF), interacting protein (liprin), alpha 4
Synonyms: 1110008G13Rik, LOC100042382, Liprin-alpha4, Gm3812
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 1
NCBI: 68507
Homologene: 66200
Name: adaptor-related protein complex 3, beta 2 subunit
Synonyms: Naptb, beta3B
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 7
NCBI: 11775
Homologene: 55837
Name: EYA transcriptional coactivator and phosphatase 2
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 2
NCBI: 14049
Homologene: 40711
Name: cadherin-like and PC-esterase domain containing 1
Synonyms: A430107O13Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 6
NCBI: 214642
Homologene: 57014
Name: synaptopodin 2-like
Synonyms: 1110054M18Rik, Chap
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 14
NCBI: 68760
Homologene: 23499
Name: myosin binding protein H
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 1
NCBI: 53311
Homologene: 3661
Name: cathepsin E
Synonyms: CE, CatE, A430072O03Rik, C920004C08Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 1
NCBI: 13034
Homologene: 37551
Name: solute carrier family 36 (proton/amino acid symporter), member 1
Synonyms: Pat1, 5830411H19Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 11
NCBI: 215335
Homologene: 121860
Name: chitinase-like 1
Synonyms: Brp39, Gp39, Chi3l1
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 1
NCBI: 12654
Homologene: 55569
Name: polymerase (RNA) II (DNA directed) polypeptide I
Synonyms: 2810002B19Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 7
NCBI: 69920
Homologene: 4541
Name: maestro heat-like repeat family member 3
Synonyms: 2310006M14Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 1
NCBI: 76422
Name: acyl-Coenzyme A dehydrogenase family, member 11
Synonyms: 5730439E10Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 9
NCBI: 102632
Homologene: 49896
Name: guanylate cyclase 1, soluble, alpha 2
Synonyms: 6330407I18Rik, A230060L24Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 9
NCBI: 234889
Homologene: 47953
Name: pleckstrin homology domain containing, family A member 6
Synonyms: Pepp3
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 1
NCBI: 240753
Homologene: 135779
Name: zinc finger protein 541
Synonyms: EG666528
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 7
NCBI: 666528
Homologene: 12991
Name: serine (or cysteine) peptidase inhibitor, clade B (ovalbumin), member 10
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 1
NCBI: 241197
Homologene: 68430
Name: kinesin family member 14
Synonyms: N-3 kinesin, D1Ertd367e
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 1
NCBI: 381293
Homologene: 8916
Name: olfactory receptor 951
Synonyms: GA_x6K02T2PVTD-33090395-33091330, MOR171-49, MOR171-33P
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 9
NCBI: 258046
Homologene: 71961
Name: RAB7B, member RAS oncogene family
Synonyms: Rab7b, 5430435G22Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 1
NCBI: 226421
Homologene: 64833
Name: dual serine/threonine and tyrosine protein kinase
Synonyms: A930019K20Rik, C430014H23Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 1
NCBI: 213452
Homologene: 19711
Name: potassium voltage-gated channel, shaker-related subfamily, member 5
Synonyms: Kv1.5
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 6
NCBI: 16493
Homologene: 1683
Name: transmembrane protein 143
Synonyms: 2310076O21Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 7
NCBI: 70209
Homologene: 10105
Name: immunoglobulin-like and fibronectin type III domain containing 1
Synonyms: 9830123M21Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 1
NCBI: 226438
Homologene: 130054
Name: signal-induced proliferation-associated 1 like 2
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 8
NCBI: 244668
Homologene: 18956
Name: aminoadipate-semialdehyde synthase
Synonyms: LOR/SDH, Lorsdh
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 6
NCBI: 30956
Homologene: 4212
