Strain Name:
Stock Number:
Citation ID:
Other Names:
R1739 (G1), C57BL/6J-MtgxR1739Btlr
Major Collection:

Gene Information

Name: p21 (RAC1) activated kinase 1
Synonyms: PAK-1, Paka
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 7
NCBI: 18479
Homologene: 1936
Name: septin 4
Synonyms: cell division control-related protein 2b, Pnutl2, Bh5, septin H5, Gm11492, ARTS, Sept4
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 11
NCBI: 18952
Homologene: 6107
Name: dysferlin
Synonyms: 2310004N10Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 6
NCBI: 26903
Homologene: 20748
Name: engrailed 1
Synonyms: Mo-en.1, En-1, engrailed-1
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 1
NCBI: 13798
Homologene: 50663
Name: neuronal cell adhesion molecule
Synonyms: Bravo, C030017F07Rik, C130076O07Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 12
NCBI: 319504
VEGA: 12
Homologene: 21041
Name: jumonji, AT rich interactive domain 2
Synonyms: Jmj, jumonji
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 13
NCBI: 16468
Homologene: 31279
Name: ubiquitin-associated protein 2
Synonyms: 1190005K07Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 4
NCBI: 68926
Homologene: 73649
Name: lysine (K)-specific demethylase 5B
Synonyms: PLU-1, 2010009J12Rik, Rb-Bp2, Plu1, 2210016I17Rik, D1Ertd202e, Jarid1b
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 1
NCBI: 75605
Homologene: 48448
Name: PHD finger protein 21A
Synonyms: 80kDa, Braf35/HDAC complex (Bhc), PFTF1, Bhc80, D030065N23Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 2
NCBI: 192285
Homologene: 9597
Name: GLI-Kruppel family member GLI2
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 1
NCBI: 14633
Homologene: 12725
Name: Mov10 RISC complex RNA helicase
Synonyms: Mov-10
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 3
NCBI: 17454
Homologene: 10365
Name: EFR3 homolog A
Synonyms: A130089M23Rik, D030063F01Rik, C920006C10Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 15
NCBI: 76740
Homologene: 44222
Name: peptidylprolyl isomerase (cyclophilin)-like 2
Synonyms: C130078A06Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 16
NCBI: 66053
Homologene: 8643
Name: cyclin-dependent kinase 18
Synonyms: Pctk3
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 1
NCBI: 18557
Homologene: 1949
Name: nuclear receptor subfamily 5, group A, member 2
Synonyms: Ftf, LRH-1, D1Ertd308e, UF2-H3B
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 1
NCBI: 26424
Homologene: 20827
Name: acyl-CoA thioesterase 7
Synonyms: 2410041A17Rik, Bach, AU014716
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 4
NCBI: 70025
Homologene: 15780
Name: chemokine (C-X-C motif) receptor 4
Synonyms: PB-CKR, fusin, CD184, Cmkar4, Sdf1r, b2b220Clo
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 1
NCBI: 12767
Homologene: 20739
Name: diazepam binding inhibitor
Synonyms: diazepam-binding inhibitor, Acbp, EP, endozepine
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 1
NCBI: 13167
Homologene: 39086
Name: myotubularin related protein 12
Synonyms: C730015A02Rik, Pip3ap
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 15
NCBI: 268783
Homologene: 10403
Name: SUN domain containing ossification factor
Synonyms: osteopotentia, Opt, AI848100
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 1
NCBI: 226551
Homologene: 32212
Name: centrosomal protein 131
Synonyms: AZ1, Azi1
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 11
NCBI: 12009
Homologene: 7638
Name: alveolar soft part sarcoma chromosome region, candidate 1 (human)
Synonyms: ASPCR1, RCC17, ASPC, 1190006K01Rik, TUG, ASPL
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 11
NCBI: 68938
Homologene: 41550
Name: ataxia telangiectasia and Rad3 related
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 9
NCBI: 245000
Homologene: 96916
Name: K(lysine) acetyltransferase 7
Synonyms: Hboa, Hbo1, Myst2
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 11
NCBI: 217127
Homologene: 5134
Name: eukaryotic elongation factor, selenocysteine-tRNA-specific
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 6
NCBI: 65967
Homologene: 11073
Name: non-SMC condensin II complex, subunit G2
Synonyms: 5830426I05Rik, Mtb, Luzp5, mCAP-G2
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 12
NCBI: 76044
VEGA: 12
Homologene: 9820
Name: coiled-coil domain containing 93
Synonyms: 9230102M16Rik, 4633402D15Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 1
NCBI: 70829
Homologene: 10393
Name: zinc finger CCCH type containing 11A
Synonyms: 1110003F06Rik, 5730454B08Rik, G630041M05Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 1
NCBI: 70579
Homologene: 8888
Name: abnormal spindle microtubule assembly
Synonyms: Sha1, Aspm, D330028K02Rik, MCPH5, Calmbp1
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 1
NCBI: 12316
Homologene: 7650
Name: calmodulin regulated spectrin-associated protein family, member 2
Synonyms: 1600013L13Rik, 4930541M15Rik, Camsap1l1
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 1
NCBI: 67886
Homologene: 18927
Name: focadhesin
Synonyms: BC057079
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 4
NCBI: 230393
Homologene: 9842
Name: tousled-like kinase 1
Synonyms: 4930545J15Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 2
NCBI: 228012
Homologene: 130657
Name: solute carrier family 45, member 4
Synonyms: 9330175B01Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 15
NCBI: 106068
Homologene: 69908
Name: GIT ArfGAP 1
Synonyms: p95Cat, Cat-1
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 11
NCBI: 216963
Homologene: 32204
Name: sorting nexin 32
Synonyms: Snx6b, B930037P14Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 19
NCBI: 225861
VEGA: 19
Homologene: 62637
Name: transcription factor 4
Synonyms: SEF-2, ITF-2, MITF-2B, MITF-2A, ME2, E2.2, TFE, E2-2, SEF2-1, ASP-I2, ITF-2b, 5730422P05Rik, bHLHb19
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 18
NCBI: 21413
Homologene: 2407
Name: thymocyte selection-associated high mobility group box
Synonyms: 1700007F02Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 4
NCBI: 252838
Homologene: 8822
Name: DEAD box helicase 18
Synonyms: 2310005B10Rik, DEAD (Asp-Glu-Ala-Asp) box polypeptide 18
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 1
NCBI: 66942
Homologene: 6697
Name: centrosomal protein 128
Synonyms: 5430424K18Rik, 4930534B04Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 12
NCBI: 75216
Homologene: 35315
Name: importin 9
Synonyms: 0710008K06Rik, Imp9
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 1
NCBI: 226432
