Strain Name:
C57BL/6J-MtgxR1739Btlr/Mmmh
Stock Number:
039771-MU
Citation ID:
RRID:MMRRC_039771-MU
Other Names:
R1739 (G1), C57BL/6J-MtgxR1739Btlr
Major Collection:

Gene Information

Pak1
Name: p21 (RAC1) activated kinase 1
Synonyms: PAK-1, Paka
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 7
Alteration at locus: Chemically Induced
NCBI: 18479
HGNC: HGNC:8590
Homologene: 1936
Sept4
Name: septin 4
Synonyms: Bh5, cell division control-related protein 2b, ARTS, Pnutl2, septin H5
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 11
Alteration at locus: Chemically Induced
NCBI: 18952
HGNC: HGNC:9165
Homologene: 6107
Dysf
Name: dysferlin
Synonyms: 2310004N10Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 6
Alteration at locus: Chemically Induced
NCBI: 26903
HGNC: HGNC:3097
Homologene: 20748
En1
Name: engrailed 1
Synonyms: engrailed-1, Mo-en.1, En-1
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 1
Alteration at locus: Chemically Induced
NCBI: 13798
HGNC: HGNC:3342
Homologene: 50663
Nrcam
Name: neuronal cell adhesion molecule
Synonyms: C030017F07Rik, Bravo, C130076O07Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 12
Alteration at locus: Chemically Induced
NCBI: 319504
VEGA: 12
HGNC: HGNC:7994
Homologene: 21041
Jarid2
Name: jumonji, AT rich interactive domain 2
Synonyms: Jmj, jumonji
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 13
Alteration at locus: Chemically Induced
NCBI: 16468
HGNC: HGNC:6196
Homologene: 31279
Ubap2
Name: ubiquitin-associated protein 2
Synonyms: 1190005K07Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 4
Alteration at locus: Chemically Induced
NCBI: 68926
Homologene: 73649
Kdm5b
Name: lysine (K)-specific demethylase 5B
Synonyms: PLU-1, Jarid1b, 2010009J12Rik, Rb-Bp2, D1Ertd202e, Plu1, 2210016I17Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 1
Alteration at locus: Chemically Induced
NCBI: 75605
Homologene: 48448
Phf21a
Name: PHD finger protein 21A
Synonyms: Bhc80, 80kDa, D030065N23Rik, Braf35/HDAC complex (Bhc), PFTF1
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 2
Alteration at locus: Chemically Induced
NCBI: 192285
Homologene: 9597
Gli2
Name: GLI-Kruppel family member GLI2
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 1
Alteration at locus: Chemically Induced
NCBI: 14633
HGNC: HGNC:4318
Homologene: 12725
Mov10
Name: Mov10 RISC complex RNA helicase
Synonyms: Mov-10
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 3
Alteration at locus: Chemically Induced
NCBI: 17454
HGNC: HGNC:7200
Homologene: 10365
Efr3a
Name: EFR3 homolog A
Synonyms: D030063F01Rik, A130089M23Rik, C920006C10Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 15
Alteration at locus: Chemically Induced
NCBI: 76740
Homologene: 44222
Ppil2
Name: peptidylprolyl isomerase (cyclophilin)-like 2
Synonyms: C130078A06Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 16
Alteration at locus: Chemically Induced
NCBI: 66053
HGNC: HGNC:9261
Homologene: 8643
Cdk18
Name: cyclin-dependent kinase 18
Synonyms: Pctk3
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 1
Alteration at locus: Chemically Induced
NCBI: 18557
HGNC: HGNC:8751
Homologene: 1949
Nr5a2
Name: nuclear receptor subfamily 5, group A, member 2
Synonyms: D1Ertd308e, UF2-H3B, LRH-1, Ftf
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 1
Alteration at locus: Chemically Induced
NCBI: 26424
HGNC: HGNC:7984
Homologene: 20827
Acot7
Name: acyl-CoA thioesterase 7
Synonyms: 2410041A17Rik, Bach, AU014716
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 4
Alteration at locus: Chemically Induced
NCBI: 70025
Homologene: 15780
Cxcr4
Name: chemokine (C-X-C motif) receptor 4
Synonyms: b2b220Clo, PB-CKR, fusin, Cmkar4, CD184, Sdf1r
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 1
Alteration at locus: Chemically Induced
NCBI: 12767
HGNC: HGNC:2561
Homologene: 20739
Dbi
Name: diazepam binding inhibitor
Synonyms: diazepam-binding inhibitor, Acbp, endozepine, EP
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 1
Alteration at locus: Chemically Induced
NCBI: 13167
HGNC: HGNC:2690
Homologene: 39086
Mtmr12
Name: myotubularin related protein 12
Synonyms: Pip3ap, C730015A02Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 15
Alteration at locus: Chemically Induced
NCBI: 268783
Homologene: 10403
Suco
Name: SUN domain containing ossification factor
Synonyms: AI848100, osteopotentia, Opt
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 1
Alteration at locus: Chemically Induced
NCBI: 226551
HGNC: HGNC:1240
Homologene: 32212
Cep131
Name: centrosomal protein 131
Synonyms: AZ1, Azi1
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 11
Alteration at locus: Chemically Induced
NCBI: 12009
Homologene: 7638
Aspscr1
Name: alveolar soft part sarcoma chromosome region, candidate 1 (human)
Synonyms: ASPC, ASPL, RCC17, ASPCR1, TUG, 1190006K01Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 11
