Strain Name:
C57BL/6J-MtgxR1730Btlr/Mmmh
Stock Number:
039762-MU
Citation ID:
RRID:MMRRC_039762-MU
Other Names:
R1730 (G1), C57BL/6J-MtgxR1730Btlr
Major Collection:

Gene Information

Ppp2r2d
Name: protein phosphatase 2, regulatory subunit B, delta
Synonyms: 1300017E19Rik, MDS026, D7Ertd753e
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 7
NCBI: 52432
Homologene: 81915
Septin4
Name: septin 4
Synonyms: cell division control-related protein 2b, Pnutl2, Bh5, septin H5, ARTS, Sept4
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 11
NCBI: 18952
HGNC: HGNC:9165
Homologene: 6107
En1
Name: engrailed 1
Synonyms: Mo-en.1, En-1, engrailed-1
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 1
NCBI: 13798
HGNC: HGNC:3342
Homologene: 50663
Gpr37l1
Name: G protein-coupled receptor 37-like 1
Synonyms: CAG-18, D0Kist8
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 1
NCBI: 171469
Homologene: 3500
Gabarap
Name: gamma-aminobutyric acid receptor associated protein
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 11
NCBI: 56486
HGNC: HGNC:4067
Homologene: 134119
Kcnj5
Name: potassium inwardly-rectifying channel, subfamily J, member 5
Synonyms: Kir3.4, GIRK4
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 9
NCBI: 16521
VEGA: 9
HGNC: HGNC:6266
Homologene: 20248
H2-D1
Name: histocompatibility 2, D region locus 1
Synonyms: H-2D
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 17
NCBI: 14964
HGNC: HGNC:4931
Homologene: 128352
Jarid2
Name: jumonji, AT rich interactive domain 2
Synonyms: Jmj, jumonji
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 13
NCBI: 16468
HGNC: HGNC:6196
Homologene: 31279
Kdm5b
Name: lysine (K)-specific demethylase 5B
Synonyms: PLU-1, 2010009J12Rik, Rb-Bp2, Plu1, 2210016I17Rik, D1Ertd202e, Jarid1b
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 1
NCBI: 75605
Homologene: 48448
Gatad2a
Name: GATA zinc finger domain containing 2A
Synonyms: 1110066C11Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 8
NCBI: 234366
Homologene: 9766
Gli2
Name: GLI-Kruppel family member GLI2
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 1
NCBI: 14633
HGNC: HGNC:4318
Homologene: 12725
Atm
Name: ataxia telangiectasia mutated
Synonyms: C030026E19Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 9
NCBI: 11920
HGNC: HGNC:795
Homologene: 30952
Cdk18
Name: cyclin-dependent kinase 18
Synonyms: Pctk3
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 1
NCBI: 18557
HGNC: HGNC:8751
Homologene: 1949
Tfg
Name: Trk-fused gene
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 16
NCBI: 21787
Homologene: 4426
Nr5a2
Name: nuclear receptor subfamily 5, group A, member 2
Synonyms: Ftf, LRH-1, D1Ertd308e, UF2-H3B
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 1
NCBI: 26424
HGNC: HGNC:7984
Homologene: 20827
Bag3
Name: BCL2-associated athanogene 3
Synonyms: Bis, Bcl-2-interacting death suppressor
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 7
NCBI: 29810
HGNC: HGNC:939
Homologene: 3162
Cxcr4
Name: chemokine (C-X-C motif) receptor 4
Synonyms: PB-CKR, fusin, CD184, Cmkar4, Sdf1r, b2b220Clo
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 1
NCBI: 12767
HGNC: HGNC:2561
Homologene: 20739
Carmil1
Name: capping protein regulator and myosin 1 linker 1
Synonyms: 1110037D04Rik, Lrrc16, Carmil, Lrrc16a
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 13
NCBI: 68732
Homologene: 9757
Aff1
Name: AF4/FMR2 family, member 1
Synonyms: Af4, Rob, 9630032B01Rik, Mllt2h
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 5
NCBI: 17355
HGNC: HGNC:7135
Homologene: 4340
Ercc6
Name: excision repair cross-complementing rodent repair deficiency, complementation group 6
Synonyms: CS group B correcting gene, CSB, C130058G22Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 14
NCBI: 319955
VEGA: 14
HGNC: HGNC:3438
Homologene: 133552
Ccdc93
Name: coiled-coil domain containing 93
Synonyms: 9230102M16Rik, 4633402D15Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 1
NCBI: 70829
Homologene: 10393
Zc3h11a
Name: zinc finger CCCH type containing 11A
Synonyms: 1110003F06Rik, 5730454B08Rik, G630041M05Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 1
NCBI: 70579
Homologene: 8888
Aspm
Name: abnormal spindle microtubule assembly
Synonyms: Sha1, Aspm, D330028K02Rik, MCPH5, Calmbp1
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 1
NCBI: 12316
Homologene: 7650
Xpo6
Name: exportin 6
Synonyms: Ranbp20, C230091E20Rik, 2610005L19Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 7
NCBI: 74204
Homologene: 12544
Gspt1
Name: G1 to S phase transition 1
Synonyms: Gst-1, Gst-1, G1st
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 16
NCBI: 14852
HGNC: HGNC:4621
Homologene: 68226
Dmtf1
Name: cyclin D binding myb-like transcription factor 1
Synonyms: Dmp1
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 5
NCBI: 23857
Homologene: 8017
Camsap2
Name: calmodulin regulated spectrin-associated protein family, member 2
Synonyms: 1600013L13Rik, 4930541M15Rik, Camsap1l1
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 1
NCBI: 67886
Homologene: 18927
Ttk
Name: Ttk protein kinase
Synonyms: Esk1, Mps1
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 9
NCBI: 22137
Homologene: 2489
Nfrkb
Name: nuclear factor related to kappa B binding protein
Synonyms: A530090G11Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 9
NCBI: 235134
HGNC: HGNC:7802
Homologene: 4492
Rad17
Name: RAD17 checkpoint clamp loader component
Synonyms: MmRad24, 9430035O09Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 13
NCBI: 19356
VEGA: 13
HGNC: HGNC:9807
Homologene: 32117
Phldb1
Name: pleckstrin homology like domain, family B, member 1
Synonyms: LL5A, D330037A14Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 9
NCBI: 102693
Homologene: 15903
Ddx18
Name: DEAD box helicase 18
Synonyms: 2310005B10Rik, DEAD (Asp-Glu-Ala-Asp) box polypeptide 18
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 1
NCBI: 66942
HGNC: HGNC:2741
Homologene: 6697
Wars
Name: tryptophanyl-tRNA synthetase
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 12
NCBI: 22375
Homologene: 3084
Ipo9
Name: importin 9