Homologene: 5874
Name: syntaxin 3
Synonyms: syntaxin 3B, syntaxin 3A, Syn-3
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 19
NCBI: 20908
Homologene: 80191
Name: CD55 molecule, decay accelerating factor for complement
Synonyms: Daf-GPI, complement-glycosylphosphatidylinositol, GPI-DAF, Cromer blood group, Daf1
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 1
NCBI: 13136
Homologene: 479
Name: potassium voltage-gated channel, subfamily H (eag-related), member 5
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 12
NCBI: 238271
VEGA: 12
Homologene: 15858
Name: protein tyrosine phosphatase, receptor type, C
Synonyms: T200, B220, CD45, Lyt-4, Ly-5
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 1
NCBI: 19264
Homologene: 2126
Name: C2 calcium-dependent domain containing 2-like
Synonyms: 1300006O23Rik, Tmem24
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 9
NCBI: 71764
Homologene: 8876
Name: DnaJ heat shock protein family (Hsp40) member C10
Synonyms: JPDI, 1200006L06Rik, D2Ertd706e, ERdj5
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 2
NCBI: 66861
Homologene: 10358
Name: DENN/MADD domain containing 1B
Synonyms: F730008N07Rik, 4632404N19Rik, 4930467M19Rik, 6820401H01Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 1
NCBI: 329260
Homologene: 11739
Name: structural maintenance of chromosomes 6
Synonyms: 2810489L22Rik, 3830418C19Rik, Smc6l1
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 12
NCBI: 67241
VEGA: 12
Homologene: 41575
Name: polymeric immunoglobulin receptor
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 1
NCBI: 18703
Homologene: 1984
Name: centrosomal protein 120
Synonyms: Ccdc100
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 18
NCBI: 225523
VEGA: 18
Homologene: 27415
Name: synaptotagmin II
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 1
NCBI: 20980
Homologene: 22516
Name: cadherin 19, type 2
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 1
NCBI: 227485
Homologene: 23286
Name: leucine-rich repeat-containing G protein-coupled receptor 6
Synonyms: A530037C04Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 1
NCBI: 329252
Homologene: 49680
Name: APC, WNT signaling pathway regulator
Synonyms: Min, CC1, adenomatosis polyposis coli
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 18
NCBI: 11789
Homologene: 30950
Name: bromodomain adjacent to zinc finger domain 1A
Synonyms: Gtl5, Wcrf180, Acf1
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 12
NCBI: 217578
Homologene: 45654
Name: cytochrome b5 reductase 1
Synonyms: B5R.1, 1500005G05Rik, Nqo3a2
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 1
NCBI: 72017
Homologene: 96059
Name: family with sequence similarity 72, member A
Synonyms: 2700049P18Rik, P17
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 1
NCBI: 108900
Homologene: 82352
Name: innate immunity activator
Synonyms: 5730559C18Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 1
NCBI: 67313
Homologene: 10103
Name: diphosphoinositol pentakisphosphate kinase 2
Synonyms: Vip2, Hisppd1, Cfap160
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 1
NCBI: 227399
Homologene: 49409
Name: gypsy retrotransposon integrase 1
Synonyms: 4930429M06, 4930429M06Rik, Zh2c2
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 1
NCBI: 252876
Homologene: 69238
Name: neuron navigator 1
Synonyms: POMFIL3, 9930003A20Rik, C230080M11Rik, unc53H1, steerin-1
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 1
NCBI: 215690
Homologene: 10719
Name: sema domain, immunoglobulin domain (Ig), transmembrane domain (TM) and short cytoplasmic domain, (semaphorin) 4A
Synonyms: SemB, SemB, Semab
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 3
NCBI: 20351
Homologene: 8425
Name: uncoupling protein 3 (mitochondrial, proton carrier)
Synonyms: UCP-3, Slc25a9
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 7
NCBI: 22229
Homologene: 2517
Name: tweety family member 1
Synonyms: tty, 6330408P11Rik, 4930459B04Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 7
NCBI: 57776
Homologene: 10779
Name: protein phosphatase 1, regulatory subunit 12B
Synonyms: 1810037O03Rik, 9530009M10Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 1
NCBI: 329251
Homologene: 135710
Name: macrophage stimulating 1 receptor (c-met-related tyrosine kinase)
Synonyms: STK, Fv-2, Ron, CDw136, friend virus susceptibility 2, PTK8, Fv2
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 9
NCBI: 19882
Homologene: 1835
Name: ubiquitin-conjugating enzyme E2T
Synonyms: 2700084L22Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 1
NCBI: 67196
Homologene: 40929
Name: STEAP family member 3
Synonyms: pHyde, 1010001D01Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 1
NCBI: 68428
Homologene: 10084
Name: a disintegrin and metallopeptidase domain 20
Synonyms: 4930529F22Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 8
NCBI: 384806
Homologene: 128364
Name: zinc finger homeodomain 4
Synonyms: Zfh-4, C130041O22Rik, Zfh4
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 3
NCBI: 80892
Homologene: 23477
Name: calcium channel, voltage-dependent, L type, alpha 1C subunit
Synonyms: (alpha)1 subunit, Cchl1a1, Cav1.2, L-type Cav1.2, D930026N18Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 6
NCBI: 12288
Homologene: 55484
Name: adhesion G protein-coupled receptor F4
Synonyms: 4632435A09Rik, Gpr115
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 17
NCBI: 78249
Homologene: 51953
Name: titin
Synonyms: connectin, L56, mdm, 1100001C23Rik, D830007G01Rik, 2310036G12Rik, 2310074I15Rik, 2310057K23Rik, D330041I19Rik, shru
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 2
NCBI: 22138
Homologene: 130650
Name: crumbs family member 1, photoreceptor morphogenesis associated
Synonyms: A930008G09Rik, 7530426H14Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 1
NCBI: 170788
Homologene: 8092
Name: E74-like factor 3
Synonyms: jen, ESX, ESE-1
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 1
NCBI: 13710
Homologene: 3265
Name: collagen, type XII, alpha 1
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 9
NCBI: 12816
Homologene: 3217
Name: arginyl aminopeptidase (aminopeptidase B)
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 1
NCBI: 215615
Homologene: 10628
Name: exophilin 5
Synonyms: slac2-b, B130009M24Rik, AC079869.22gm5, Slac2b
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 9
NCBI: 320051
Homologene: 9007
Name: polycystin (PKD) family receptor for egg jelly
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 15
NCBI: 18766
VEGA: 15
Homologene: 4427
Name: unc-80, NALCN activator