Alteration at locus: Chemically Induced
NCBI: 68938
Homologene: 41550
Atr
Name: ataxia telangiectasia and Rad3 related
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 9
Alteration at locus: Chemically Induced
NCBI: 245000
HGNC: HGNC:882
Homologene: 96916
Kat7
Name: K(lysine) acetyltransferase 7
Synonyms: Hbo1, Hboa, Myst2
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 11
Alteration at locus: Chemically Induced
NCBI: 217127
Homologene: 5134
Eefsec
Name: eukaryotic elongation factor, selenocysteine-tRNA-specific
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 6
Alteration at locus: Chemically Induced
NCBI: 65967
Homologene: 11073
Ncapg2
Name: non-SMC condensin II complex, subunit G2
Synonyms: 5830426I05Rik, Luzp5, Mtb, mCAP-G2
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 12
Alteration at locus: Chemically Induced
NCBI: 76044
VEGA: 12
Homologene: 9820
Ccdc93
Name: coiled-coil domain containing 93
Synonyms: 4633402D15Rik, 9230102M16Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 1
Alteration at locus: Chemically Induced
NCBI: 70829
Homologene: 10393
Zc3h11a
Name: zinc finger CCCH type containing 11A
Synonyms: 1110003F06Rik, G630041M05Rik, 5730454B08Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 1
Alteration at locus: Chemically Induced
NCBI: 70579
Homologene: 8888
Aspm
Name: abnormal spindle microtubule assembly
Synonyms: Sha1, D330028K02Rik, Calmbp1, Aspm, MCPH5
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 1
Alteration at locus: Chemically Induced
NCBI: 12316
Homologene: 7650
Camsap2
Name: calmodulin regulated spectrin-associated protein family, member 2
Synonyms: 4930541M15Rik, Camsap1l1, 1600013L13Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 1
Alteration at locus: Chemically Induced
NCBI: 67886
Homologene: 18927
Focad
Name: focadhesin
Synonyms: BC057079
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 4
Alteration at locus: Chemically Induced
NCBI: 230393
Homologene: 9842
Tlk1
Name: tousled-like kinase 1
Synonyms: 4930545J15Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 2
Alteration at locus: Chemically Induced
NCBI: 228012
Homologene: 130657
Slc45a4
Name: solute carrier family 45, member 4
Synonyms: 9330175B01Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 15
Alteration at locus: Chemically Induced
NCBI: 106068
Homologene: 69908
Git1
Name: GIT ArfGAP 1
Synonyms: p95Cat, Cat-1
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 11
Alteration at locus: Chemically Induced
NCBI: 216963
HGNC: HGNC:4272
Homologene: 32204
Snx32
Name: sorting nexin 32
Synonyms: B930037P14Rik, Snx6b
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 19
Alteration at locus: Chemically Induced
NCBI: 225861
VEGA: 19
Homologene: 62637
Tcf4
Name: transcription factor 4
Synonyms: ITF-2, MITF-2B, ASP-I2, ITF-2b, MITF-2A, 5730422P05Rik, ME2, SEF-2, bHLHb19, SEF2-1, E2.2, TFE, E2-2
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 18
Alteration at locus: Chemically Induced
NCBI: 21413
Homologene: 2407
Tox
Name: thymocyte selection-associated high mobility group box
Synonyms: 1700007F02Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 4
Alteration at locus: Chemically Induced
NCBI: 252838
Homologene: 8822
Ddx18
Name: DEAD (Asp-Glu-Ala-Asp) box polypeptide 18
Synonyms: 2310005B10Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 1
Alteration at locus: Chemically Induced
NCBI: 66942
HGNC: HGNC:2741
Homologene: 6697
Cep128
Name: centrosomal protein 128
Synonyms: 4930534B04Rik, 5430424K18Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 12
Alteration at locus: Chemically Induced
NCBI: 75216
Homologene: 35315
Ipo9
Name: importin 9
Synonyms: 0710008K06Rik, Imp9
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 1
Alteration at locus: Chemically Induced
NCBI: 226432
Homologene: 5874
Stx3
Name: syntaxin 3
Synonyms: syntaxin 3A, Syn-3, syntaxin 3B
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 19
Alteration at locus: Chemically Induced
NCBI: 20908
Homologene: 80191
Cd55
Name: CD55 molecule, decay accelerating factor for complement
Synonyms: Daf1, Cromer blood group, complement-glycosylphosphatidylinositol, GPI-DAF, Daf-GPI
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 1
Alteration at locus: Chemically Induced
NCBI: 13136
HGNC: HGNC:2665
Homologene: 479
Kcnh5
Name: potassium voltage-gated channel, subfamily H (eag-related), member 5
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 12
Alteration at locus: Chemically Induced
NCBI: 238271
VEGA: 12
HGNC: HGNC:6254
Homologene: 15858
Ptprc
Name: protein tyrosine phosphatase, receptor type, C
Synonyms: Lyt-4, CD45, Ly-5, T200, B220
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 1
Alteration at locus: Chemically Induced
NCBI: 19264
HGNC: HGNC:9666
Homologene: 2126
C2cd2l
Name: C2 calcium-dependent domain containing 2-like
Synonyms: Tmem24, 1300006O23Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 9