Synonyms: 0710008K06Rik, Imp9
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 1
NCBI: 226432
Homologene: 5874
Cnr1
Name: cannabinoid receptor 1 (brain)
Synonyms: CB1, CB1R
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 4
NCBI: 12801
HGNC: HGNC:2159
Homologene: 7273
Cd55
Name: CD55 molecule, decay accelerating factor for complement
Synonyms: Daf-GPI, complement-glycosylphosphatidylinositol, GPI-DAF, Cromer blood group, Daf1
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 1
NCBI: 13136
HGNC: HGNC:2665
Homologene: 479
Ptprc
Name: protein tyrosine phosphatase, receptor type, C
Synonyms: T200, B220, CD45, Ly-5, Lyt-4
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 1
NCBI: 19264
HGNC: HGNC:9666
Homologene: 2126
Dennd1b
Name: DENN/MADD domain containing 1B
Synonyms: F730008N07Rik, 4632404N19Rik, 4930467M19Rik, 6820401H01Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 1
NCBI: 329260
Homologene: 11739
Pigr
Name: polymeric immunoglobulin receptor
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 1
NCBI: 18703
HGNC: HGNC:8968
Homologene: 1984
Nrip1
Name: nuclear receptor interacting protein 1
Synonyms: RIP140, 6030458L20Rik, 8430438I05Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 16
NCBI: 268903
HGNC: HGNC:8001
Homologene: 2606
Ptgfrn
Name: prostaglandin F2 receptor negative regulator
Synonyms: CD9P-1, 4833445A08Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 3
NCBI: 19221
HGNC: HGNC:9601
Homologene: 7908
Cep63
Name: centrosomal protein 63
Synonyms: CD20R, ET2, D9Mgc41, D9Mgc48e
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 9
NCBI: 28135
Homologene: 11861
Setd1a
Name: SET domain containing 1A
Synonyms: KMT2F
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 7
NCBI: 233904
Homologene: 52251
Syt2
Name: synaptotagmin II
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 1
NCBI: 20980
Homologene: 22516
Cdh19
Name: cadherin 19, type 2
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 1
NCBI: 227485
HGNC: HGNC:1758
Homologene: 23286
Lgr6
Name: leucine-rich repeat-containing G protein-coupled receptor 6
Synonyms: A530037C04Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 1
NCBI: 329252
Homologene: 49680
Dsg2
Name: desmoglein 2
Synonyms: D18Ertd293e
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 18
NCBI: 13511
HGNC: HGNC:3049
Homologene: 1464
Pms1
Name: PMS1 homolog 1, mismatch repair system component
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 1
NCBI: 227099
HGNC: HGNC:9121
Homologene: 449
Cyb5r1
Name: cytochrome b5 reductase 1
Synonyms: B5R.1, 1500005G05Rik, Nqo3a2
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 1
NCBI: 72017
Homologene: 96059
Fam72a
Name: family with sequence similarity 72, member A
Synonyms: 2700049P18Rik, P17
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 1
NCBI: 108900
Homologene: 82352
Inava
Name: innate immunity activator
Synonyms: 5730559C18Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 1
NCBI: 67313
Homologene: 10103
Pard6g
Name: par-6 family cell polarity regulator gamma
Synonyms: 2410049N21Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 18
NCBI: 93737
VEGA: 18
Homologene: 36487
Nav1
Name: neuron navigator 1
Synonyms: POMFIL3, 9930003A20Rik, C230080M11Rik, unc53H1, steerin-1
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 1
NCBI: 215690
Homologene: 10719
Uggt1
Name: UDP-glucose glycoprotein glucosyltransferase 1
Synonyms: A930007H10Rik, C820010P03Rik, 0910001L17Rik, Ugcgl1
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 1
NCBI: 320011
Homologene: 10586
Klhl20
Name: kelch-like 20
Synonyms: D930050H05Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 1
NCBI: 226541
Homologene: 8699
Susd4
Name: sushi domain containing 4
Synonyms: E430021N18Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 1
NCBI: 96935
Homologene: 23062
Olfml2b
Name: olfactomedin-like 2B
Synonyms: 1110018N05Rik, 4832415H08Rik, photomedin-2
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 1
NCBI: 320078
Homologene: 18546
Ppp1r12b
Name: protein phosphatase 1, regulatory subunit 12B
Synonyms: 1810037O03Rik, 9530009M10Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 1
NCBI: 329251
HGNC: HGNC:7619
Homologene: 135710
Ube2t
Name: ubiquitin-conjugating enzyme E2T
Synonyms: 2700084L22Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 1
NCBI: 67196
Homologene: 40929
Steap3
Name: STEAP family member 3
Synonyms: pHyde, 1010001D01Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 1
NCBI: 68428
Homologene: 10084
Tnni1
Name: troponin I, skeletal, slow 1
Synonyms: 2700018B22Rik, ssTnI
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 1
NCBI: 21952
Homologene: 2462
Ttn
Name: titin
Synonyms: connectin, L56, mdm, 1100001C23Rik, D830007G01Rik, 2310036G12Rik, 2310074I15Rik, 2310057K23Rik, D330041I19Rik, shru
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 2
NCBI: 22138
Homologene: 130650
Crb1
Name: crumbs family member 1, photoreceptor morphogenesis associated
Synonyms: A930008G09Rik, 7530426H14Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 1
NCBI: 170788
HGNC: HGNC:2343
Homologene: 8092
Elf3
Name: E74-like factor 3
Synonyms: jen, ESX, ESE-1
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 1
NCBI: 13710
HGNC: HGNC:3318
Homologene: 3265
Col12a1
Name: collagen, type XII, alpha 1
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 9
NCBI: 12816
HGNC: HGNC:2188
Homologene: 3217
Rnpep
Name: arginyl aminopeptidase (aminopeptidase B)
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 1
NCBI: 215615
Homologene: 10628
Gm4847
Name: predicted gene 4847
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 1
NCBI: 226604
Homologene: 101040
Mrc1
Name: mannose receptor, C type 1
Synonyms: CD206, MR
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 2
NCBI: 17533
HGNC: HGNC:7228
Homologene: 37622
Mgam
Name: maltase-glucoamylase
Synonyms: 6030407P20Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 6
NCBI: 232714
HGNC: HGNC:7043
Homologene: 130099
Mapkapk2
Name: MAP kinase-activated protein kinase 2
Synonyms: MAPKAP kinase 2, Rps6kc1, MK2
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 1