Synonyms: C230061B10Rik, C030018G13Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 1
NCBI: 329178
Homologene: 122243
Name: delta/notch-like EGF repeat containing
Synonyms: BET, A930026D19Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 1
NCBI: 227325
Homologene: 26722
Name: MAP kinase-activated protein kinase 2
Synonyms: MAPKAP kinase 2, Rps6kc1, MK2
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 1
NCBI: 17164
Homologene: 56412
Name: secretin receptor
Synonyms: 6530402O03Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 1
NCBI: 319229
Homologene: 68290
Name: collagen, type V, alpha 2
Synonyms: 1110014L14Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 1
NCBI: 12832
Homologene: 20119
Name: cadherin 7, type 2
Synonyms: CDH7L1, 9330156F07Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 1
NCBI: 241201
Homologene: 68391
Name: calcium channel, voltage-dependent, L type, alpha 1S subunit
Synonyms: Cchl1a3, fmd, mdg, sj, muscle dysgenesis, Cav1.1, DHPR alpha1s
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 1
NCBI: 12292
Homologene: 37257
Name: globoside alpha-1,3-N-acetylgalactosaminyltransferase 1
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 2
NCBI: 227671
Homologene: 110677
Name: ATP-binding cassette, sub-family B (MDR/TAP), member 11
Synonyms: PFIC2, ABC16, PGY4, Lith1, sister of P-glycoprotein, Bsep
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 2
NCBI: 27413
Homologene: 74509
Name: C-type lectin domain family 4, member a3
Synonyms: 3110037K17Rik, mDcir3
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 6
NCBI: 73149
Homologene: 9413
Name: vomeronasal 2, receptor 78
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 7
NCBI: 637896
Homologene: 115466
Name: protein tyrosine phosphatase, receptor type, f polypeptide (PTPRF), interacting protein (liprin), alpha 4
Synonyms: 1110008G13Rik, LOC100042382, Liprin-alpha4, Gm3812
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 1
NCBI: 68507
Homologene: 66200
Name: sperm antigen with calponin homology and coiled-coil domains 1
Synonyms: 2810012G08Rik, B230396K10Rik, Cytsb
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 11
NCBI: 432572
Homologene: 45157
Name: sparc/osteonectin, cwcv and kazal-like domains proteoglycan 3
Synonyms: testican 3, 2900045C01Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 8
NCBI: 72902
Homologene: 9662
Name: alpha-N-acetylglucosaminidase (Sanfilippo disease IIIB)
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 11
NCBI: 27419
Homologene: 222
Name: EYA transcriptional coactivator and phosphatase 2
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 2
NCBI: 14049
Homologene: 40711
Name: synaptopodin 2-like
Synonyms: 1110054M18Rik, Chap
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 14
NCBI: 68760
Homologene: 23499
Name: SH3 and cysteine rich domain 3
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 10
NCBI: 237611
Homologene: 17039
Name: myosin binding protein H
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 1
NCBI: 53311
Homologene: 3661
Name: chitinase-like 1
Synonyms: Brp39, Gp39, Chi3l1
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 1
NCBI: 12654
Homologene: 55569
Name: SH3 and multiple ankyrin repeat domains 2
Synonyms: ProSAP1
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 7
NCBI: 210274
Homologene: 105965
Name: maestro heat-like repeat family member 3
Synonyms: 2310006M14Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 1
NCBI: 76422
Name: heart development protein with EGF-like domains 1
Synonyms: LOC268884, 5530401I02Rik, 9530025L16Rik, 4632417D23Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 16
NCBI: 77446
Homologene: 35276
Name: DExD/H box helicase 60
Synonyms: DEAD (Asp-Glu-Ala-Asp) box polypeptide 60
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 8
NCBI: 234311
Homologene: 23031
Name: N-terminal EF-hand calcium binding protein 3
Synonyms: XB51, 2900010M17Rik, Nip1, Apba2bp
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 2
NCBI: 56846
Homologene: 10992
Name: amyloid beta (A4) precursor protein-binding, family B, member 1
Synonyms: Fe65, Rir
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 7
NCBI: 11785
Homologene: 898
Name: kinase suppressor of ras 1
Synonyms: D11Bhm183e, B-KSR1, D11Bhm184e
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 11
NCBI: 16706
Homologene: 8410
Name: pleckstrin homology domain containing, family A member 6
Synonyms: Pepp3
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 1
NCBI: 240753
Homologene: 135779
Name: N-acetylglucosamine-1-phosphate transferase, alpha and beta subunits
Synonyms: EG432486
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 10
NCBI: 432486
Homologene: 32576
Name: serine (or cysteine) peptidase inhibitor, clade B (ovalbumin), member 10
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 1
NCBI: 241197
Homologene: 68430
Name: kinesin family member 14
Synonyms: N-3 kinesin, D1Ertd367e
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 1
NCBI: 381293
Homologene: 8916
Name: dispatched RND tramsporter family member 2
Synonyms: DispB, B230210L08Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 2
NCBI: 214240
Homologene: 24916
Name: ATP-binding cassette, sub-family A (ABC1), member 14
Synonyms: 1700110B15Rik, 4930539G24Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 7
NCBI: 67928
Homologene: 86128
Name: mannosidase 2, alpha 2
Synonyms: alpha mannosidase IIx, MX, 4931438M07Rik, 1700052O22Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 7
NCBI: 140481
Homologene: 55954
Name: coiled coil domain containing 178
Synonyms: 4921528I01Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 18
NCBI: 70950
VEGA: 18
Homologene: 12373
Name: zinc finger protein 108
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 7
NCBI: 54678
Homologene: 117959
Name: RAB7B, member RAS oncogene family
Synonyms: Rab7b, 5430435G22Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 1
NCBI: 226421
Homologene: 64833
Name: dual serine/threonine and tyrosine protein kinase
Synonyms: A930019K20Rik, C430014H23Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 1
NCBI: 213452
Homologene: 19711
Name: immunoglobulin-like and fibronectin type III domain containing 1
Synonyms: 9830123M21Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 1
NCBI: 226438
Homologene: 130054
Name: cadherin 20
Synonyms: Cdh7
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 1
NCBI: 23836
Homologene: 8015
Name: thrombospondin, type I, domain containing 7B