Alteration at locus: Chemically Induced
NCBI: 71764
VEGA: 9
Homologene: 8876
Dnajc10
Name: DnaJ heat shock protein family (Hsp40) member C10
Synonyms: JPDI, D2Ertd706e, 1200006L06Rik, ERdj5
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 2
Alteration at locus: Chemically Induced
NCBI: 66861
Homologene: 10358
Dennd1b
Name: DENN/MADD domain containing 1B
Synonyms: 4632404N19Rik, 4930467M19Rik, 6820401H01Rik, F730008N07Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 1
Alteration at locus: Chemically Induced
NCBI: 329260
Homologene: 11739
Smc6
Name: structural maintenance of chromosomes 6
Synonyms: 2810489L22Rik, Smc6l1, 3830418C19Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 12
Alteration at locus: Chemically Induced
NCBI: 67241
VEGA: 12
Homologene: 41575
Pigr
Name: polymeric immunoglobulin receptor
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 1
Alteration at locus: Chemically Induced
NCBI: 18703
HGNC: HGNC:8968
Homologene: 1984
Cep120
Name: centrosomal protein 120
Synonyms: Ccdc100
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 18
Alteration at locus: Chemically Induced
NCBI: 225523
VEGA: 18
Homologene: 27415
Syt2
Name: synaptotagmin II
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 1
Alteration at locus: Chemically Induced
NCBI: 20980
Homologene: 22516
Cdh19
Name: cadherin 19, type 2
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 1
Alteration at locus: Chemically Induced
NCBI: 227485
HGNC: HGNC:1758
Homologene: 23286
Lgr6
Name: leucine-rich repeat-containing G protein-coupled receptor 6
Synonyms: A530037C04Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 1
Alteration at locus: Chemically Induced
NCBI: 329252
Homologene: 49680
Apc
Name: APC, WNT signaling pathway regulator
Synonyms: CC1, Min
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 18
Alteration at locus: Chemically Induced
NCBI: 11789
HGNC: HGNC:583
Homologene: 30950
Baz1a
Name: bromodomain adjacent to zinc finger domain 1A
Synonyms: Gtl5, Wcrf180, Acf1
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 12
Alteration at locus: Chemically Induced
NCBI: 217578
HGNC: HGNC:960
Homologene: 45654
Cyb5r1
Name: cytochrome b5 reductase 1
Synonyms: Nqo3a2, 1500005G05Rik, B5R.1
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 1
Alteration at locus: Chemically Induced
NCBI: 72017
Homologene: 96059
Fam72a
Name: family with sequence similarity 72, member A
Synonyms: P17, 2700049P18Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 1
Alteration at locus: Chemically Induced
NCBI: 108900
Homologene: 82352
Inava
Name: innate immunity activator
Synonyms: 5730559C18Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 1
Alteration at locus: Chemically Induced
NCBI: 67313
Homologene: 10103
Ppip5k2
Name: diphosphoinositol pentakisphosphate kinase 2
Synonyms: Hisppd1, Cfap160, Vip2
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 1
Alteration at locus: Chemically Induced
NCBI: 227399
Homologene: 49409
Gin1
Name: gypsy retrotransposon integrase 1
Synonyms: 4930429M06, Zh2c2, 4930429M06Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 1
Alteration at locus: Chemically Induced
NCBI: 252876
Homologene: 69238
Nav1
Name: neuron navigator 1
Synonyms: C230080M11Rik, steerin-1, POMFIL3, unc53H1, 9930003A20Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 1
Alteration at locus: Chemically Induced
NCBI: 215690
Homologene: 10719
Sema4a
Name: sema domain, immunoglobulin domain (Ig), transmembrane domain (TM) and short cytoplasmic domain, (semaphorin) 4A
Synonyms: Semab, SemB, SemB
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 3
Alteration at locus: Chemically Induced
NCBI: 20351
Homologene: 8425
Ucp3
Name: uncoupling protein 3 (mitochondrial, proton carrier)
Synonyms: UCP-3, Slc25a9
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 7
Alteration at locus: Chemically Induced
NCBI: 22229
Homologene: 2517
Ttyh1
Name: tweety family member 1
Synonyms: 6330408P11Rik, 4930459B04Rik, tty
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 7
Alteration at locus: Chemically Induced
NCBI: 57776
Homologene: 10779
Ppp1r12b
Name: protein phosphatase 1, regulatory subunit 12B
Synonyms: 9530009M10Rik, 1810037O03Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 1
Alteration at locus: Chemically Induced
NCBI: 329251
HGNC: HGNC:7619
Homologene: 135710
Mst1r
Name: macrophage stimulating 1 receptor (c-met-related tyrosine kinase)
Synonyms: STK, Fv2, Ron, Fv-2, CDw136, friend virus susceptibility 2, PTK8
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 9
Alteration at locus: Chemically Induced
NCBI: 19882
HGNC: HGNC:7381
Homologene: 1835
Ube2t
Name: ubiquitin-conjugating enzyme E2T
Synonyms: 2700084L22Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 1
Alteration at locus: Chemically Induced
NCBI: 67196
Homologene: 40929
Steap3
Name: STEAP family member 3