NCBI: 17164
HGNC: HGNC:6887
Homologene: 56412
Myh7b
Name: myosin, heavy chain 7B, cardiac muscle, beta
Synonyms: Myh14
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 2
NCBI: 668940
Homologene: 66117
Olfr371
Name: olfactory receptor 371
Synonyms: GA_x6K02T2NUPS-13298842-13299780, MOR141-3
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 8
NCBI: 258858
Homologene: 65998
Sctr
Name: secretin receptor
Synonyms: 6530402O03Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 1
NCBI: 319229
Homologene: 68290
Eogt
Name: EGF domain-specific O-linked N-acetylglucosamine (GlcNAc) transferase
Synonyms: A130022J15Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 6
NCBI: 101351
Homologene: 65276
Zfp804b
Name: zinc finger protein 804B
Synonyms: LOC207618
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 5
NCBI: 207618
Homologene: 52304
Fam131b
Name: family with sequence similarity 131, member B
Synonyms: 6530406I18Rik, 6330503C03Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 6
NCBI: 76156
Homologene: 8797
Cdh7
Name: cadherin 7, type 2
Synonyms: CDH7L1, 9330156F07Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 1
NCBI: 241201
HGNC: HGNC:1766
Homologene: 68391
Cacna1s
Name: calcium channel, voltage-dependent, L type, alpha 1S subunit
Synonyms: Cchl1a3, fmd, mdg, sj, muscle dysgenesis, Cav1.1, DHPR alpha1s
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 1
NCBI: 12292
HGNC: HGNC:1397
Homologene: 37257
Rims1
Name: regulating synaptic membrane exocytosis 1
Synonyms: RIM1, RIM1a, C030033M19Rik, RIM1alpha
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 1
NCBI: 116837
Homologene: 128399
Obscn
Name: obscurin, cytoskeletal calmodulin and titin-interacting RhoGEF
Synonyms: LOC380698, OTTMUSG00000005786
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 11
NCBI: 380698
Homologene: 70869
Tbc1d17
Name: TBC1 domain family, member 17
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 7
NCBI: 233204
Homologene: 11656
Ppfia4
Name: protein tyrosine phosphatase, receptor type, f polypeptide (PTPRF), interacting protein (liprin), alpha 4
Synonyms: 1110008G13Rik, LOC100042382, Liprin-alpha4, Gm3812
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 1
NCBI: 68507
HGNC: HGNC:9248
Homologene: 66200
Ap3b2
Name: adaptor-related protein complex 3, beta 2 subunit
Synonyms: Naptb, beta3B
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 7
NCBI: 11775
HGNC: HGNC:567
Homologene: 55837
Eya2
Name: EYA transcriptional coactivator and phosphatase 2
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 2
NCBI: 14049
HGNC: HGNC:3520
Homologene: 40711
Cped1
Name: cadherin-like and PC-esterase domain containing 1
Synonyms: A430107O13Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 6
NCBI: 214642
Homologene: 57014
Synpo2l
Name: synaptopodin 2-like
Synonyms: 1110054M18Rik, Chap
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 14
NCBI: 68760
Homologene: 23499
Mybph
Name: myosin binding protein H
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 1
NCBI: 53311
HGNC: HGNC:7552
Homologene: 3661
Ctse
Name: cathepsin E
Synonyms: CE, CatE, A430072O03Rik, C920004C08Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 1
NCBI: 13034
HGNC: HGNC:2530
Homologene: 37551
Slc36a1
Name: solute carrier family 36 (proton/amino acid symporter), member 1
Synonyms: Pat1, 5830411H19Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 11
NCBI: 215335
Homologene: 121860
Chil1
Name: chitinase-like 1
Synonyms: Brp39, Gp39, Chi3l1
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 1
NCBI: 12654
HGNC: HGNC:1932
Homologene: 55569
Polr2i
Name: polymerase (RNA) II (DNA directed) polypeptide I
Synonyms: 2810002B19Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 7
NCBI: 69920
HGNC: HGNC:9196
Homologene: 4541
Mroh3
Name: maestro heat-like repeat family member 3
Synonyms: 2310006M14Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 1
NCBI: 76422
Acad11
Name: acyl-Coenzyme A dehydrogenase family, member 11
Synonyms: 5730439E10Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 9
NCBI: 102632
Homologene: 49896
Gucy1a2
Name: guanylate cyclase 1, soluble, alpha 2
Synonyms: 6330407I18Rik, A230060L24Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 9
NCBI: 234889
HGNC: HGNC:4684
Homologene: 47953
Plekha6
Name: pleckstrin homology domain containing, family A member 6
Synonyms: Pepp3
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 1
NCBI: 240753
Homologene: 135779
Zfp541
Name: zinc finger protein 541
Synonyms: EG666528
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 7
NCBI: 666528
Homologene: 12991
Serpinb10
Name: serine (or cysteine) peptidase inhibitor, clade B (ovalbumin), member 10
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 1
NCBI: 241197
HGNC: HGNC:8942
Homologene: 68430
Kif14
Name: kinesin family member 14
Synonyms: N-3 kinesin, D1Ertd367e
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 1
NCBI: 381293
Homologene: 8916
Olfr951
Name: olfactory receptor 951
Synonyms: GA_x6K02T2PVTD-33090395-33091330, MOR171-33P, MOR171-49
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 9
NCBI: 258046
VEGA: 9
Homologene: 71961
Rab7b
Name: RAB7B, member RAS oncogene family
Synonyms: Rab7b, 5430435G22Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 1
NCBI: 226421
Homologene: 64833
Dstyk
Name: dual serine/threonine and tyrosine protein kinase
Synonyms: A930019K20Rik, C430014H23Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 1
NCBI: 213452
Homologene: 19711
Kcna5
Name: potassium voltage-gated channel, shaker-related subfamily, member 5
Synonyms: Kv1.5
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 6
NCBI: 16493
HGNC: HGNC:6224
Homologene: 1683
Tmem143
Name: transmembrane protein 143
Synonyms: 2310076O21Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 7
NCBI: 70209
Homologene: 10105
Igfn1
Name: immunoglobulin-like and fibronectin type III domain containing 1
Synonyms: 9830123M21Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 1
NCBI: 226438
Homologene: 130054
Sipa1l2
Name: signal-induced proliferation-associated 1 like 2
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 8