Synonyms: 1700074E13Rik, D130067I03Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 1
NCBI: 210417
Homologene: 18180
Name: SWI/SNF related, matrix associated, actin dependent regulator of chromatin, subfamily a, member 2
Synonyms: brm, Snf2l2, 2610209L14Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 19
NCBI: 67155
Homologene: 2308
Name: kinesin family member 21B
Synonyms: N-5 kinesin, 2610511N21Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 1
NCBI: 16565
Homologene: 56868
Name: a disintegrin and metallopeptidase domain 26B
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 8
NCBI: 382007
Homologene: 128363
Name: dermatan sulfate epimerase-like
Synonyms: 9330132E09Rik, DS-epi2
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 1
NCBI: 319901
Homologene: 12964
Name: enoyl-Coenzyme A, hydratase/3-hydroxyacyl Coenzyme A dehydrogenase
Synonyms: HD, MFP, L-bifunctional enzyme, L-PBE, 1300002P22Rik, MFP1
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 16
NCBI: 74147
Homologene: 1486
Name: DEAD box helicase 59
Synonyms: 4833411G06Rik, 1210002B07Rik, DEAD (Asp-Glu-Ala-Asp) box polypeptide 59
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 1
NCBI: 67997
Homologene: 12222
Name: neurocan
Synonyms: Tgfbit, Cspg3, Cspg3-rs
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 8
NCBI: 13004
Homologene: 3229
Name: potassium channel, subfamily T, member 2
Synonyms: E330038N15Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 1
NCBI: 240776
Homologene: 16121
Name: neurofascin
Synonyms: D430023G06Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 1
NCBI: 269116
Homologene: 24945
Name: complement component factor h
Synonyms: Mud-1, Sas-1, Sas1
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 1
NCBI: 12628
Homologene: 20086
Name: renin 1 structural
Synonyms: Ren1d, Ren-A, Rn-1, Ren, Rnr, Ren-1, Ren1c
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 1
NCBI: 19701
Homologene: 20151
Name: obscurin-like 1
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 1
NCBI: 98733
Name: serine (or cysteine) peptidase inhibitor, clade B, member 8
Synonyms: Spi8, NK10, ovalbumin, CAP-2, CAP2
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 1
NCBI: 20725
Homologene: 74445
Name: calpain 9
Synonyms: GC36, nCL-4
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 8
NCBI: 73647
Homologene: 38208
Name: contactin associated protein-like 5A
Synonyms: Caspr5-1
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 1
NCBI: 636808
Homologene: 43974
Name: isopentenyl-diphosphate delta isomerase
Synonyms: 4832416K17Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 13
NCBI: 319554
Homologene: 3315
Name: contactin associated protein-like 3
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 13
NCBI: 238680
VEGA: 13
Homologene: 129602
Name: growth arrest and DNA-damage-inducible, gamma interacting protein 1
Synonyms: 2310040G17Rik, Crif1
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 8
NCBI: 102060
Homologene: 33474
Name: human immunodeficiency virus type I enhancer binding protein 3
Synonyms: Krc, E030045D18Rik, 2900056N03Rik, Shn3, Schnurri-3
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 4
NCBI: 16656
Homologene: 7803
Name: NLR family, pyrin domain containing 4C
Synonyms: Nalp-alpha, Rnh2, Nalp4c
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 7
NCBI: 83564
Homologene: 75315
Name: major facilitator superfamily domain containing 4A
Synonyms: A930031D07Rik, Mfsd4
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 1
NCBI: 213006
Homologene: 45419
Name: olfactory receptor family 4 subfamily A member 68
Synonyms: GA_x6K02T2Q125-50883183-50882239, MOR231-8, Olfr1240
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 2
NCBI: 258804
Homologene: 121591
Name: programmed cell death 6
Synonyms: PS2, MA-3, Alg2, alg-2
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 13
NCBI: 18570
VEGA: 13
Homologene: 7880
Name: muscle, skeletal, receptor tyrosine kinase
Synonyms: MDK4, Nsk1, Nsk2, Nsk3
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 4
NCBI: 18198
Homologene: 4084
Name: zinc finger, BED type containing 6
Synonyms: similar to Zinc finger BED domain containing protein 4, Gm8466, MGR, Gm38394
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 1
NCBI: 667118
Homologene: 130066
Name: Ro60, Y RNA binding protein
Synonyms: SS-A/Ro, Ssa, A530054J02Rik, 1810007I17Rik, Ssa2, Trove2
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 1
NCBI: 20822
Homologene: 3383
Name: lymphocyte transmembrane adaptor 1
Synonyms: E430019B13Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 1
NCBI: 240754
Homologene: 49504
Name: inhibitor of kappaB kinase epsilon
Synonyms: IKK-i, IKKepsilon
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 1
NCBI: 56489
Homologene: 23168
Name: hypoxia up-regulated 1
Synonyms: CBP-140, Orp150, 140 kDa, Grp170, Cab140
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 9
NCBI: 12282
Homologene: 4658
Name: cripto, FRL-1, cryptic family 1
Synonyms: cryptic, b2b970Clo
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 1
NCBI: 12627
Homologene: 50007
Name: zona pellucida 3 receptor
Synonyms: SP56
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 1
NCBI: 22789
Homologene: 7609
Name: vomeronasal 1 receptor 197
Synonyms: V1rh21
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 13
NCBI: 171278
Homologene: 110880
Name: vomeronasal 1 receptor 40
Synonyms: V1rb7
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 6
NCBI: 113855
Homologene: 113975
Name: phosphatidylinositol-4-phosphate 3-kinase catalytic subunit type 2 beta
Synonyms: PI3K-C2beta, C330011J12Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 1
NCBI: 240752
Homologene: 20582
Name: complement factor H-related 2
Synonyms: FHR-B
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 1
NCBI: 545366
Homologene: 134349
Name: chloride channel accessory 1
Synonyms: gob-5, gob5, Clca3
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 3
NCBI: 23844
Homologene: 984
Name: protein tyrosine phosphatase, non-receptor type 7
Synonyms: LC-PTP, BPTP-4, C920001D21Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 1
NCBI: 320139
Homologene: 15411
Name: src homology 2 domain-containing transforming protein C3
Synonyms: ShcC, N-Shc, Rai
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 13
NCBI: 20418
VEGA: 13
Homologene: 7536
Name: leiomodin 1 (smooth muscle)
Synonyms: 64kD D1, 1D, D1, SM-Lmod, 9530015K06Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 1
NCBI: 93689
Homologene: 8118
Name: SRY (sex determining region Y)-box 13
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 1