Synonyms: pHyde, 1010001D01Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 1
Alteration at locus: Chemically Induced
NCBI: 68428
Homologene: 10084
Adam20
Name: a disintegrin and metallopeptidase domain 20
Synonyms: 4930529F22Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 8
Alteration at locus: Chemically Induced
NCBI: 384806
HGNC: HGNC:199
Homologene: 128364
Zfhx4
Name: zinc finger homeodomain 4
Synonyms: Zfh-4, C130041O22Rik, Zfh4
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 3
Alteration at locus: Chemically Induced
NCBI: 80892
Homologene: 23477
Cacna1c
Name: calcium channel, voltage-dependent, L type, alpha 1C subunit
Synonyms: (alpha)1 subunit, L-type Cav1.2, Cav1.2, Cchl1a1, D930026N18Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 6
Alteration at locus: Chemically Induced
NCBI: 12288
HGNC: HGNC:1390
Homologene: 55484
Adgrf4
Name: adhesion G protein-coupled receptor F4
Synonyms: 4632435A09Rik, Gpr115
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 17
Alteration at locus: Chemically Induced
NCBI: 78249
Homologene: 51953
Ttn
Name: titin
Synonyms: shru, connectin, mdm, 2310057K23Rik, D330041I19Rik, 1100001C23Rik, D830007G01Rik, 2310036G12Rik, L56, 2310074I15Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 2
Alteration at locus: Chemically Induced
NCBI: 22138
Homologene: 130650
Crb1
Name: crumbs family member 1, photoreceptor morphogenesis associated
Synonyms: 7530426H14Rik, A930008G09Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 1
Alteration at locus: Chemically Induced
NCBI: 170788
HGNC: HGNC:2343
Homologene: 8092
Elf3
Name: E74-like factor 3
Synonyms: jen, ESX, ESE-1
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 1
Alteration at locus: Chemically Induced
NCBI: 13710
HGNC: HGNC:3318
Homologene: 3265
Col12a1
Name: collagen, type XII, alpha 1
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 9
Alteration at locus: Chemically Induced
NCBI: 12816
HGNC: HGNC:2188
Homologene: 3217
Rnpep
Name: arginyl aminopeptidase (aminopeptidase B)
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 1
Alteration at locus: Chemically Induced
NCBI: 215615
Homologene: 10628
Exph5
Name: exophilin 5
Synonyms: slac2-b, B130009M24Rik, AC079869.22gm5, Slac2b
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 9
Alteration at locus: Chemically Induced
NCBI: 320051
Homologene: 9007
Pkdrej
Name: polycystin (PKD) family receptor for egg jelly
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 15
Alteration at locus: Chemically Induced
NCBI: 18766
VEGA: 15
HGNC: HGNC:9015
Homologene: 4427
Unc80
Name: unc-80, NALCN activator
Synonyms: C030018G13Rik, C230061B10Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 1
Alteration at locus: Chemically Induced
NCBI: 329178
Homologene: 122243
Dner
Name: delta/notch-like EGF repeat containing
Synonyms: A930026D19Rik, BET
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 1
Alteration at locus: Chemically Induced
NCBI: 227325
Homologene: 26722
Mapkapk2
Name: MAP kinase-activated protein kinase 2
Synonyms: Rps6kc1, MAPKAP kinase 2, MK2
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 1
Alteration at locus: Chemically Induced
NCBI: 17164
HGNC: HGNC:6887
Homologene: 56412
Sctr
Name: secretin receptor
Synonyms: 6530402O03Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 1
Alteration at locus: Chemically Induced
NCBI: 319229
Homologene: 68290
Col5a2
Name: collagen, type V, alpha 2
Synonyms: 1110014L14Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 1
Alteration at locus: Chemically Induced
NCBI: 12832
HGNC: HGNC:2210
Homologene: 20119
Cdh7
Name: cadherin 7, type 2
Synonyms: CDH7L1, 9330156F07Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 1
Alteration at locus: Chemically Induced
NCBI: 241201
HGNC: HGNC:1766
Homologene: 68391
Cacna1s
Name: calcium channel, voltage-dependent, L type, alpha 1S subunit
Synonyms: sj, DHPR alpha1s, muscle dysgenesis, fmd, Cchl1a3, mdg, Cav1.1
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 1
Alteration at locus: Chemically Induced
NCBI: 12292
HGNC: HGNC:1397
Homologene: 37257
Gbgt1
Name: globoside alpha-1,3-N-acetylgalactosaminyltransferase 1
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 2
Alteration at locus: Chemically Induced
NCBI: 227671
Homologene: 110677
Abcb11
Name: ATP-binding cassette, sub-family B (MDR/TAP), member 11
Synonyms: sister of P-glycoprotein, Lith1, Bsep, PFIC2, ABC16, PGY4
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 2
Alteration at locus: Chemically Induced
NCBI: 27413
HGNC: HGNC:42
Homologene: 74509
Clec4a3
Name: C-type lectin domain family 4, member a3
Synonyms: mDcir3, 3110037K17Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 6
Alteration at locus: Chemically Induced
NCBI: 73149
Homologene: 9413
Vmn2r78
Name: vomeronasal 2, receptor 78
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 7
Alteration at locus: Chemically Induced