NCBI: 244668
Homologene: 18956
Aass
Name: aminoadipate-semialdehyde synthase
Synonyms: LOR/SDH, Lorsdh
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 6
NCBI: 30956
Homologene: 4212
Parp6
Name: poly (ADP-ribose) polymerase family, member 6
Synonyms: 2310028P13Rik, 1700119G14Rik, C030013N01Rik, 3110038K10Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 9
NCBI: 67287
VEGA: 9
Homologene: 10627
Thsd7b
Name: thrombospondin, type I, domain containing 7B
Synonyms: 1700074E13Rik, D130067I03Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 1
NCBI: 210417
Homologene: 18180
Kif21b
Name: kinesin family member 21B
Synonyms: N-5 kinesin, 2610511N21Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 1
NCBI: 16565
Homologene: 56868
Trim47
Name: tripartite motif-containing 47
Synonyms: 2210023F24Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 11
NCBI: 217333
Homologene: 14128
Dsel
Name: dermatan sulfate epimerase-like
Synonyms: 9330132E09Rik, DS-epi2
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 1
NCBI: 319901
Homologene: 12964
Ddx59
Name: DEAD box helicase 59
Synonyms: 4833411G06Rik, 1210002B07Rik, DEAD (Asp-Glu-Ala-Asp) box polypeptide 59
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 1
NCBI: 67997
Homologene: 12222
Vwa5b2
Name: von Willebrand factor A domain containing 5B2
Synonyms: EG328644
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 16
NCBI: 328643
Homologene: 28056
Kcnt2
Name: potassium channel, subfamily T, member 2
Synonyms: E330038N15Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 1
NCBI: 240776
Homologene: 16121
Mcam
Name: melanoma cell adhesion molecule
Synonyms: s-endo, CD146, s-gicerin, 1-gicerin, Muc18
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 9
NCBI: 84004
HGNC: HGNC:6934
Homologene: 4742
Cfh
Name: complement component factor h
Synonyms: Sas-1, Mud-1, Sas1
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 1
NCBI: 12628
HGNC: HGNC:4883
Homologene: 20086
Ren1
Name: renin 1 structural
Synonyms: Ren1d, Ren-A, Rn-1, Ren, Rnr, Ren-1, Ren1c
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 1
NCBI: 19701
HGNC: HGNC:9958
Homologene: 20151
Etnppl
Name: ethanolamine phosphate phospholyase
Synonyms: 1300019H02Rik, Agxt2l1
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 3
NCBI: 71760
Homologene: 69440
Obsl1
Name: obscurin-like 1
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 1
NCBI: 98733
Serpinb8
Name: serine (or cysteine) peptidase inhibitor, clade B, member 8
Synonyms: ovalbumin, CAP-2, CAP2, Spi8, NK10
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 1
NCBI: 20725
HGNC: HGNC:8952
Homologene: 74445
Usp9y
Name: ubiquitin specific peptidase 9, Y chromosome
Synonyms: Dffry, Fafl2
Type: Gene
Species: Mus musculus (mouse)
Chromosome: Y
NCBI: 107868
Homologene: 68408
Cntnap5a
Name: contactin associated protein-like 5A
Synonyms: Caspr5-1
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 1
NCBI: 636808
Homologene: 43974
1110051M20Rik
Name: RIKEN cDNA 1110051M20 gene
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 2
NCBI: 228356
Homologene: 11471
Olfr1240
Name: olfactory receptor 1240
Synonyms: GA_x6K02T2Q125-50883183-50882239, MOR231-8
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 2
NCBI: 258804
Homologene: 121591
Zbed6
Name: zinc finger, BED type containing 6
Synonyms: similar to Zinc finger BED domain containing protein 4, Gm8466, MGR
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 1
NCBI: 667118
Homologene: 130066
Ro60
Name: Ro60, Y RNA binding protein
Synonyms: SS-A/Ro, Ssa, A530054J02Rik, 1810007I17Rik, Ssa2, Trove2
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 1
NCBI: 20822
Homologene: 3383
Gba2
Name: glucosidase beta 2
Synonyms: bile acid
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 4
NCBI: 230101
Homologene: 10859
Abi3bp
Name: ABI family member 3 binding protein
Synonyms: 5033411B22Rik, D930038M13Rik, eratin, TARSH
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 16
NCBI: 320712
VEGA: 16
Homologene: 134172
Lax1
Name: lymphocyte transmembrane adaptor 1
Synonyms: E430019B13Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 1
NCBI: 240754
Homologene: 49504
Akr1b7
Name: aldo-keto reductase family 1, member B7
Synonyms: MVDP, Avdp
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 6
NCBI: 11997
Homologene: 122176
Ikbke
Name: inhibitor of kappaB kinase epsilon
Synonyms: IKK-i, IKKepsilon
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 1
NCBI: 56489
Homologene: 23168
Olfr1012
Name: olfactory receptor 1012
Synonyms: GA_x6K02T2Q125-47239120-47238185, MOR213-6
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 2
NCBI: 258561
Homologene: 64889
Cyp2c29
Name: cytochrome P450, family 2, subfamily c, polypeptide 29
Synonyms: AHOH, AHOHase, Ahh-1, Ah-2, P450-2C, Cyp2c
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 19
NCBI: 13095
HGNC: HGNC:2622
Homologene: 117948
Zp3r
Name: zona pellucida 3 receptor
Synonyms: SP56
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 1
NCBI: 22789
Homologene: 7609
Sele
Name: selectin, endothelial cell
Synonyms: E-selectin, CD62E, Elam
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 1
NCBI: 20339
Homologene: 389
Pik3c2b
Name: phosphatidylinositol-4-phosphate 3-kinase catalytic subunit type 2 beta
Synonyms: PI3K-C2beta, C330011J12Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 1
NCBI: 240752
HGNC: HGNC:8972
Homologene: 20582
Cfhr2
Name: complement factor H-related 2
Synonyms: FHR-B
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 1
NCBI: 545366
Homologene: 134349
Ptpn7
Name: protein tyrosine phosphatase, non-receptor type 7
Synonyms: LC-PTP, BPTP-4, C920001D21Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 1
NCBI: 320139
HGNC: HGNC:9659
Homologene: 15411
Lmod1
Name: leiomodin 1 (smooth muscle)
Synonyms: 64kD D1, 1D, D1, SM-Lmod, 9530015K06Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 1
NCBI: 93689
HGNC: HGNC:6647
Homologene: 8118
Cyp2c68
Name: cytochrome P450, family 2, subfamily c, polypeptide 68
Synonyms: 9030012A22Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 19
NCBI: 433247
Homologene: 74936