NCBI: 20668
Homologene: 4159
Name: solute carrier family 26, member 9
Synonyms: anion transporter/exchanger-9, E030002L01Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 1
NCBI: 320718
Homologene: 14179
Name: regulator of G-protein signaling 18
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 1
NCBI: 64214
Homologene: 11281
Name: zinc finger SWIM-type containing 2
Synonyms: 1700025P14Rik, 4933437F18Rik, MEX
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 2
NCBI: 71861
Homologene: 32689
Name: meningioma 1
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 5
NCBI: 433938
Homologene: 37620
Name: zinc finger protein 873
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 10
NCBI: 408062
Homologene: 134319
Name: linker for activation of T cells family, member 2
Synonyms: Wbscr15, Wbscr5
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 5
NCBI: 56743
Homologene: 11297
Name: troponin T2, cardiac
Synonyms: Tnt, cTnT, cardiac TnT
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 1
NCBI: 21956
Homologene: 68050
Name: chitinase 1 (chitotriosidase)
Synonyms: 2300002L19Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 1
NCBI: 71884
Homologene: 68318
Name: olfactory receptor family 4 subfamily C member 124
Synonyms: GA_x6K02T2Q125-50770831-50769896, MOR233-18, Olfr1232
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 2
NCBI: 258320
Homologene: 74068
Name: opticin
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 1
NCBI: 269120
Homologene: 8652
Name: coiled-coil domain containing 177
Synonyms: LOC380768, Gm1568
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 12
NCBI: 380768
VEGA: 12
Homologene: 128326
Name: TOX high mobility group box family member 2
Synonyms: RxHMG1, LOC269389
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 2
NCBI: 269389
Homologene: 13155
Name: proline arginine-rich end leucine-rich repeat
Synonyms: 7330409J17Rik, SLRR2A
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 1
NCBI: 116847
Homologene: 2041
Name: complement component 4 binding protein
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 1
NCBI: 12269
Name: Fc receptor, IgA, IgM, high affinity
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 1
NCBI: 64435
Homologene: 12929
Name: ethanolamine kinase 2
Synonyms: 4933417N20Rik, Eki2
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 1
NCBI: 214253
Homologene: 10072
Name: olfactory receptor family 2 subfamily F member 1
Synonyms: GA_x6K02T2P3E9-4815856-4814903, MOR257-8P, Olfr453
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 6
NCBI: 258016
Homologene: 128151
Name: serine (or cysteine) peptidase inhibitor, clade B, member 2
Synonyms: PAI-2, Planh2, ovalbumin
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 1
NCBI: 18788
Homologene: 20571
Name: Fc fragment of IgM receptor
Synonyms: 1810037B05Rik, FcmuR, Faim3
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 1
NCBI: 69169
Homologene: 48347
Name: chemokine (C-X-C motif) ligand 2
Synonyms: MIP-2, Mip2, Scyb, Scyb2, Mgsa-b, MIP-2a, CINC-2a, GROb, Gro2
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 5
NCBI: 20310
Homologene: 117695
Name: ladinin
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 1
NCBI: 16763
Homologene: 4059
Name: predicted gene 4793
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 1
NCBI: 215714
Name: RAB29, member RAS oncogene family
Synonyms: Rab7l1
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 1
NCBI: 226422
Homologene: 20842
Name: protein tyrosine phosphatase, receptor type, V
Synonyms: mOST-PTP, Esp, OST-PTP, OST
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 1
NCBI: 13924
Homologene: 7306
Name: G protein-coupled receptor 25
Synonyms: LOC383563
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 1
NCBI: 383563
Homologene: 3872
Name: predicted gene 5152
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 5
NCBI: 381612
Name: zinc finger protein 260
Synonyms: Ozrf1, PEX1, Zfp63
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 7
NCBI: 26466
Homologene: 40802
Name: synaptogyrin 4
Synonyms: 1700016O14Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 7
NCBI: 58867
Homologene: 8258
Name: keratin associated protein 12-1
Synonyms: D10Jhu14e
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 10
NCBI: 16694
VEGA: 10
Homologene: 135687
Genetic Alterations
ENU-induced transitions at the following base pair locations (GRCm38):
  • A to G, chromosome 1 at 34,537,234 bp
  • A to G, chromosome 1 at 45,407,123 bp
  • A to T, chromosome 1 at 66,527,892 bp
  • G to A, chromosome 1 at 75,486,756 bp
  • T to C, chromosome 1 at 84,370,784 bp
  • A to T, chromosome 1 at 97,728,957 bp
  • T to A, chromosome 1 at 97,786,104 bp
  • T to C, chromosome 1 at 104,978,968 bp
  • G to A, chromosome 1 at 107,515,635 bp
  • C to A, chromosome 1 at 107,523,834 bp
  • C to T, chromosome 1 at 107,523,890 bp
  • C to T, chromosome 1 at 107,523,894 bp
  • G to A, chromosome 1 at 107,523,975 bp
  • A to C, chromosome 1 at 107,524,543 bp
  • C to T, chromosome 1 at 107,538,473 bp
  • A to G, chromosome 1 at 107,597,527 bp
  • G to A, chromosome 1 at 107,598,954 bp
  • A to C, chromosome 1 at 107,607,004 bp
  • C to G, chromosome 1 at 110,065,735 bp
  • C to A, chromosome 1 at 110,893,384 bp
  • T to C, chromosome 1 at 111,859,457 bp
  • G to C, chromosome 1 at 111,859,994 bp
  • C to A, chromosome 1 at 116,455,004 bp
  • T to C, chromosome 1 at 116,455,101 bp
  • C to T, chromosome 1 at 116,455,143 bp
  • G to A, chromosome 1 at 116,455,224 bp
  • C to T, chromosome 1 at 118,868,087 bp
  • A to T, chromosome 1 at 119,002,029 bp
  • G to T, chromosome 1 at 119,002,044 bp
  • T to C, chromosome 1 at 120,031,656 bp
  • G to T, chromosome 1 at 120,063,246 bp
  • G to A, chromosome 1 at 120,063,257 bp
  • C to T, chromosome 1 at 120,120,108 bp
  • T to C, chromosome 1 at 120,227,750 bp
  • G to A, chromosome 1 at 120,234,378 bp
  • T to C, chromosome 1 at 120,243,757 bp
  • T to C, chromosome 1 at 120,270,115 bp
  • A to G, chromosome 1 at 120,603,621 bp
  • A to G, chromosome 1 at 121,456,061 bp
  • C to T, chromosome 1 at 121,456,126 bp
  • T to C, chromosome 1 at 121,461,939 bp
  • T to C, chromosome 1 at 121,559,334 bp
  • C to T, chromosome 1 at 128,589,277 bp
  • C to T, chromosome 1 at 129,628,891 bp
  • T to A, chromosome 1 at 129,667,937 bp
  • G to C, chromosome 1 at 129,678,183 bp
  • T to C, chromosome 1 at 129,915,756 bp
  • T to G, chromosome 1 at 130,103,066 bp
  • A to C, chromosome 1 at 130,116,631 bp
  • T to C, chromosome 1 at 130,116,717 bp