NCBI: 637896
Homologene: 115466
Ppfia4
Name: protein tyrosine phosphatase, receptor type, f polypeptide (PTPRF), interacting protein (liprin), alpha 4
Synonyms: Gm3812, Liprin-alpha4, 1110008G13Rik, LOC100042382
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 1
Alteration at locus: Chemically Induced
NCBI: 68507
HGNC: HGNC:9248
Homologene: 66200
Specc1
Name: sperm antigen with calponin homology and coiled-coil domains 1
Synonyms: B230396K10Rik, 2810012G08Rik, Cytsb
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 11
Alteration at locus: Chemically Induced
NCBI: 432572
Homologene: 45157
Spock3
Name: sparc/osteonectin, cwcv and kazal-like domains proteoglycan 3
Synonyms: 2900045C01Rik, testican 3
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 8
Alteration at locus: Chemically Induced
NCBI: 72902
Homologene: 9662
Naglu
Name: alpha-N-acetylglucosaminidase (Sanfilippo disease IIIB)
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 11
Alteration at locus: Chemically Induced
NCBI: 27419
HGNC: HGNC:7632
Homologene: 222
Eya2
Name: EYA transcriptional coactivator and phosphatase 2
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 2
Alteration at locus: Chemically Induced
NCBI: 14049
HGNC: HGNC:3520
Homologene: 40711
Synpo2l
Name: synaptopodin 2-like
Synonyms: Chap, 1110054M18Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 14
Alteration at locus: Chemically Induced
NCBI: 68760
Homologene: 23499
Stac3
Name: SH3 and cysteine rich domain 3
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 10
Alteration at locus: Chemically Induced
NCBI: 237611
Homologene: 17039
Mybph
Name: myosin binding protein H
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 1
Alteration at locus: Chemically Induced
NCBI: 53311
HGNC: HGNC:7552
Homologene: 3661
Chil1
Name: chitinase-like 1
Synonyms: Gp39, Chi3l1, Brp39
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 1
Alteration at locus: Chemically Induced
NCBI: 12654
HGNC: HGNC:1932
Homologene: 55569
Shank2
Name: SH3 and multiple ankyrin repeat domains 2
Synonyms: ProSAP1
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 7
Alteration at locus: Chemically Induced
NCBI: 210274
Homologene: 105965
Mroh3
Name: maestro heat-like repeat family member 3
Synonyms: 2310006M14Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 1
Alteration at locus: Chemically Induced
NCBI: 76422
Heg1
Name: heart development protein with EGF-like domains 1
Synonyms: 9530025L16Rik, 5530401I02Rik, 4632417D23Rik, LOC268884
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 16
Alteration at locus: Chemically Induced
NCBI: 77446
Homologene: 35276
Ddx60
Name: DEAD (Asp-Glu-Ala-Asp) box polypeptide 60
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 8
Alteration at locus: Chemically Induced
NCBI: 234311
Homologene: 23031
Necab3
Name: N-terminal EF-hand calcium binding protein 3
Synonyms: Nip1, XB51, 2900010M17Rik, Apba2bp
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 2
Alteration at locus: Chemically Induced
NCBI: 56846
Homologene: 10992
Apbb1
Name: amyloid beta (A4) precursor protein-binding, family B, member 1
Synonyms: Rir, Fe65
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 7
Alteration at locus: Chemically Induced
NCBI: 11785
HGNC: HGNC:581
Homologene: 898
Ksr1
Name: kinase suppressor of ras 1
Synonyms: D11Bhm183e, B-KSR1, D11Bhm184e
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 11
Alteration at locus: Chemically Induced
NCBI: 16706
HGNC: HGNC:6465
Homologene: 8410
Plekha6
Name: pleckstrin homology domain containing, family A member 6
Synonyms: Pepp3
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 1
Alteration at locus: Chemically Induced
NCBI: 240753
Homologene: 135779
Gnptab
Name: N-acetylglucosamine-1-phosphate transferase, alpha and beta subunits
Synonyms: EG432486
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 10
Alteration at locus: Chemically Induced
NCBI: 432486
Homologene: 32576
Serpinb10
Name: serine (or cysteine) peptidase inhibitor, clade B (ovalbumin), member 10
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 1
Alteration at locus: Chemically Induced
NCBI: 241197
HGNC: HGNC:8942
Homologene: 68430
Kif14
Name: kinesin family member 14
Synonyms: N-3 kinesin, D1Ertd367e
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 1
Alteration at locus: Chemically Induced
NCBI: 381293
Homologene: 8916
Disp2
Name: dispatched RND tramsporter family member 2
Synonyms: DispB, B230210L08Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 2
Alteration at locus: Chemically Induced
NCBI: 214240
Homologene: 24916
Abca14
Name: ATP-binding cassette, sub-family A (ABC1), member 14
Synonyms: 1700110B15Rik, 4930539G24Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 7
Alteration at locus: Chemically Induced
NCBI: 67928
Homologene: 86128
Man2a2
Name: mannosidase 2, alpha 2