Map3k9
Name: mitogen-activated protein kinase kinase kinase 9
Synonyms: Mlk1
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 12
NCBI: 338372
VEGA: 12
HGNC: HGNC:6861
Homologene: 76377
Olfr1417
Name: olfactory receptor 1417
Synonyms: GA_x6K02T2RE5P-2172809-2171862, MOR266-2
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 19
NCBI: 258938
Homologene: 27304
4930590J08Rik
Name: RIKEN cDNA 4930590J08 gene
Synonyms: LOC381798
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 6
NCBI: 381798
Homologene: 49985
Lin7b
Name: lin-7 homolog B (C. elegans)
Synonyms: LIN-7B, MALS-2, Veli2
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 7
NCBI: 22342
Homologene: 22648
Nfkbib
Name: nuclear factor of kappa light polypeptide gene enhancer in B cells inhibitor, beta
Synonyms: IKappaBbeta, IkB
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 7
NCBI: 18036
HGNC: HGNC:7798
Homologene: 37631
Slc26a9
Name: solute carrier family 26, member 9
Synonyms: anion transporter/exchanger-9, E030002L01Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 1
NCBI: 320718
Homologene: 14179
Rgs18
Name: regulator of G-protein signaling 18
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 1
NCBI: 64214
Homologene: 11281
Olfr924
Name: olfactory receptor 924
Synonyms: GA_x6K02T2PVTD-32543982-32544908, MOR171-27P, MOR171-47, MOR171-27P, Olfr1520-ps1
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 9
NCBI: 404322
VEGA: 9
HGNC: HGNC:8482
Homologene: 128215
Olfr1307
Name: olfactory receptor 1307
Synonyms: GA_x6K02T2Q125-72988111-72987173, MOR245-19P
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 2
NCBI: 257956
Homologene: 128383
Tnnt2
Name: troponin T2, cardiac
Synonyms: Tnt, cTnT, cardiac TnT
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 1
NCBI: 21956
Homologene: 68050
Chit1
Name: chitinase 1 (chitotriosidase)
Synonyms: 2300002L19Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 1
NCBI: 71884
HGNC: HGNC:1936
Homologene: 68318
Optc
Name: opticin
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 1
NCBI: 269120
HGNC: HGNC:8158
Homologene: 8652
Prelp
Name: proline arginine-rich end leucine-rich repeat
Synonyms: 7330409J17Rik, SLRR2A
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 1
NCBI: 116847
HGNC: HGNC:9357
Homologene: 2041
C4bp
Name: complement component 4 binding protein
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 1
NCBI: 12269
Fcamr
Name: Fc receptor, IgA, IgM, high affinity
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 1
NCBI: 64435
Homologene: 12929
Etnk2
Name: ethanolamine kinase 2
Synonyms: 4933417N20Rik, Eki2
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 1
NCBI: 214253
Homologene: 10072
Olfr453
Name: olfactory receptor 453
Synonyms: GA_x6K02T2P3E9-4815856-4814903, MOR257-8P
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 6
NCBI: 258016
HGNC: HGNC:8246
Homologene: 128151
Serpinb2
Name: serine (or cysteine) peptidase inhibitor, clade B, member 2
Synonyms: PAI-2, Planh2, ovalbumin
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 1
NCBI: 18788
HGNC: HGNC:8584
Homologene: 20571
Fcmr
Name: Fc fragment of IgM receptor
Synonyms: 1810037B05Rik, FcmuR, Faim3
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 1
NCBI: 69169
Homologene: 48347
Ankdd1b
Name: ankyrin repeat and death domain containing 1B
Synonyms: 9330128J19Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 13
NCBI: 271144
Homologene: 19566
Lad1
Name: ladinin
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 1
NCBI: 16763
HGNC: HGNC:6472
Homologene: 4059
Gm4793
Name: predicted gene 4793
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 1
NCBI: 215714
Rab29
Name: RAB29, member RAS oncogene family
Synonyms: Rab7l1
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 1
NCBI: 226422
HGNC: HGNC:9789
Homologene: 20842
Ptprv
Name: protein tyrosine phosphatase, receptor type, V
Synonyms: mOST-PTP, Esp, OST-PTP, OST
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 1
NCBI: 13924
Homologene: 7306
Gm10961
Name: predicted gene 10961
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 3
NCBI: 102639972
VEGA: 3
Slc25a41
Name: solute carrier family 25, member 41
Synonyms: 4933406J04Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 17
NCBI: 103775
Homologene: 27855
Genetic Alterations
ENU-induced transitions at the following base pair locations (GRCm38):
  • C to T, chromosome 1 at 22,346,529 bp
  • T to C, chromosome 1 at 36,221,261 bp
  • T to C, chromosome 1 at 53,194,920 bp
  • G to A, chromosome 1 at 75,486,756 bp
  • G to A, chromosome 1 at 107,515,635 bp
  • C to A, chromosome 1 at 107,523,834 bp
  • C to T, chromosome 1 at 107,523,890 bp
  • C to T, chromosome 1 at 107,523,894 bp
  • G to A, chromosome 1 at 107,523,975 bp
  • A to C, chromosome 1 at 107,524,543 bp
  • C to T, chromosome 1 at 107,538,473 bp
  • A to G, chromosome 1 at 107,597,527 bp
  • G to A, chromosome 1 at 107,598,954 bp
  • A to C, chromosome 1 at 107,607,004 bp
  • C to G, chromosome 1 at 110,065,735 bp
  • C to A, chromosome 1 at 110,893,384 bp
  • T to C, chromosome 1 at 111,859,457 bp
  • G to C, chromosome 1 at 111,859,994 bp
  • C to A, chromosome 1 at 116,455,004 bp
  • T to C, chromosome 1 at 116,455,101 bp
  • C to T, chromosome 1 at 116,455,143 bp
  • G to A, chromosome 1 at 116,455,224 bp
  • C to T, chromosome 1 at 118,868,087 bp
  • A to T, chromosome 1 at 119,002,029 bp
  • G to T, chromosome 1 at 119,002,044 bp
  • T to C, chromosome 1 at 120,031,656 bp
  • G to A, chromosome 1 at 120,063,257 bp
  • T to C, chromosome 1 at 120,227,750 bp
  • G to A, chromosome 1 at 120,234,378 bp
  • T to C, chromosome 1 at 120,243,757 bp
  • T to C, chromosome 1 at 120,270,115 bp
  • A to G, chromosome 1 at 120,603,621 bp
  • A to G, chromosome 1 at 121,456,061 bp
  • C to T, chromosome 1 at 121,456,126 bp
  • T to C, chromosome 1 at 121,461,939 bp
  • T to C, chromosome 1 at 121,559,334 bp
  • C to T, chromosome 1 at 128,589,277 bp
  • C to T, chromosome 1 at 129,628,891 bp
  • T to A, chromosome 1 at 129,667,937 bp
  • G to C, chromosome 1 at 129,678,183 bp
  • T to C, chromosome 1 at 129,915,756 bp