Name: poly (ADP-ribose) polymerase family, member 6
Synonyms: 2310028P13Rik, 1700119G14Rik, C030013N01Rik, 3110038K10Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 9
NCBI: 67287
Homologene: 10627
Name: thrombospondin, type I, domain containing 7B
Synonyms: 1700074E13Rik, D130067I03Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 1
NCBI: 210417
Homologene: 18180
Name: kinesin family member 21B
Synonyms: N-5 kinesin, 2610511N21Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 1
NCBI: 16565
Homologene: 56868
Name: tripartite motif-containing 47
Synonyms: 2210023F24Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 11
NCBI: 217333
Homologene: 14128
Name: dermatan sulfate epimerase-like
Synonyms: 9330132E09Rik, DS-epi2
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 1
NCBI: 319901
Homologene: 12964
Name: DEAD box helicase 59
Synonyms: 4833411G06Rik, 1210002B07Rik, DEAD (Asp-Glu-Ala-Asp) box polypeptide 59
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 1
NCBI: 67997
Homologene: 12222
Name: von Willebrand factor A domain containing 5B2
Synonyms: EG328644
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 16
NCBI: 328643
Homologene: 28056
Name: potassium channel, subfamily T, member 2
Synonyms: E330038N15Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 1
NCBI: 240776
Homologene: 16121
Name: melanoma cell adhesion molecule
Synonyms: s-endo, CD146, s-gicerin, 1-gicerin, Muc18
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 9
NCBI: 84004
Homologene: 4742
Name: complement component factor h
Synonyms: Sas-1, Mud-1, Sas1
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 1
NCBI: 12628
Homologene: 20086
Name: renin 1 structural
Synonyms: Ren1d, Ren-A, Rn-1, Ren, Rnr, Ren-1, Ren1c
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 1
NCBI: 19701
Homologene: 20151
Name: ethanolamine phosphate phospholyase
Synonyms: 1300019H02Rik, Agxt2l1
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 3
NCBI: 71760
Homologene: 69440
Name: obscurin-like 1
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 1
NCBI: 98733
Name: serine (or cysteine) peptidase inhibitor, clade B, member 8
Synonyms: ovalbumin, CAP-2, CAP2, Spi8, NK10
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 1
NCBI: 20725
Homologene: 74445
Name: ubiquitin specific peptidase 9, Y chromosome
Synonyms: Dffry, Fafl2
Type: Gene
Species: Mus musculus (mouse)
Chromosome: Y
NCBI: 107868
Homologene: 68408
Name: contactin associated protein-like 5A
Synonyms: Caspr5-1
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 1
NCBI: 636808
Homologene: 43974
Name: RIKEN cDNA 1110051M20 gene
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 2
NCBI: 228356
Homologene: 11471
Name: olfactory receptor 1240
Synonyms: GA_x6K02T2Q125-50883183-50882239, MOR231-8
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 2
NCBI: 258804
Homologene: 121591
Name: zinc finger, BED type containing 6
Synonyms: similar to Zinc finger BED domain containing protein 4, Gm8466, MGR, Gm38394
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 1
NCBI: 667118
Homologene: 130066
Name: Ro60, Y RNA binding protein
Synonyms: SS-A/Ro, Ssa, A530054J02Rik, 1810007I17Rik, Ssa2, Trove2
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 1
NCBI: 20822
Homologene: 3383
Name: glucosidase beta 2
Synonyms: bile acid
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 4
NCBI: 230101
Homologene: 10859
Name: ABI family member 3 binding protein
Synonyms: 5033411B22Rik, D930038M13Rik, eratin, TARSH
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 16
NCBI: 320712
VEGA: 16
Homologene: 134172
Name: lymphocyte transmembrane adaptor 1
Synonyms: E430019B13Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 1
NCBI: 240754
Homologene: 49504
Name: aldo-keto reductase family 1, member B7
Synonyms: MVDP, Avdp
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 6
NCBI: 11997
Homologene: 122176