Synonyms: alpha mannosidase IIx, 1700052O22Rik, MX, 4931438M07Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 7
Alteration at locus: Chemically Induced
NCBI: 140481
HGNC: HGNC:6825
Homologene: 55954
Ccdc178
Name: coiled coil domain containing 178
Synonyms: 4921528I01Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 18
Alteration at locus: Chemically Induced
NCBI: 70950
VEGA: 18
Homologene: 12373
Zfp108
Name: zinc finger protein 108
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 7
Alteration at locus: Chemically Induced
NCBI: 54678
Homologene: 117959
Rab7b
Name: RAB7B, member RAS oncogene family
Synonyms: Rab7b, 5430435G22Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 1
Alteration at locus: Chemically Induced
NCBI: 226421
Homologene: 64833
Dstyk
Name: dual serine/threonine and tyrosine protein kinase
Synonyms: A930019K20Rik, C430014H23Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 1
Alteration at locus: Chemically Induced
NCBI: 213452
Homologene: 19711
Igfn1
Name: immunoglobulin-like and fibronectin type III domain containing 1
Synonyms: 9830123M21Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 1
Alteration at locus: Chemically Induced
NCBI: 226438
Homologene: 130054
Cdh20
Name: cadherin 20
Synonyms: Cdh7
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 1
Alteration at locus: Chemically Induced
NCBI: 23836
HGNC: HGNC:1760
Homologene: 8015
Thsd7b
Name: thrombospondin, type I, domain containing 7B
Synonyms: D130067I03Rik, 1700074E13Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 1
Alteration at locus: Chemically Induced
NCBI: 210417
Homologene: 18180
Smarca2
Name: SWI/SNF related, matrix associated, actin dependent regulator of chromatin, subfamily a, member 2
Synonyms: brm, Snf2l2, 2610209L14Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 19
Alteration at locus: Chemically Induced
NCBI: 67155
Homologene: 2308
Kif21b
Name: kinesin family member 21B
Synonyms: 2610511N21Rik, N-5 kinesin
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 1
Alteration at locus: Chemically Induced
NCBI: 16565
Homologene: 56868
Adam26b
Name: a disintegrin and metallopeptidase domain 26B
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 8
Alteration at locus: Chemically Induced
NCBI: 382007
Homologene: 128363
Dsel
Name: dermatan sulfate epimerase-like
Synonyms: DS-epi2, 9330132E09Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 1
Alteration at locus: Chemically Induced
NCBI: 319901
Homologene: 12964
Ehhadh
Name: enoyl-Coenzyme A, hydratase/3-hydroxyacyl Coenzyme A dehydrogenase
Synonyms: MFP, L-bifunctional enzyme, 1300002P22Rik, MFP1, HD, L-PBE
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 16
Alteration at locus: Chemically Induced
NCBI: 74147
HGNC: HGNC:3247
Homologene: 1486
Ddx59
Name: DEAD (Asp-Glu-Ala-Asp) box polypeptide 59
Synonyms: 1210002B07Rik, 4833411G06Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 1
Alteration at locus: Chemically Induced
NCBI: 67997
Homologene: 12222
Ncan
Name: neurocan
Synonyms: Tgfbit, Cspg3, Cspg3-rs
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 8
Alteration at locus: Chemically Induced
NCBI: 13004
HGNC: HGNC:2465
Homologene: 3229
Kcnt2
Name: potassium channel, subfamily T, member 2
Synonyms: E330038N15Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 1
Alteration at locus: Chemically Induced
NCBI: 240776
Homologene: 16121
Nfasc
Name: neurofascin
Synonyms: D430023G06Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 1
Alteration at locus: Chemically Induced
NCBI: 269116
Homologene: 24945
Cfh
Name: complement component factor h
Synonyms: Sas1, Sas-1, Mud-1
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 1
Alteration at locus: Chemically Induced
NCBI: 12628
HGNC: HGNC:4883
Homologene: 20086
Ren1
Name: renin 1 structural
Synonyms: Ren-A, Ren-1, Ren, Ren1c, Rnr, Ren1d, Rn-1
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 1
Alteration at locus: Chemically Induced
NCBI: 19701
HGNC: HGNC:9958
Homologene: 20151
Obsl1
Name: obscurin-like 1
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 1
Alteration at locus: Chemically Induced
NCBI: 98733
Serpinb8
Name: serine (or cysteine) peptidase inhibitor, clade B, member 8
Synonyms: ovalbumin, CAP2, NK10, Spi8, CAP-2
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 1
Alteration at locus: Chemically Induced
NCBI: 20725
HGNC: HGNC:8952
Homologene: 74445
Capn9
Name: calpain 9
Synonyms: GC36, nCL-4
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 8
Alteration at locus: Chemically Induced
NCBI: 73647
HGNC: HGNC:1486
Homologene: 38208
Cntnap5a
Name: contactin associated protein-like 5A
Synonyms: Caspr5-1
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 1
Alteration at locus: Chemically Induced
NCBI: 636808
Homologene: 43974
Idi1
Name: isopentenyl-diphosphate delta isomerase
Synonyms: 4832416K17Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 13
Alteration at locus: Chemically Induced