  • T to G, chromosome 1 at 130,103,066 bp
  • A to C, chromosome 1 at 130,116,631 bp
  • T to C, chromosome 1 at 130,116,717 bp
  • C to T, chromosome 1 at 130,449,423 bp
  • G to A, chromosome 1 at 130,458,078 bp
  • C to A, chromosome 1 at 130,459,633 bp
  • A to G, chromosome 1 at 130,596,651 bp
  • A to G, chromosome 1 at 130,596,814 bp
  • C to A, chromosome 1 at 130,619,414 bp
  • C to G, chromosome 1 at 130,642,988 bp
  • A to G, chromosome 1 at 130,811,580 bp
  • G to A, chromosome 1 at 130,812,629 bp
  • A to G, chromosome 1 at 130,812,692 bp
  • T to C, chromosome 1 at 130,812,738 bp
  • A to G, chromosome 1 at 130,812,809 bp
  • C to T, chromosome 1 at 130,812,816 bp
  • A to G, chromosome 1 at 130,814,597 bp
  • C to T, chromosome 1 at 130,844,522 bp
  • A to G, chromosome 1 at 130,875,974 bp
  • T to C, chromosome 1 at 130,878,269 bp
  • G to T, chromosome 1 at 131,056,406 bp
  • C to A, chromosome 1 at 131,265,937 bp
  • T to C, chromosome 1 at 131,269,823 bp
  • T to C, chromosome 1 at 131,530,668 bp
  • C to T, chromosome 1 at 131,538,895 bp
  • ACTCTCTCTCTCTCTCT to ACTCTCTCTCTCTCTCTCT, chromosome 1 at 131,663,285 bp
  • T to C, chromosome 1 at 131,697,817 bp
  • G to T, chromosome 1 at 131,697,819 bp
  • T to C, chromosome 1 at 131,698,409 bp
  • C to T, chromosome 1 at 131,758,590 bp
  • C to T, chromosome 1 at 131,763,870 bp
  • T to C, chromosome 1 at 131,765,876 bp
  • A to G, chromosome 1 at 131,872,110 bp
  • T to C, chromosome 1 at 132,115,859 bp
  • G to A, chromosome 1 at 132,453,334 bp
  • C to T, chromosome 1 at 132,456,984 bp
  • C to T, chromosome 1 at 133,066,627 bp
  • C to T, chromosome 1 at 133,071,339 bp
  • G to T, chromosome 1 at 133,282,278 bp
  • C to G, chromosome 1 at 133,287,846 bp
  • T to A, chromosome 1 at 133,354,206 bp
  • C to T, chromosome 1 at 133,354,237 bp
  • A to G, chromosome 1 at 133,354,287 bp
  • C to T, chromosome 1 at 133,354,787 bp
  • A to C, chromosome 1 at 133,356,457 bp
  • T to C, chromosome 1 at 133,358,537 bp
  • A to T, chromosome 1 at 133,359,079 bp
  • A to T, chromosome 1 at 133,359,983 bp
  • C to G, chromosome 1 at 133,360,007 bp
  • A to G, chromosome 1 at 133,363,923 bp
  • C to A, chromosome 1 at 133,365,587 bp
  • G to T, chromosome 1 at 133,365,765 bp
  • C to T, chromosome 1 at 133,365,816 bp
  • G to A, chromosome 1 at 133,365,817 bp
  • T to C, chromosome 1 at 133,373,123 bp
  • T to C, chromosome 1 at 133,373,127 bp
  • T to A, chromosome 1 at 133,376,915 bp
  • G to A, chromosome 1 at 133,622,154 bp
  • C to T, chromosome 1 at 133,624,621 bp
  • A to G, chromosome 1 at 133,638,523 bp
  • T to C, chromosome 1 at 133,679,978 bp
  • T to C, chromosome 1 at 133,680,569 bp
  • G to A, chromosome 1 at 133,683,634 bp
  • A to T, chromosome 1 at 133,903,796 bp
  • C to G, chromosome 1 at 133,905,170 bp
  • C to T, chromosome 1 at 133,915,131 bp
  • T to C, chromosome 1 at 134,149,361 bp
  • C to T, chromosome 1 at 134,151,204 bp
  • C to T, chromosome 1 at 134,188,529 bp
  • A to G, chromosome 1 at 134,193,732 bp
  • C to T, chromosome 1 at 134,197,480 bp
  • G to A, chromosome 1 at 134,299,321 bp
  • C to G, chromosome 1 at 134,303,789 bp
  • C to T, chromosome 1 at 134,407,667 bp
  • C to T, chromosome 1 at 134,408,389 bp
  • C to T, chromosome 1 at 134,585,243 bp
  • A to G, chromosome 1 at 134,604,431 bp
  • T to G, chromosome 1 at 134,605,705 bp
  • C to G, chromosome 1 at 134,605,709 bp
  • ACTCTCTCT to ACTCTCTCTCT, chromosome 1 at 134,746,741 bp
  • G to A, chromosome 1 at 134,865,964 bp
  • C to T, chromosome 1 at 134,886,408 bp
  • AG to AGG, chromosome 1 at 134,971,364 bp
  • C to T, chromosome 1 at 134,972,167 bp
  • G to A, chromosome 1 at 134,972,201 bp
  • C to T, chromosome 1 at 134,987,088 bp
  • A to T, chromosome 1 at 134,988,009 bp
  • G to T, chromosome 1 at 134,990,635 bp
  • A to G, chromosome 1 at 135,000,469 bp
  • G to A, chromosome 1 at 135,003,275 bp
  • C to T, chromosome 1 at 135,003,451 bp
  • C to T, chromosome 1 at 135,003,476 bp
  • T to C, chromosome 1 at 135,111,440 bp
  • A to G, chromosome 1 at 135,134,475 bp
  • C to A, chromosome 1 at 135,161,530 bp
  • A to G, chromosome 1 at 135,256,335 bp
  • A to C, chromosome 1 at 135,257,299 bp
  • C to T, chromosome 1 at 135,263,096 bp
  • C to T, chromosome 1 at 135,364,073 bp
  • ATCCTCCTCCTCCTCCTC to ATCCTCCTCCTCCTCCTCCTC, chromosome 1 at 135,386,268 bp
  • A to G, chromosome 1 at 135,386,810 bp
  • C to T, chromosome 1 at 135,388,501 bp
  • A to C, chromosome 1 at 135,388,683 bp
  • A to G, chromosome 1 at 135,402,250 bp
  • A to G, chromosome 1 at 135,404,215 bp
  • A to G, chromosome 1 at 135,404,334 bp
  • G to C, chromosome 1 at 135,405,985 bp
  • T to C, chromosome 1 at 135,406,745 bp
  • A to G, chromosome 1 at 135,452,798 bp
  • T to C, chromosome 1 at 135,471,182 bp
  • C to A, chromosome 1 at 135,532,727 bp
  • A to T, chromosome 1 at 135,584,727 bp
  • G to A, chromosome 1 at 135,592,515 bp
  • A to T, chromosome 1 at 135,607,339 bp
  • A to G, chromosome 1 at 135,607,421 bp
  • C to T, chromosome 1 at 135,607,423 bp
  • C to A, chromosome 1 at 135,607,716 bp
  • T to G, chromosome 1 at 135,805,640 bp
  • C to T, chromosome 1 at 135,827,381 bp
  • C to T, chromosome 1 at 135,828,023 bp
  • C to T, chromosome 1 at 135,841,897 bp
  • A to G, chromosome 1 at 135,841,997 bp
  • C to T, chromosome 1 at 135,843,763 bp
  • C to T, chromosome 1 at 135,845,506 bp
  • TG to TGG, chromosome 1 at 135,846,761 bp
  • C to A, chromosome 1 at 135,847,786 bp
  • T to C, chromosome 1 at 135,852,024 bp
  • G to A, chromosome 1 at 135,954,556 bp
  • G to A, chromosome 1 at 135,959,928 bp
  • G to A, chromosome 1 at 135,968,199 bp
  • T to C, chromosome 1 at 135,970,411 bp
  • C to T, chromosome 1 at 135,972,127 bp
  • AGGG to AGG, chromosome 1 at 135,974,852 bp
  • C to T, chromosome 1 at 135,979,915 bp
  • G to A, chromosome 1 at 135,982,475 bp
  • T to C, chromosome 1 at 135,998,625 bp
  • T to C, chromosome 1 at 135,998,683 bp
  • T to C, chromosome 1 at 136,054,697 bp
  • C to G, chromosome 1 at 136,073,723 bp
  • T to C, chromosome 1 at 136,111,963 bp