Name: inhibitor of kappaB kinase epsilon
Synonyms: IKK-i, IKKepsilon
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 1
NCBI: 56489
Homologene: 23168
Name: olfactory receptor 1012
Synonyms: GA_x6K02T2Q125-47239120-47238185, MOR213-6
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 2
NCBI: 258561
Homologene: 64889
Name: cytochrome P450, family 2, subfamily c, polypeptide 29
Synonyms: AHOH, AHOHase, Ahh-1, Ah-2, P450-2C, Cyp2c
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 19
NCBI: 13095
Homologene: 117948
Name: zona pellucida 3 receptor
Synonyms: SP56
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 1
NCBI: 22789
Homologene: 7609
Name: selectin, endothelial cell
Synonyms: E-selectin, CD62E, Elam
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 1
NCBI: 20339
Homologene: 389
Name: phosphatidylinositol-4-phosphate 3-kinase catalytic subunit type 2 beta
Synonyms: PI3K-C2beta, C330011J12Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 1
NCBI: 240752
Homologene: 20582
Name: complement factor H-related 2
Synonyms: FHR-B
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 1
NCBI: 545366
Homologene: 134349
Name: protein tyrosine phosphatase, non-receptor type 7
Synonyms: LC-PTP, BPTP-4, C920001D21Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 1
NCBI: 320139
Homologene: 15411
Name: leiomodin 1 (smooth muscle)
Synonyms: 64kD D1, 1D, D1, SM-Lmod, 9530015K06Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 1
NCBI: 93689
Homologene: 8118
Name: cytochrome P450, family 2, subfamily c, polypeptide 68
Synonyms: 9030012A22Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 19
NCBI: 433247
Homologene: 74936
Name: mitogen-activated protein kinase kinase kinase 9
Synonyms: Mlk1
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 12
NCBI: 338372
VEGA: 12
Homologene: 76377
Name: olfactory receptor 1417
Synonyms: GA_x6K02T2RE5P-2172809-2171862, MOR266-2
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 19
NCBI: 258938
Homologene: 27304
Name: RIKEN cDNA 4930590J08 gene
Synonyms: LOC381798
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 6
NCBI: 381798
Homologene: 49985
Name: lin-7 homolog B, crumbs cell polarity complex component
Synonyms: LIN-7B, MALS-2, Veli2
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 7
NCBI: 22342
Homologene: 22648
Name: nuclear factor of kappa light polypeptide gene enhancer in B cells inhibitor, beta
Synonyms: IKappaBbeta, IkB
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 7
NCBI: 18036
Homologene: 37631
Name: solute carrier family 26, member 9
Synonyms: anion transporter/exchanger-9, E030002L01Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 1
NCBI: 320718
Homologene: 14179
Name: regulator of G-protein signaling 18
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 1
NCBI: 64214
Homologene: 11281
Name: olfactory receptor 924
Synonyms: GA_x6K02T2PVTD-32543982-32544908, MOR171-27P, MOR171-47, MOR171-27P, Olfr1520-ps1
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 9
NCBI: 404322
Homologene: 128215
Name: olfactory receptor 1307
Synonyms: GA_x6K02T2Q125-72988111-72987173, MOR245-19P
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 2
NCBI: 257956
Homologene: 128383
Name: troponin T2, cardiac
Synonyms: Tnt, cTnT, cardiac TnT
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 1
NCBI: 21956
Homologene: 68050
Name: chitinase 1 (chitotriosidase)
Synonyms: 2300002L19Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 1
NCBI: 71884
Homologene: 68318
Name: opticin
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 1
NCBI: 269120
Homologene: 8652
Name: proline arginine-rich end leucine-rich repeat
Synonyms: 7330409J17Rik, SLRR2A
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 1
NCBI: 116847
Homologene: 2041
Name: complement component 4 binding protein
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 1
NCBI: 12269
Name: Fc receptor, IgA, IgM, high affinity