  • C to T, chromosome 1 at 130,449,423 bp
  • G to A, chromosome 1 at 130,458,078 bp
  • C to A, chromosome 1 at 130,459,633 bp
  • A to G, chromosome 1 at 130,596,651 bp
  • A to G, chromosome 1 at 130,596,814 bp
  • C to A, chromosome 1 at 130,619,414 bp
  • C to G, chromosome 1 at 130,642,988 bp
  • A to C, chromosome 1 at 130,804,627 bp
  • C to A, chromosome 1 at 130,804,690 bp
  • A to G, chromosome 1 at 130,811,580 bp
  • G to A, chromosome 1 at 130,812,629 bp
  • A to G, chromosome 1 at 130,812,692 bp
  • T to C, chromosome 1 at 130,812,738 bp
  • A to G, chromosome 1 at 130,812,809 bp
  • C to T, chromosome 1 at 130,812,816 bp
  • A to G, chromosome 1 at 130,814,597 bp
  • C to T, chromosome 1 at 130,844,522 bp
  • A to G, chromosome 1 at 130,875,974 bp
  • T to C, chromosome 1 at 130,878,269 bp
  • G to T, chromosome 1 at 131,056,406 bp
  • C to A, chromosome 1 at 131,265,937 bp
  • T to C, chromosome 1 at 131,269,823 bp
  • T to C, chromosome 1 at 131,530,668 bp
  • C to T, chromosome 1 at 131,538,895 bp
  • T to C, chromosome 1 at 131,697,817 bp
  • G to T, chromosome 1 at 131,697,819 bp
  • T to C, chromosome 1 at 131,698,409 bp
  • C to T, chromosome 1 at 131,758,590 bp
  • C to T, chromosome 1 at 131,763,870 bp
  • T to C, chromosome 1 at 131,765,876 bp
  • A to G, chromosome 1 at 131,872,110 bp
  • C to T, chromosome 1 at 132,067,883 bp
  • T to C, chromosome 1 at 132,115,859 bp
  • G to A, chromosome 1 at 132,453,334 bp
  • C to T, chromosome 1 at 132,456,984 bp
  • T to C, chromosome 1 at 132,627,929 bp
  • C to T, chromosome 1 at 133,066,627 bp
  • C to T, chromosome 1 at 133,071,339 bp
  • C to T, chromosome 1 at 133,098,620 bp
  • A to G, chromosome 1 at 133,098,621 bp
  • G to T, chromosome 1 at 133,282,278 bp
  • C to G, chromosome 1 at 133,287,846 bp
  • T to A, chromosome 1 at 133,354,206 bp
  • C to T, chromosome 1 at 133,354,237 bp
  • A to G, chromosome 1 at 133,354,287 bp
  • C to T, chromosome 1 at 133,354,787 bp
  • A to C, chromosome 1 at 133,356,457 bp
  • T to C, chromosome 1 at 133,358,537 bp
  • A to T, chromosome 1 at 133,359,079 bp
  • A to T, chromosome 1 at 133,359,983 bp
  • C to G, chromosome 1 at 133,360,007 bp
  • A to G, chromosome 1 at 133,363,923 bp
  • C to A, chromosome 1 at 133,365,587 bp
  • G to T, chromosome 1 at 133,365,765 bp
  • C to T, chromosome 1 at 133,365,816 bp
  • G to A, chromosome 1 at 133,365,817 bp
  • T to C, chromosome 1 at 133,373,123 bp
  • T to C, chromosome 1 at 133,373,127 bp
  • T to A, chromosome 1 at 133,376,915 bp
  • A to G, chromosome 1 at 133,387,076 bp
  • G to A, chromosome 1 at 133,622,154 bp
  • C to T, chromosome 1 at 133,624,621 bp
  • A to G, chromosome 1 at 133,638,523 bp
  • T to C, chromosome 1 at 133,679,978 bp
  • T to C, chromosome 1 at 133,680,569 bp
  • G to A, chromosome 1 at 133,683,634 bp
  • A to T, chromosome 1 at 133,903,796 bp
  • C to G, chromosome 1 at 133,905,170 bp
  • C to T, chromosome 1 at 133,915,131 bp
  • T to C, chromosome 1 at 134,149,361 bp
  • C to T, chromosome 1 at 134,151,204 bp
  • C to T, chromosome 1 at 134,188,529 bp
  • A to G, chromosome 1 at 134,193,732 bp
  • C to T, chromosome 1 at 134,197,480 bp
  • C to G, chromosome 1 at 134,303,789 bp
  • C to A, chromosome 1 at 134,304,275 bp
  • C to T, chromosome 1 at 134,407,667 bp
  • C to T, chromosome 1 at 134,408,389 bp
  • A to G, chromosome 1 at 134,604,431 bp
  • T to G, chromosome 1 at 134,605,705 bp
  • C to G, chromosome 1 at 134,605,709 bp
  • ACTCTCTCT to ACTCTCTCTCT, chromosome 1 at 134,746,741 bp
  • G to A, chromosome 1 at 134,865,964 bp
  • C to T, chromosome 1 at 134,886,408 bp
  • AG to AGG, chromosome 1 at 134,971,364 bp
  • C to T, chromosome 1 at 134,972,167 bp
  • G to A, chromosome 1 at 134,972,201 bp
  • C to T, chromosome 1 at 134,987,088 bp
  • A to T, chromosome 1 at 134,988,009 bp
  • G to T, chromosome 1 at 134,990,635 bp
  • A to G, chromosome 1 at 135,000,469 bp
  • G to A, chromosome 1 at 135,003,275 bp
  • C to T, chromosome 1 at 135,003,451 bp
  • C to T, chromosome 1 at 135,003,476 bp
  • T to C, chromosome 1 at 135,111,440 bp
  • A to G, chromosome 1 at 135,134,475 bp
  • A to G, chromosome 1 at 135,256,335 bp
  • A to C, chromosome 1 at 135,257,299 bp
  • C to T, chromosome 1 at 135,263,096 bp
  • C to G, chromosome 1 at 135,283,629 bp
  • C to T, chromosome 1 at 135,364,073 bp
  • ATCCTCCTCCTCCTCCTC to ATCCTCCTCCTCCTCCTCCTC, chromosome 1 at 135,386,268 bp
  • A to G, chromosome 1 at 135,386,810 bp
  • C to T, chromosome 1 at 135,388,501 bp
  • A to C, chromosome 1 at 135,388,683 bp
  • A to G, chromosome 1 at 135,402,250 bp
  • A to G, chromosome 1 at 135,404,215 bp
  • A to G, chromosome 1 at 135,404,334 bp
  • G to C, chromosome 1 at 135,405,985 bp
  • T to C, chromosome 1 at 135,406,745 bp
  • A to G, chromosome 1 at 135,452,798 bp
  • T to C, chromosome 1 at 135,468,845 bp
  • T to C, chromosome 1 at 135,471,182 bp
  • C to A, chromosome 1 at 135,532,727 bp
  • A to T, chromosome 1 at 135,584,727 bp
  • G to A, chromosome 1 at 135,592,515 bp
  • A to T, chromosome 1 at 135,607,339 bp
  • A to G, chromosome 1 at 135,607,421 bp
  • C to T, chromosome 1 at 135,607,423 bp
  • C to A, chromosome 1 at 135,607,716 bp
  • C to T, chromosome 1 at 135,827,381 bp
  • C to T, chromosome 1 at 135,828,023 bp
  • C to T, chromosome 1 at 135,841,897 bp
  • A to G, chromosome 1 at 135,841,997 bp
  • C to T, chromosome 1 at 135,843,763 bp
  • C to T, chromosome 1 at 135,845,506 bp
  • TG to TGG, chromosome 1 at 135,846,761 bp
  • C to A, chromosome 1 at 135,847,786 bp
  • T to C, chromosome 1 at 135,852,024 bp
  • G to A, chromosome 1 at 135,954,556 bp
  • G to A, chromosome 1 at 135,959,928 bp
  • G to A, chromosome 1 at 135,968,199 bp
  • T to C, chromosome 1 at 135,970,411 bp
  • C to T, chromosome 1 at 135,972,127 bp
  • AGGG to AGG, chromosome 1 at 135,974,852 bp
  • C to T, chromosome 1 at 135,979,915 bp
  • G to A, chromosome 1 at 135,982,475 bp
  • T to C, chromosome 1 at 135,998,625 bp
  • T to C, chromosome 1 at 135,998,683 bp
  • C to G, chromosome 1 at 136,073,723 bp
  • T to C, chromosome 1 at 136,111,963 bp
  • T to C, chromosome 1 at 136,118,716 bp
  • C to T, chromosome 1 at 136,145,123 bp
  • T to C, chromosome 1 at 136,147,490 bp
  • C to T, chromosome 1 at 136,147,721 bp
  • A to C, chromosome 1 at 136,148,385 bp
  • G to A, chromosome 1 at 136,160,218 bp
  • T to C, chromosome 1 at 136,160,292 bp
  • A to G, chromosome 1 at 136,163,059 bp
  • T to A, chromosome 1 at 136,163,156 bp
  • G to C, chromosome 1 at 136,192,144 bp