  • T to C, chromosome 1 at 136,118,716 bp
  • C to T, chromosome 1 at 136,145,123 bp
  • T to C, chromosome 1 at 136,147,490 bp
  • C to T, chromosome 1 at 136,147,721 bp
  • A to C, chromosome 1 at 136,148,385 bp
  • A to G, chromosome 1 at 136,163,059 bp
  • G to C, chromosome 1 at 136,192,144 bp
  • G to A, chromosome 1 at 136,227,590 bp
  • C to T, chromosome 1 at 136,281,315 bp
  • C to T, chromosome 1 at 136,295,507 bp
  • T to C, chromosome 1 at 136,417,053 bp
  • T to C, chromosome 1 at 136,432,578 bp
  • A to G, chromosome 1 at 136,468,279 bp
  • A to G, chromosome 1 at 136,468,975 bp
  • G to A, chromosome 1 at 136,478,365 bp
  • A to G, chromosome 1 at 136,490,332 bp
  • CC to CCGAC, chromosome 1 at 136,490,395 bp
  • T to G, chromosome 1 at 136,496,556 bp
  • C to T, chromosome 1 at 136,503,431 bp
  • T to C, chromosome 1 at 136,515,961 bp
  • T to C, chromosome 1 at 136,525,783 bp
  • C to A, chromosome 1 at 136,952,125 bp
  • A to G, chromosome 1 at 138,080,273 bp
  • T to G, chromosome 1 at 138,099,676 bp
  • A to G, chromosome 1 at 138,107,823 bp
  • C to A, chromosome 1 at 138,107,824 bp
  • A to G, chromosome 1 at 138,107,837 bp
  • T to C, chromosome 1 at 138,112,254 bp
  • T to C, chromosome 1 at 138,966,234 bp
  • T to C, chromosome 1 at 139,039,996 bp
  • C to T, chromosome 1 at 139,059,141 bp
  • T to C, chromosome 1 at 139,234,779 bp
  • A to T, chromosome 1 at 139,237,622 bp
  • G to A, chromosome 1 at 139,241,138 bp
  • C to T, chromosome 1 at 139,242,995 bp
  • C to T, chromosome 1 at 139,243,417 bp
  • A to G, chromosome 1 at 139,473,574 bp
  • A to G, chromosome 1 at 139,813,442 bp
  • A to C, chromosome 1 at 139,813,459 bp
  • C to T, chromosome 1 at 140,147,697 bp
  • G to A, chromosome 1 at 140,354,547 bp
  • C to T, chromosome 1 at 143,760,014 bp
  • T to C, chromosome 1 at 143,760,034 bp
  • A to G, chromosome 1 at 143,765,929 bp
  • A to G, chromosome 1 at 144,773,509 bp
  • A to G, chromosome 1 at 161,102,990 bp
  • T to G, chromosome 1 at 164,054,623 bp
  • T to C, chromosome 1 at 166,638,339 bp
  • G to A, chromosome 1 at 170,681,789 bp
  • A to G, chromosome 1 at 182,853,978 bp
  • T to C, chromosome 2 at 14,327,844 bp
  • T to G, chromosome 2 at 76,716,992 bp
  • C to T, chromosome 2 at 76,813,339 bp
  • T to A, chromosome 2 at 85,760,242 bp
  • C to T, chromosome 2 at 89,439,583 bp
  • A to T, chromosome 2 at 91,421,975 bp
  • T to C, chromosome 2 at 111,945,288 bp
  • A to G, chromosome 2 at 155,625,672 bp
  • G to T, chromosome 2 at 165,687,663 bp
  • T to C, chromosome 3 at 101,056,442 bp
  • T to C, chromosome 3 at 107,632,994 bp
  • A to G, chromosome 3 at 130,620,749 bp
  • A to G, chromosome 4 at 33,943,851 bp
  • A to G, chromosome 4 at 43,578,242 bp
  • T to C, chromosome 5 at 6,771,938 bp
  • T to C, chromosome 5 at 9,137,111 bp
  • T to G, chromosome 5 at 103,833,512 bp
  • T to C, chromosome 6 at 22,120,969 bp
  • T to C, chromosome 6 at 23,121,019 bp
  • T to G, chromosome 6 at 34,417,269 bp
  • A to G, chromosome 6 at 40,664,860 bp
  • T to G, chromosome 6 at 42,318,580 bp
  • C to A, chromosome 6 at 42,744,135 bp
  • T to C, chromosome 6 at 91,919,278 bp
  • T to C, chromosome 6 at 97,113,864 bp
  • A to T, chromosome 6 at 126,533,860 bp
  • A to G, chromosome 7 at 16,077,973 bp
  • A to T, chromosome 7 at 28,762,055 bp
  • T to C, chromosome 7 at 30,233,068 bp
  • A to C, chromosome 7 at 44,845,131 bp
  • A to T, chromosome 7 at 45,369,927 bp
  • G to A, chromosome 7 at 45,907,002 bp
  • A to T, chromosome 7 at 81,476,733 bp
  • A to T, chromosome 7 at 126,110,082 bp
  • T to A, chromosome 7 at 127,785,124 bp
  • A to T, chromosome 7 at 128,523,859 bp
  • T to C, chromosome 7 at 138,869,866 bp
  • G to T, chromosome 8 at 69,909,936 bp
  • A to C, chromosome 8 at 85,230,848 bp
  • A to T, chromosome 8 at 125,480,141 bp
  • A to T, chromosome 9 at 3,634,957 bp
  • C to T, chromosome 9 at 31,414,636 bp
  • T to C, chromosome 9 at 32,322,192 bp
  • T to A, chromosome 9 at 38,848,972 bp
  • T to C, chromosome 9 at 39,394,222 bp
  • T to C, chromosome 9 at 44,134,706 bp
  • T to C, chromosome 9 at 44,694,362 bp
  • T to A, chromosome 9 at 53,458,983 bp
  • C to A, chromosome 9 at 59,633,538 bp
  • A to C, chromosome 9 at 79,628,378 bp
  • A to G, chromosome 9 at 83,868,592 bp
  • T to A, chromosome 9 at 102,618,867 bp
  • T to A, chromosome 9 at 104,063,882 bp
  • A to G, chromosome 11 at 55,223,672 bp
  • A to G, chromosome 11 at 59,073,633 bp
  • C to T, chromosome 11 at 69,991,689 bp
  • A to T, chromosome 11 at 87,583,436 bp
  • A to G, chromosome 11 at 116,106,038 bp
  • A to T, chromosome 12 at 81,722,226 bp
  • A to C, chromosome 12 at 108,875,741 bp
  • T to C, chromosome 13 at 24,041,689 bp
  • T to A, chromosome 13 at 44,906,276 bp
  • G to T, chromosome 13 at 96,460,903 bp
  • C to T, chromosome 13 at 100,622,806 bp
  • G to A, chromosome 14 at 20,665,819 bp
  • A to C, chromosome 14 at 32,552,561 bp
  • A to G, chromosome 16 at 11,238,863 bp
  • C to T, chromosome 16 at 20,600,925 bp
  • G to A, chromosome 16 at 56,668,279 bp
  • G to T, chromosome 16 at 56,712,789 bp
  • G to T, chromosome 16 at 76,292,890 bp
  • A to G, chromosome 17 at 35,263,405 bp
  • T to C, chromosome 17 at 57,039,921 bp
  • G to A, chromosome 18 at 20,591,880 bp
  • T to A, chromosome 18 at 80,079,825 bp
  • T to A, chromosome 19 at 11,828,081 bp
  • A to T, chromosome 19 at 39,324,945 bp
  • A to T, chromosome 19 at 39,699,275 bp
  • A to T, chromosome Y at 1,367,093 bp
Genotype Determination
Phenotype
G1 male heterozygous mice are viable and fertile. The G1 mice were not characterized prior to archiving.
Strain Development
C57BL/6J mice were injected with ENU, resulting in G0 mice that were bred back to C57BL/6J. Sperm was archived from G1 male mice that produced viable G2 mice.
Suggested Control Mice
Wild-type littermates or C57BL/6J mice
Donor
Bruce Beutler, M.D., University of Texas Southwestern Medical Center.
Primary Reference
MUTAGENETIX record for R1730 (G1). B. Beutler and colleagues, Center for the Genetics of Host Defense, UT Southwestern, Dallas, TX.