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 1
NCBI: 64435
Homologene: 12929
Name: ethanolamine kinase 2
Synonyms: 4933417N20Rik, Eki2
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 1
NCBI: 214253
Homologene: 10072
Name: olfactory receptor 453
Synonyms: GA_x6K02T2P3E9-4815856-4814903, MOR257-8P
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 6
NCBI: 258016
Homologene: 128151
Name: serine (or cysteine) peptidase inhibitor, clade B, member 2
Synonyms: PAI-2, Planh2, ovalbumin
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 1
NCBI: 18788
Homologene: 20571
Name: Fc fragment of IgM receptor
Synonyms: 1810037B05Rik, FcmuR, Faim3
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 1
NCBI: 69169
Homologene: 48347
Name: ankyrin repeat and death domain containing 1B
Synonyms: 9330128J19Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 13
NCBI: 271144
Homologene: 19566
Name: ladinin
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 1
NCBI: 16763
Homologene: 4059
Name: predicted gene 4793
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 1
NCBI: 215714
Name: RAB29, member RAS oncogene family
Synonyms: Rab7l1
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 1
NCBI: 226422
Homologene: 20842
Name: protein tyrosine phosphatase, receptor type, V
Synonyms: mOST-PTP, Esp, OST-PTP, OST
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 1
NCBI: 13924
Homologene: 7306
Name: predicted gene 10961
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 3
NCBI: 102639972
Name: solute carrier family 25, member 41
Synonyms: 4933406J04Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 17
NCBI: 103775
Homologene: 27855
Genetic Alterations
ENU-induced transitions at the following base pair locations (GRCm38):
  • C to T, chromosome 1 at 22,346,529 bp
  • T to C, chromosome 1 at 36,221,261 bp
  • T to C, chromosome 1 at 53,194,920 bp
  • G to A, chromosome 1 at 75,486,756 bp
  • G to A, chromosome 1 at 107,515,635 bp
  • C to A, chromosome 1 at 107,523,834 bp
  • C to T, chromosome 1 at 107,523,890 bp
  • C to T, chromosome 1 at 107,523,894 bp
  • G to A, chromosome 1 at 107,523,975 bp
  • A to C, chromosome 1 at 107,524,543 bp
  • C to T, chromosome 1 at 107,538,473 bp
  • A to G, chromosome 1 at 107,597,527 bp
  • G to A, chromosome 1 at 107,598,954 bp
  • A to C, chromosome 1 at 107,607,004 bp
  • C to G, chromosome 1 at 110,065,735 bp
  • C to A, chromosome 1 at 110,893,384 bp
  • T to C, chromosome 1 at 111,859,457 bp
  • G to C, chromosome 1 at 111,859,994 bp
  • C to A, chromosome 1 at 116,455,004 bp
  • T to C, chromosome 1 at 116,455,101 bp
  • C to T, chromosome 1 at 116,455,143 bp
  • G to A, chromosome 1 at 116,455,224 bp
  • C to T, chromosome 1 at 118,868,087 bp
  • A to T, chromosome 1 at 119,002,029 bp
  • G to T, chromosome 1 at 119,002,044 bp
  • T to C, chromosome 1 at 120,031,656 bp
  • G to A, chromosome 1 at 120,063,257 bp
  • T to C, chromosome 1 at 120,227,750 bp
  • G to A, chromosome 1 at 120,234,378 bp
  • T to C, chromosome 1 at 120,243,757 bp
  • T to C, chromosome 1 at 120,270,115 bp
  • A to G, chromosome 1 at 120,603,621 bp
  • A to G, chromosome 1 at 121,456,061 bp
  • C to T, chromosome 1 at 121,456,126 bp
  • T to C, chromosome 1 at 121,461,939 bp
  • T to C, chromosome 1 at 121,559,334 bp
  • C to T, chromosome 1 at 128,589,277 bp
  • C to T, chromosome 1 at 129,628,891 bp
  • T to A, chromosome 1 at 129,667,937 bp
  • G to C, chromosome 1 at 129,678,183 bp
  • T to C, chromosome 1 at 129,915,756 bp
  • T to G, chromosome 1 at 130,103,066 bp
  • A to C, chromosome 1 at 130,116,631 bp
  • T to C, chromosome 1 at 130,116,717 bp
  • C to T, chromosome 1 at 130,449,423 bp
  • G to A, chromosome 1 at 130,458,078 bp
  • C to A, chromosome 1 at 130,459,633 bp
  • A to G, chromosome 1 at 130,596,651 bp
  • A to G, chromosome 1 at 130,596,814 bp
  • C to A, chromosome 1 at 130,619,414 bp
  • C to G, chromosome 1 at 130,642,988 bp