NCBI: 319554
HGNC: HGNC:5387
Homologene: 3315
Cntnap3
Name: contactin associated protein-like 3
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 13
Alteration at locus: Chemically Induced
NCBI: 238680
VEGA: 13
Homologene: 129602
Gadd45gip1
Name: growth arrest and DNA-damage-inducible, gamma interacting protein 1
Synonyms: 2310040G17Rik, Crif1
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 8
Alteration at locus: Chemically Induced
NCBI: 102060
Homologene: 33474
Hivep3
Name: human immunodeficiency virus type I enhancer binding protein 3
Synonyms: Krc, E030045D18Rik, Schnurri-3, 2900056N03Rik, Shn3
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 4
Alteration at locus: Chemically Induced
NCBI: 16656
Homologene: 7803
Nlrp4c
Name: NLR family, pyrin domain containing 4C
Synonyms: Nalp-alpha, Rnh2, Nalp4c
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 7
Alteration at locus: Chemically Induced
NCBI: 83564
Homologene: 75315
Mfsd4a
Name: major facilitator superfamily domain containing 4A
Synonyms: A930031D07Rik, Mfsd4
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 1
Alteration at locus: Chemically Induced
NCBI: 213006
Homologene: 45419
Olfr1240
Name: olfactory receptor 1240
Synonyms: MOR231-8, GA_x6K02T2Q125-50883183-50882239
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 2
Alteration at locus: Chemically Induced
NCBI: 258804
Homologene: 121591
Pdcd6
Name: programmed cell death 6
Synonyms: MA-3, PS2, alg-2, Alg2
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 13
Alteration at locus: Chemically Induced
NCBI: 18570
VEGA: 13
HGNC: HGNC:8765
Homologene: 7880
Musk
Name: muscle, skeletal, receptor tyrosine kinase
Synonyms: MDK4, Nsk1, Nsk3, Nsk2
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 4
Alteration at locus: Chemically Induced
NCBI: 18198
HGNC: HGNC:7525
Homologene: 4084
Zbed6
Name: zinc finger, BED type containing 6
Synonyms: MGR, Gm8466, similar to Zinc finger BED domain containing protein 4
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 1
Alteration at locus: Chemically Induced
NCBI: 667118
Homologene: 130066
Ro60
Name: Ro60, Y RNA binding protein
Synonyms: SS-A/Ro, A530054J02Rik, Ssa, Trove2, 1810007I17Rik, Ssa2
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 1
Alteration at locus: Chemically Induced
NCBI: 20822
Homologene: 3383
Lax1
Name: lymphocyte transmembrane adaptor 1
Synonyms: E430019B13Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 1
Alteration at locus: Chemically Induced
NCBI: 240754
Homologene: 49504
Ikbke
Name: inhibitor of kappaB kinase epsilon
Synonyms: IKKepsilon, IKK-i
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 1
Alteration at locus: Chemically Induced
NCBI: 56489
Homologene: 23168
Hyou1
Name: hypoxia up-regulated 1
Synonyms: Cab140, Grp170, Orp150, CBP-140, 140 kDa
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 9
Alteration at locus: Chemically Induced
NCBI: 12282
Homologene: 4658
Cfc1
Name: cripto, FRL-1, cryptic family 1
Synonyms: cryptic, b2b970Clo
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 1
Alteration at locus: Chemically Induced
NCBI: 12627
Homologene: 50007
Zp3r
Name: zona pellucida 3 receptor
Synonyms: SP56
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 1
Alteration at locus: Chemically Induced
NCBI: 22789
Homologene: 7609
Vmn1r197
Name: vomeronasal 1 receptor 197
Synonyms: V1rh21
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 13
Alteration at locus: Chemically Induced
NCBI: 171278
Homologene: 110880
Vmn1r40
Name: vomeronasal 1 receptor 40
Synonyms: V1rb7
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 6
Alteration at locus: Chemically Induced
NCBI: 113855
Homologene: 113975
Pik3c2b
Name: phosphatidylinositol-4-phosphate 3-kinase catalytic subunit type 2 beta
Synonyms: PI3K-C2beta, C330011J12Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 1
Alteration at locus: Chemically Induced
NCBI: 240752
HGNC: HGNC:8972
Homologene: 20582
Cfhr2
Name: complement factor H-related 2
Synonyms: FHR-B
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 1
Alteration at locus: Chemically Induced
NCBI: 545366
Homologene: 134349
Clca1
Name: chloride channel accessory 1
Synonyms: Clca3, gob-5, gob5
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 3
Alteration at locus: Chemically Induced
NCBI: 23844
HGNC: HGNC:2015
Homologene: 984
Ptpn7
Name: protein tyrosine phosphatase, non-receptor type 7
Synonyms: BPTP-4, LC-PTP, C920001D21Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 1
Alteration at locus: Chemically Induced
NCBI: 320139
HGNC: HGNC:9659
Homologene: 15411
Shc3
Name: src homology 2 domain-containing transforming protein C3
Synonyms: N-Shc, ShcC, Rai
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 13
Alteration at locus: Chemically Induced
NCBI: 20418
VEGA: 13
Homologene: 7536
Lmod1
Name: leiomodin 1 (smooth muscle)
Synonyms: 9530015K06Rik, 1D, D1, 64kD D1, SM-Lmod