Colony and Husbandry Information

Colony Surveillance Program and Current Health Reports

Mice recovered from a cryo-archive will have health surveillance performed on recipient females. Health reports will be provided prior to shipment. If you require additional health status information, please email mmrrc@missouri.edu .
Coat Color
Black
MMRRC Breeding System
Random intra-strain mating
Breeding Scheme(s)
When maintaining a live colony, heterozygous mice may be bred together, bred with wild-type siblings, or bred with C57BL/6J inbred mice.
Overall Breeding Performance
Undetermined; during development, mating was done with heterozygous males; viability, fertility and other breeding statistics for heterozygous females and homozygotes are unverified, but presumably would be similar to the C57BL/6J background strain
Average litter size
Undetermined
Recommended wean age
3 weeks

Order Request Information

Limited quantities of breeder mice (recovered litter) are available from a cryoarchive; recovered litter usually available to ship in 3 to 4 months.

Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

Distribution of this strain requires submission of the MMRRC Conditions of Use (COU). A link to the COU web form will be provided via email after an order has been placed; the form should be completed then or the email forwarded to your institutional official for completion.

The donor or their institution limits the distribution to non-profit institutions only.

Additional charges may apply for any special requests. Shipping costs are in addition to the basic distribution/resuscitation fees. Information on shipping costs and any additional charges will be provided by the supplying MMRRC facility.

Click button to Request this one strain. (Use the MMRRC Catalog Search to request more than one strain.)
MMRRC Item # Description Distribution Fee / Unit (US $) Units Notes
039762-MU-RESUS Litter recovered from cryo-archive $5,475.00 / Non-Profit Litter Recovered litter4; additional fees for any special requests.
Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

Some MMRRC strains were submitted by the donor as cryopreserved germplasm, and because these strains were not cryopreserved by the MMRRC, we have not assessed the quality of this material. We have extensive experience with recovery of mice from cryopreserved sperm and embryos of varying quality, including using techniques such as IVF and ICSI, and are confident that we will have success in most, if not all, cases. However, because of the unknown quality of these frozen samples, we will restrict recovery efforts to two attempts for each order. Subsequent attempts can be performed on a fee-for-service basis, in addition to the standard fees, upon request.

1 The distribution fee covers the expense of rederiving mice from a live mouse; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

2 An aliquot contains a sufficient number of embryos (in one or more vials or straws and based on the transfer success rate of the MMRRC facility) to transfer into one to three recipients. The MMRRC makes no guarantee concerning embryo transfer success experienced in the recipient investigator's laboratory. Neither gender nor genotype ratios are guaranteed.

3 An aliquot is one straw or vial with sufficient sperm to recover at least one litter of mice, as per provided protocols, when performed at the MMRRC facility. The MMRRC makes no guarantee concerning the success of these procedures when performed outside the MMRRC facilities.

4 The distribution fee covers the expense of resuscitating mice from the cryo-archive; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

To request material from the MMRRC: Please fill out our on-line request form (accessible from the catalog search results page, or click the Request this Strain button in the fees section). If you have questions or need assistance completing this form, you may call Customer Service at (800) 910-2291 (in USA or Canada) or (530) 757-5710 (international calls). Before you call, please have with you: the MMRRC item number, quantity needed, Bill-to and Ship-to contact information.