  • A to G, chromosome 1 at 130,811,580 bp
  • G to A, chromosome 1 at 130,812,629 bp
  • A to G, chromosome 1 at 130,812,692 bp
  • T to C, chromosome 1 at 130,812,738 bp
  • A to G, chromosome 1 at 130,812,809 bp
  • C to T, chromosome 1 at 130,812,816 bp
  • A to G, chromosome 1 at 130,814,597 bp
  • C to T, chromosome 1 at 130,844,522 bp
  • A to G, chromosome 1 at 130,875,974 bp
  • T to C, chromosome 1 at 130,878,269 bp
  • G to T, chromosome 1 at 131,056,406 bp
  • C to A, chromosome 1 at 131,265,937 bp
  • T to C, chromosome 1 at 131,269,823 bp
  • T to C, chromosome 1 at 131,530,668 bp
  • C to T, chromosome 1 at 131,538,895 bp
  • ACTCTCTCTCTCTCTCT to ACTCTCTCTCTCTCTCTCT, chromosome 1 at 131,663,285 bp
  • T to C, chromosome 1 at 131,697,817 bp
  • G to T, chromosome 1 at 131,697,819 bp
  • T to C, chromosome 1 at 131,698,409 bp
  • C to T, chromosome 1 at 131,758,590 bp
  • C to T, chromosome 1 at 131,763,870 bp
  • T to C, chromosome 1 at 131,765,876 bp
  • A to G, chromosome 1 at 131,872,110 bp
  • T to C, chromosome 1 at 132,115,859 bp
  • G to A, chromosome 1 at 132,453,334 bp
  • C to T, chromosome 1 at 132,456,984 bp
  • C to T, chromosome 1 at 133,066,627 bp
  • C to T, chromosome 1 at 133,071,339 bp
  • G to T, chromosome 1 at 133,282,278 bp
  • C to G, chromosome 1 at 133,287,846 bp
  • T to A, chromosome 1 at 133,354,206 bp
  • C to T, chromosome 1 at 133,354,237 bp
  • A to G, chromosome 1 at 133,354,287 bp
  • C to T, chromosome 1 at 133,354,787 bp
  • A to C, chromosome 1 at 133,356,457 bp
  • T to C, chromosome 1 at 133,358,537 bp
  • A to T, chromosome 1 at 133,359,079 bp
  • A to T, chromosome 1 at 133,359,983 bp
  • C to G, chromosome 1 at 133,360,007 bp
  • A to G, chromosome 1 at 133,363,923 bp
  • C to A, chromosome 1 at 133,365,587 bp
  • G to T, chromosome 1 at 133,365,765 bp
  • C to T, chromosome 1 at 133,365,816 bp
  • G to A, chromosome 1 at 133,365,817 bp
  • T to C, chromosome 1 at 133,373,123 bp
  • T to C, chromosome 1 at 133,373,127 bp
  • T to A, chromosome 1 at 133,376,915 bp
  • G to A, chromosome 1 at 133,622,154 bp
  • C to T, chromosome 1 at 133,624,621 bp
  • A to G, chromosome 1 at 133,638,523 bp
  • T to C, chromosome 1 at 133,679,978 bp
  • T to C, chromosome 1 at 133,680,569 bp
  • G to A, chromosome 1 at 133,683,634 bp
  • A to T, chromosome 1 at 133,903,796 bp
  • C to G, chromosome 1 at 133,905,170 bp
  • C to T, chromosome 1 at 133,915,131 bp
  • T to C, chromosome 1 at 134,149,361 bp
  • C to T, chromosome 1 at 134,151,204 bp
  • C to T, chromosome 1 at 134,188,529 bp
  • A to G, chromosome 1 at 134,193,732 bp
  • C to T, chromosome 1 at 134,197,480 bp
  • G to A, chromosome 1 at 134,299,321 bp
  • C to G, chromosome 1 at 134,303,789 bp
  • C to T, chromosome 1 at 134,407,667 bp
  • C to T, chromosome 1 at 134,408,389 bp
  • C to T, chromosome 1 at 134,585,243 bp
  • A to G, chromosome 1 at 134,604,431 bp
  • T to G, chromosome 1 at 134,605,705 bp
  • C to G, chromosome 1 at 134,605,709 bp
  • ACTCTCTCT to ACTCTCTCTCT, chromosome 1 at 134,746,741 bp
  • G to A, chromosome 1 at 134,865,964 bp
  • C to T, chromosome 1 at 134,886,408 bp
  • AG to AGG, chromosome 1 at 134,971,364 bp
  • C to T, chromosome 1 at 134,972,167 bp
  • G to A, chromosome 1 at 134,972,201 bp
  • C to T, chromosome 1 at 134,987,088 bp
  • A to T, chromosome 1 at 134,988,009 bp
  • G to T, chromosome 1 at 134,990,635 bp
  • A to G, chromosome 1 at 135,000,469 bp
  • G to A, chromosome 1 at 135,003,275 bp
  • C to T, chromosome 1 at 135,003,451 bp
  • C to T, chromosome 1 at 135,003,476 bp
  • T to C, chromosome 1 at 135,111,440 bp
  • A to G, chromosome 1 at 135,134,475 bp
  • C to A, chromosome 1 at 135,161,530 bp
  • A to G, chromosome 1 at 135,256,335 bp
  • A to C, chromosome 1 at 135,257,299 bp
  • C to T, chromosome 1 at 135,263,096 bp
  • C to T, chromosome 1 at 135,364,073 bp
  • ATCCTCCTCCTCCTCCTC to ATCCTCCTCCTCCTCCTCCTC, chromosome 1 at 135,386,268 bp