  • G to A, chromosome 1 at 136,227,590 bp
  • G to A, chromosome 1 at 136,260,710 bp
  • C to T, chromosome 1 at 136,281,315 bp
  • C to T, chromosome 1 at 136,295,507 bp
  • T to C, chromosome 1 at 136,417,053 bp
  • T to C, chromosome 1 at 136,432,578 bp
  • A to G, chromosome 1 at 136,468,279 bp
  • A to G, chromosome 1 at 136,468,975 bp
  • G to A, chromosome 1 at 136,478,365 bp
  • A to G, chromosome 1 at 136,490,332 bp
  • CC to CCGAC, chromosome 1 at 136,490,395 bp
  • T to G, chromosome 1 at 136,496,556 bp
  • C to T, chromosome 1 at 136,503,431 bp
  • T to C, chromosome 1 at 136,515,961 bp
  • T to C, chromosome 1 at 136,525,783 bp
  • C to A, chromosome 1 at 136,952,125 bp
  • A to G, chromosome 1 at 138,080,273 bp
  • T to G, chromosome 1 at 138,099,676 bp
  • A to G, chromosome 1 at 138,107,823 bp
  • C to A, chromosome 1 at 138,107,824 bp
  • A to G, chromosome 1 at 138,107,837 bp
  • T to C, chromosome 1 at 138,112,254 bp
  • T to C, chromosome 1 at 138,966,234 bp
  • T to C, chromosome 1 at 139,039,996 bp
  • C to T, chromosome 1 at 139,059,141 bp
  • T to C, chromosome 1 at 139,234,779 bp
  • A to T, chromosome 1 at 139,237,622 bp
  • G to A, chromosome 1 at 139,241,138 bp
  • C to T, chromosome 1 at 139,242,995 bp
  • C to T, chromosome 1 at 139,243,417 bp
  • A to G, chromosome 1 at 139,473,574 bp
  • A to G, chromosome 1 at 139,813,442 bp
  • A to C, chromosome 1 at 139,813,459 bp
  • T to C, chromosome 1 at 140,136,788 bp
  • C to T, chromosome 1 at 140,147,697 bp
  • G to A, chromosome 1 at 140,354,547 bp
  • C to T, chromosome 1 at 143,760,014 bp
  • T to C, chromosome 1 at 143,760,034 bp
  • A to G, chromosome 1 at 143,765,929 bp
  • A to G, chromosome 1 at 144,773,509 bp
  • A to G, chromosome 1 at 161,827,655 bp
  • T to C, chromosome 2 at 28,505,052 bp
  • C to T, chromosome 2 at 69,261,566 bp
  • T to C, chromosome 2 at 70,721,077 bp
  • C to T, chromosome 2 at 76,813,339 bp
  • C to G, chromosome 2 at 80,347,662 bp
  • T to A, chromosome 2 at 83,915,340 bp
  • T to A, chromosome 2 at 89,325,566 bp
  • C to T, chromosome 2 at 89,439,583 bp
  • C to T, chromosome 2 at 92,360,299 bp
  • T to C, chromosome 2 at 118,791,550 bp
  • C to T, chromosome 2 at 154,546,015 bp
  • T to C, chromosome 2 at 163,247,785 bp
  • G to T, chromosome 2 at 165,687,663 bp
  • A to T, chromosome 3 at 5,401,730 bp
  • A to G, chromosome 3 at 88,436,838 bp
  • T to C, chromosome 3 at 104,800,282 bp
  • C to A, chromosome 3 at 145,007,778 bp
  • G to T, chromosome 4 at 6,823,150 bp
  • A to G, chromosome 4 at 41,206,849 bp
  • G to A, chromosome 4 at 58,293,563 bp
  • T to C, chromosome 4 at 88,397,891 bp
  • A to G, chromosome 4 at 120,095,174 bp
  • T to C, chromosome 4 at 152,260,912 bp
  • T to C, chromosome 5 at 10,245,204 bp
  • C to T, chromosome 5 at 90,904,158 bp
  • G to T, chromosome 5 at 111,420,014 bp
  • T to C, chromosome 5 at 134,606,369 bp
  • C to A, chromosome 6 at 42,744,135 bp
  • T to C, chromosome 6 at 84,112,235 bp
  • T to A, chromosome 6 at 88,376,205 bp
  • T to A, chromosome 6 at 89,714,315 bp
  • A to C, chromosome 6 at 118,610,544 bp
  • C to T, chromosome 6 at 122,954,041 bp
  • G to A, chromosome 7 at 4,129,349 bp
  • T to A, chromosome 7 at 6,073,222 bp
  • T to C, chromosome 7 at 24,261,310 bp
  • A to T, chromosome 7 at 30,104,806 bp
  • A to G, chromosome 7 at 45,888,722 bp
  • T to C, chromosome 7 at 80,362,438 bp
  • C to A, chromosome 7 at 86,920,789 bp
  • T to A, chromosome 7 at 97,904,695 bp
  • G to C, chromosome 7 at 100,482,720 bp
  • A to G, chromosome 7 at 105,574,227 bp
  • C to T, chromosome 7 at 120,278,306 bp
  • A to T, chromosome 7 at 144,179,853 bp
  • T to A, chromosome 8 at 40,796,558 bp
  • T to A, chromosome 8 at 43,521,677 bp
  • T to C, chromosome 8 at 62,017,728 bp
  • A to T, chromosome 8 at 63,348,947 bp
  • T to A, chromosome 8 at 70,108,086 bp
  • T to A, chromosome 8 at 84,832,292 bp
  • G to A, chromosome 8 at 124,605,711 bp
  • C to A, chromosome 9 at 44,319,743 bp
  • T to A, chromosome 9 at 44,384,655 bp
  • T to C, chromosome 9 at 53,375,588 bp
  • T to A, chromosome 9 at 79,633,468 bp
  • G to A, chromosome 9 at 95,897,581 bp
  • T to G, chromosome 9 at 107,912,256 bp
  • C to T, chromosome 10 at 77,720,992 bp
  • C to A, chromosome 10 at 82,060,707 bp
  • T to C, chromosome 10 at 88,436,095 bp
  • A to G, chromosome 10 at 127,507,766 bp
  • C to T, chromosome 11 at 62,118,818 bp
  • A to T, chromosome 11 at 77,498,982 bp
  • G to A, chromosome 11 at 79,047,305 bp
  • A to T, chromosome 11 at 87,583,436 bp
  • T to G, chromosome 11 at 95,276,547 bp
  • C to T, chromosome 11 at 101,076,403 bp
  • T to C, chromosome 11 at 120,083,906 bp
  • A to G, chromosome 11 at 120,678,516 bp
  • T to G, chromosome 12 at 11,317,853 bp
  • A to T, chromosome 12 at 44,571,675 bp
  • G to A, chromosome 12 at 54,898,788 bp
  • G to T, chromosome 12 at 75,114,229 bp
  • A to G, chromosome 12 at 80,759,239 bp
  • G to T, chromosome 12 at 91,022,491 bp
  • T to C, chromosome 12 at 116,415,566 bp
  • T to C, chromosome 13 at 8,890,411 bp
  • T to A, chromosome 13 at 22,328,371 bp
  • T to A, chromosome 13 at 44,906,276 bp
  • A to T, chromosome 13 at 51,482,916 bp
  • T to A, chromosome 13 at 64,740,592 bp
  • G to A, chromosome 13 at 74,304,041 bp
  • G to A, chromosome 14 at 20,665,819 bp
  • A to T, chromosome 15 at 12,245,019 bp
  • T to A, chromosome 15 at 65,829,724 bp
  • A to G, chromosome 15 at 73,586,038 bp
  • G to A, chromosome 15 at 85,820,427 bp
  • C to G, chromosome 16 at 17,089,419 bp
  • G to C, chromosome 16 at 21,762,253 bp
  • T to G, chromosome 16 at 33,738,583 bp
  • C to T, chromosome 17 at 42,666,898 bp
  • T to A, chromosome 18 at 22,097,723 bp
  • A to G, chromosome 18 at 34,312,318 bp
  • A to G, chromosome 18 at 53,719,214 bp
  • A to T, chromosome 18 at 69,642,970 bp
  • C to A, chromosome 19 at 5,496,111 bp
  • A to G, chromosome 19 at 11,785,523 bp
  • G to A, chromosome 19 at 26,691,457 bp
Genotype Determination
G1 male heterozygous mice are viable and fertile. The G1 mice were not characterized prior to archiving.
Strain Development
C57BL/6J mice were injected with ENU, resulting in G0 mice that were bred back to C57BL/6J. Sperm was archived from G1 male mice that produced viable G2 mice.
Suggested Control Mice
Wild-type littermates or C57BL/6J mice
Bruce Beutler, M.D., University of Texas Southwestern Medical Center.
Primary Reference
MUTAGENETIX record for R1739 (G1). B. Beutler and colleagues, Center for the Genetics of Host Defense, UT Southwestern, Dallas, TX.