  • A to G, chromosome 1 at 135,386,810 bp
  • C to T, chromosome 1 at 135,388,501 bp
  • A to C, chromosome 1 at 135,388,683 bp
  • A to G, chromosome 1 at 135,402,250 bp
  • A to G, chromosome 1 at 135,404,215 bp
  • A to G, chromosome 1 at 135,404,334 bp
  • G to C, chromosome 1 at 135,405,985 bp
  • T to C, chromosome 1 at 135,406,745 bp
  • A to G, chromosome 1 at 135,452,798 bp
  • T to C, chromosome 1 at 135,471,182 bp
  • C to A, chromosome 1 at 135,532,727 bp
  • A to T, chromosome 1 at 135,584,727 bp
  • G to A, chromosome 1 at 135,592,515 bp
  • A to T, chromosome 1 at 135,607,339 bp
  • A to G, chromosome 1 at 135,607,421 bp
  • C to T, chromosome 1 at 135,607,423 bp
  • C to A, chromosome 1 at 135,607,716 bp
  • T to G, chromosome 1 at 135,805,640 bp
  • C to T, chromosome 1 at 135,827,381 bp
  • C to T, chromosome 1 at 135,828,023 bp
  • C to T, chromosome 1 at 135,841,897 bp
  • A to G, chromosome 1 at 135,841,997 bp
  • C to T, chromosome 1 at 135,843,763 bp
  • C to T, chromosome 1 at 135,845,506 bp
  • TG to TGG, chromosome 1 at 135,846,761 bp
  • C to A, chromosome 1 at 135,847,786 bp
  • T to C, chromosome 1 at 135,852,024 bp
  • G to A, chromosome 1 at 135,954,556 bp
  • G to A, chromosome 1 at 135,959,928 bp
  • G to A, chromosome 1 at 135,968,199 bp
  • T to C, chromosome 1 at 135,970,411 bp
  • C to T, chromosome 1 at 135,972,127 bp
  • AGGG to AGG, chromosome 1 at 135,974,852 bp
  • C to T, chromosome 1 at 135,979,915 bp
  • G to A, chromosome 1 at 135,982,475 bp
  • T to C, chromosome 1 at 135,998,625 bp
  • T to C, chromosome 1 at 135,998,683 bp
  • T to C, chromosome 1 at 136,054,697 bp
  • C to G, chromosome 1 at 136,073,723 bp
  • T to C, chromosome 1 at 136,111,963 bp
  • T to C, chromosome 1 at 136,118,716 bp
  • C to T, chromosome 1 at 136,145,123 bp
  • T to C, chromosome 1 at 136,147,490 bp
  • C to T, chromosome 1 at 136,147,721 bp
  • A to C, chromosome 1 at 136,148,385 bp
  • A to G, chromosome 1 at 136,163,059 bp
  • G to C, chromosome 1 at 136,192,144 bp
  • G to A, chromosome 1 at 136,227,590 bp
  • C to T, chromosome 1 at 136,281,315 bp
  • C to T, chromosome 1 at 136,295,507 bp
  • T to C, chromosome 1 at 136,417,053 bp
  • T to C, chromosome 1 at 136,432,578 bp
  • A to G, chromosome 1 at 136,468,279 bp
  • A to G, chromosome 1 at 136,468,975 bp
  • G to A, chromosome 1 at 136,478,365 bp
  • A to G, chromosome 1 at 136,490,332 bp
  • CC to CCGAC, chromosome 1 at 136,490,395 bp
  • T to G, chromosome 1 at 136,496,556 bp
  • C to T, chromosome 1 at 136,503,431 bp
  • T to C, chromosome 1 at 136,515,961 bp
  • T to C, chromosome 1 at 136,525,783 bp
  • C to A, chromosome 1 at 136,952,125 bp
  • A to G, chromosome 1 at 138,080,273 bp
  • T to G, chromosome 1 at 138,099,676 bp
  • A to G, chromosome 1 at 138,107,823 bp
  • C to A, chromosome 1 at 138,107,824 bp
  • A to G, chromosome 1 at 138,107,837 bp
  • T to C, chromosome 1 at 138,112,254 bp
  • T to C, chromosome 1 at 138,966,234 bp
  • T to C, chromosome 1 at 139,039,996 bp
  • C to T, chromosome 1 at 139,059,141 bp
  • T to C, chromosome 1 at 139,234,779 bp
  • A to T, chromosome 1 at 139,237,622 bp
  • G to A, chromosome 1 at 139,241,138 bp
  • C to T, chromosome 1 at 139,242,995 bp
  • C to T, chromosome 1 at 139,243,417 bp
  • A to G, chromosome 1 at 139,473,574 bp
  • A to G, chromosome 1 at 139,813,442 bp
  • A to C, chromosome 1 at 139,813,459 bp
  • C to T, chromosome 1 at 140,147,697 bp
  • G to A, chromosome 1 at 140,354,547 bp
  • C to T, chromosome 1 at 143,760,014 bp
  • T to C, chromosome 1 at 143,760,034 bp
  • A to G, chromosome 1 at 143,765,929 bp
  • A to G, chromosome 1 at 144,773,509 bp
  • A to G, chromosome 1 at 161,102,990 bp
  • T to G, chromosome 1 at 164,054,623 bp
  • T to C, chromosome 1 at 166,638,339 bp
  • G to A, chromosome 1 at 170,681,789 bp
  • A to G, chromosome 1 at 182,853,978 bp
  • T to C, chromosome 2 at 14,327,844 bp
  • T to G, chromosome 2 at 76,716,992 bp
  • C to T, chromosome 2 at 76,813,339 bp
  • T to A, chromosome 2 at 85,760,242 bp
  • C to T, chromosome 2 at 89,439,583 bp
  • A to T, chromosome 2 at 91,421,975 bp
  • T to C, chromosome 2 at 111,945,288 bp
  • A to G, chromosome 2 at 155,625,672 bp
  • G to T, chromosome 2 at 165,687,663 bp
  • T to C, chromosome 3 at 101,056,442 bp
  • T to C, chromosome 3 at 107,632,994 bp
  • A to G, chromosome 3 at 130,620,749 bp
  • A to G, chromosome 4 at 33,943,851 bp
  • A to G, chromosome 4 at 43,578,242 bp
  • T to C, chromosome 5 at 6,771,938 bp
  • T to C, chromosome 5 at 9,137,111 bp
  • T to G, chromosome 5 at 103,833,512 bp
  • T to C, chromosome 6 at 22,120,969 bp
  • T to C, chromosome 6 at 23,121,019 bp
  • T to G, chromosome 6 at 34,417,269 bp
  • A to G, chromosome 6 at 40,664,860 bp
  • T to G, chromosome 6 at 42,318,580 bp
  • C to A, chromosome 6 at 42,744,135 bp
  • T to C, chromosome 6 at 91,919,278 bp
  • T to C, chromosome 6 at 97,113,864 bp
  • A to T, chromosome 6 at 126,533,860 bp
  • A to G, chromosome 7 at 16,077,973 bp
  • A to T, chromosome 7 at 28,762,055 bp
  • T to C, chromosome 7 at 30,233,068 bp
  • A to C, chromosome 7 at 44,845,131 bp
  • A to T, chromosome 7 at 45,369,927 bp
  • G to A, chromosome 7 at 45,907,002 bp
  • A to T, chromosome 7 at 81,476,733 bp
  • A to T, chromosome 7 at 126,110,082 bp
  • T to A, chromosome 7 at 127,785,124 bp
  • A to T, chromosome 7 at 128,523,859 bp
  • T to C, chromosome 7 at 138,869,866 bp
  • G to T, chromosome 8 at 69,909,936 bp
  • A to C, chromosome 8 at 85,230,848 bp
  • A to T, chromosome 8 at 125,480,141 bp
  • A to T, chromosome 9 at 3,634,957 bp
  • C to T, chromosome 9 at 31,414,636 bp
  • T to C, chromosome 9 at 32,322,192 bp
  • T to A, chromosome 9 at 38,848,972 bp
  • T to C, chromosome 9 at 39,394,222 bp
  • T to C, chromosome 9 at 44,134,706 bp
  • T to C, chromosome 9 at 44,694,362 bp
  • T to A, chromosome 9 at 53,458,983 bp
  • C to A, chromosome 9 at 59,633,538 bp
  • A to C, chromosome 9 at 79,628,378 bp
  • A to G, chromosome 9 at 83,868,592 bp
  • T to A, chromosome 9 at 102,618,867 bp
  • T to A, chromosome 9 at 104,063,882 bp
  • A to G, chromosome 11 at 55,223,672 bp
  • A to G, chromosome 11 at 59,073,633 bp
  • C to T, chromosome 11 at 69,991,689 bp
  • A to T, chromosome 11 at 87,583,436 bp
  • A to G, chromosome 11 at 116,106,038 bp
  • A to T, chromosome 12 at 81,722,226 bp
  • A to C, chromosome 12 at 108,875,741 bp
  • T to C, chromosome 13 at 24,041,689 bp
  • T to A, chromosome 13 at 44,906,276 bp
  • G to T, chromosome 13 at 96,460,903 bp
  • C to T, chromosome 13 at 100,622,806 bp
  • G to A, chromosome 14 at 20,665,819 bp
  • A to C, chromosome 14 at 32,552,561 bp
  • A to G, chromosome 16 at 11,238,863 bp
  • C to T, chromosome 16 at 20,600,925 bp
  • G to A, chromosome 16 at 56,668,279 bp
  • G to T, chromosome 16 at 56,712,789 bp
  • G to T, chromosome 16 at 76,292,890 bp
  • A to G, chromosome 17 at 35,263,405 bp
  • T to C, chromosome 17 at 57,039,921 bp
  • G to A, chromosome 18 at 20,591,880 bp
  • T to A, chromosome 18 at 80,079,825 bp
  • T to A, chromosome 19 at 11,828,081 bp
  • A to T, chromosome 19 at 39,324,945 bp
  • A to T, chromosome 19 at 39,699,275 bp
  • A to T, chromosome Y at 1,367,093 bp
Genotype Determination
G1 male heterozygous mice are viable and fertile. The G1 mice were not characterized prior to archiving.
Strain Development
C57BL/6J mice were injected with ENU, resulting in G0 mice that were bred back to C57BL/6J. Sperm was archived from G1 male mice that produced viable G2 mice.
Suggested Control Mice
Wild-type littermates or C57BL/6J mice
Bruce Beutler, M.D., University of Texas Southwestern Medical Center.
Primary Reference
MUTAGENETIX record for R1730 (G1). B. Beutler and colleagues, Center for the Genetics of Host Defense, UT Southwestern, Dallas, TX.