Colony and Husbandry Information

Colony Surveillance Program and Current Health Reports

Mice recovered from a cryo-archive will have health surveillance performed on recipient females. Health reports will be provided prior to shipment. If you require additional health status information, please email .
Coat Color
MMRRC Breeding System
Random intra-strain mating
Breeding Scheme(s)
When maintaining a live colony, heterozygous mice may be bred together, bred with wild-type siblings, or bred with C57BL/6J inbred mice.
Overall Breeding Performance
Undetermined; during development, mating was done with heterozygous males; viability, fertility and other breeding statistics for heterozygous females and homozygotes are unverified, but presumably would be similar to the C57BL/6J background strain
Average litter size
Recommended wean age
3 weeks

Order Request Information

Limited quantities of breeder mice (recovered litter) are available from a cryoarchive; recovered litter usually available to ship in 3 to 4 months.

Cryopreserved material may be available upon request, please inquire to for more information.

Distribution of this strain requires submission of the MMRRC Conditions of Use (COU). A link to the COU web form will be provided via email after an order has been placed; the form should be completed then or the email forwarded to your institutional official for completion.

The donor or their institution limits the distribution to non-profit institutions only.

Additional charges may apply for any special requests. Shipping costs are in addition to the basic distribution/resuscitation fees. Information on shipping costs and any additional charges will be provided by the supplying MMRRC facility.

Click button to Request this one strain. (Use the MMRRC Catalog Search to request more than one strain.)
MMRRC Item # Description Distribution Fee / Unit (US $)
*Shipping & Handling not included*
Units Notes
039771-MU-RESUS Litter recovered from cryo-archive $5,475.00 / Non-Profit Litter Recovered litter4; additional fees for any special requests.
Cryopreserved material may be available upon request, please inquire to for more information.

Some MMRRC strains were submitted by the donor as cryopreserved germplasm, and because these strains were not cryopreserved by the MMRRC, we have not assessed the quality of this material. We have extensive experience with recovery of mice from cryopreserved sperm and embryos of varying quality, including using techniques such as IVF and ICSI, and are confident that we will have success in most, if not all, cases. However, because of the unknown quality of these frozen samples, we will restrict recovery efforts to two attempts for each order. Subsequent attempts can be performed on a fee-for-service basis, in addition to the standard fees, upon request.

1 The distribution fee covers the expense of rederiving mice from a live mouse; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

2 An aliquot contains a sufficient number of embryos (in one or more vials or straws and based on the transfer success rate of the MMRRC facility) to transfer into one to three recipients. The MMRRC makes no guarantee concerning embryo transfer success experienced in the recipient investigator's laboratory. Neither gender nor genotype ratios are guaranteed.

3 An aliquot is one straw or vial with sufficient sperm to recover at least one litter of mice, as per provided protocols, when performed at the MMRRC facility. The MMRRC makes no guarantee concerning the success of these procedures when performed outside the MMRRC facilities.

4 The distribution fee covers the expense of resuscitating mice from the cryo-archive; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

To request material from the MMRRC: Please fill out our on-line request form (accessible from the catalog search results page, or click the Request this Strain button in the fees section). If you have questions or need assistance completing this form, you may call Customer Service at (800) 910-2291 (in USA or Canada) or (530) 757-5710 (international calls). Before you call, please have with you: the MMRRC item number, quantity needed, Bill-to and Ship-to contact information.