Colony and Husbandry Information

Colony Surveillance Program and Current Health Reports

Mice recovered from a cryo-archive will have health surveillance performed on recipient females. Health reports will be provided prior to shipment. If you require additional health status information, please email .
Coat Color
MMRRC Breeding System
Random intra-strain mating
Breeding Scheme(s)
When maintaining a live colony, heterozygous mice may be bred together, bred with wild-type siblings, or bred with C57BL/6J inbred mice.
Overall Breeding Performance
Undetermined; during development, mating was done with heterozygous males; viability, fertility and other breeding statistics for heterozygous females and homozygotes are unverified, but presumably would be similar to the C57BL/6J background strain
Average litter size
Recommended wean age
3 weeks

Order Request Information

Limited quantities of breeder mice (recovered litter) are available from a cryoarchive; recovered litter usually available to ship in 3 to 4 months.

Cryopreserved material may be available upon request, please inquire to for more information.

Distribution of this strain requires submission of the MMRRC Conditions of Use (COU). A link to the COU web form will be provided via email after an order has been placed; the form should be completed then or the email forwarded to your institutional official for completion.

The donor or their institution limits the distribution to non-profit institutions only.

Additional charges may apply for any special requests. Shipping costs are in addition to the basic distribution/resuscitation fees. Information on shipping costs and any additional charges will be provided by the supplying MMRRC facility.

Click button to Request this one strain. (Use the MMRRC Catalog Search to request more than one strain.)
MMRRC Item # Description Distribution Fee / Unit (US $)
*Shipping & Handling not included*
Units Notes
039762-MU-RESUS Litter recovered from cryo-archive $5,475.00 / Non-Profit Litter Recovered litter4; additional fees for any special requests.
Cryopreserved material may be available upon request, please inquire to for more information.

Some MMRRC strains were submitted by the donor as cryopreserved germplasm, and because these strains were not cryopreserved by the MMRRC, we have not assessed the quality of this material. We have extensive experience with recovery of mice from cryopreserved sperm and embryos of varying quality, including using techniques such as IVF and ICSI, and are confident that we will have success in most, if not all, cases. However, because of the unknown quality of these frozen samples, we will restrict recovery efforts to two attempts for each order. Subsequent attempts can be performed on a fee-for-service basis, in addition to the standard fees, upon request.

1 The distribution fee covers the expense of rederiving mice from a live mouse; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

2 An aliquot contains a sufficient number of embryos (in one or more vials or straws and based on the transfer success rate of the MMRRC facility) to transfer into one to three recipients. The MMRRC makes no guarantee concerning embryo transfer success experienced in the recipient investigator's laboratory. Neither gender nor genotype ratios are guaranteed.

3 An aliquot is one straw or vial with sufficient sperm to recover at least one litter of mice, as per provided protocols, when performed at the MMRRC facility. The MMRRC makes no guarantee concerning the success of these procedures when performed outside the MMRRC facilities.

4 The distribution fee covers the expense of resuscitating mice from the cryo-archive; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

To request material from the MMRRC: Please fill out our on-line request form (accessible from the catalog search results page, or click the Request this Strain button in the fees section). If you have questions or need assistance completing this form, you may call Customer Service at (800) 910-2291 (in USA or Canada) or (530) 757-5710 (international calls). Before you call, please have with you: the MMRRC item number, quantity needed, Bill-to and Ship-to contact information.