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 1
Alteration at locus: Chemically Induced
NCBI: 93689
HGNC: HGNC:6647
Homologene: 8118
Sox13
Name: SRY (sex determining region Y)-box 13
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 1
Alteration at locus: Chemically Induced
NCBI: 20668
Homologene: 4159
Slc26a9
Name: solute carrier family 26, member 9
Synonyms: anion transporter/exchanger-9, E030002L01Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 1
Alteration at locus: Chemically Induced
NCBI: 320718
Homologene: 14179
Rgs18
Name: regulator of G-protein signaling 18
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 1
Alteration at locus: Chemically Induced
NCBI: 64214
Homologene: 11281
Zswim2
Name: zinc finger SWIM-type containing 2
Synonyms: MEX, 1700025P14Rik, 4933437F18Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 2
Alteration at locus: Chemically Induced
NCBI: 71861
Homologene: 32689
Mn1
Name: meningioma 1
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 5
Alteration at locus: Chemically Induced
NCBI: 433938
HGNC: HGNC:7180
Homologene: 37620
Zfp873
Name: zinc finger protein 873
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 10
Alteration at locus: Chemically Induced
NCBI: 408062
Homologene: 134319
Lat2
Name: linker for activation of T cells family, member 2
Synonyms: Wbscr5, Wbscr15
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 5
Alteration at locus: Chemically Induced
NCBI: 56743
Homologene: 11297
Tnnt2
Name: troponin T2, cardiac
Synonyms: Tnt, cardiac TnT, cTnT
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 1
Alteration at locus: Chemically Induced
NCBI: 21956
Homologene: 68050
Chit1
Name: chitinase 1 (chitotriosidase)
Synonyms: 2300002L19Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 1
Alteration at locus: Chemically Induced
NCBI: 71884
HGNC: HGNC:1936
Homologene: 68318
Olfr1232
Name: olfactory receptor 1232
Synonyms: GA_x6K02T2Q125-50770831-50769896, MOR233-18
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 2
Alteration at locus: Chemically Induced
NCBI: 258320
Homologene: 74068
Optc
Name: opticin
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 1
Alteration at locus: Chemically Induced
NCBI: 269120
HGNC: HGNC:8158
Homologene: 8652
Ccdc177
Name: coiled-coil domain containing 177
Synonyms: LOC380768, Gm1568
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 12
Alteration at locus: Chemically Induced
NCBI: 380768
VEGA: 12
Homologene: 128326
Tox2
Name: TOX high mobility group box family member 2
Synonyms: LOC269389, RxHMG1
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 2
Alteration at locus: Chemically Induced
NCBI: 269389
Homologene: 13155
Prelp
Name: proline arginine-rich end leucine-rich repeat
Synonyms: SLRR2A, 7330409J17Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 1
Alteration at locus: Chemically Induced
NCBI: 116847
HGNC: HGNC:9357
Homologene: 2041
C4bp
Name: complement component 4 binding protein
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 1
Alteration at locus: Chemically Induced
NCBI: 12269
Fcamr
Name: Fc receptor, IgA, IgM, high affinity
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 1
Alteration at locus: Chemically Induced
NCBI: 64435
Homologene: 12929
Etnk2
Name: ethanolamine kinase 2
Synonyms: 4933417N20Rik, Eki2
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 1
Alteration at locus: Chemically Induced
NCBI: 214253
Homologene: 10072
Olfr453
Name: olfactory receptor 453
Synonyms: MOR257-8P, GA_x6K02T2P3E9-4815856-4814903
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 6
Alteration at locus: Chemically Induced
NCBI: 258016
HGNC: HGNC:8246
Homologene: 128151
Serpinb2
Name: serine (or cysteine) peptidase inhibitor, clade B, member 2
Synonyms: ovalbumin, PAI-2, Planh2
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 1
Alteration at locus: Chemically Induced
NCBI: 18788
HGNC: HGNC:8584
Homologene: 20571
Fcmr
Name: Fc fragment of IgM receptor
Synonyms: Faim3, 1810037B05Rik, FcmuR
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 1
Alteration at locus: Chemically Induced
NCBI: 69169
Homologene: 48347
Cxcl2
Name: chemokine (C-X-C motif) ligand 2
Synonyms: Scyb, Scyb2, Mgsa-b, MIP-2a, CINC-2a, GROb, Gro2, MIP-2, Mip2
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 5
Alteration at locus: Chemically Induced
NCBI: 20310
HGNC: HGNC:4604
Homologene: 117695
Lad1
Name: ladinin
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 1
Alteration at locus: Chemically Induced
NCBI: 16763
HGNC: HGNC:6472
Homologene: 4059
Gm4793
Name: predicted gene 4793
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 1
Alteration at locus: Chemically Induced
NCBI: 215714
Rab29
Name: RAB29, member RAS oncogene family
Synonyms: Rab7l1
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 1
Alteration at locus: Chemically Induced
NCBI: 226422
HGNC: HGNC:9789
Homologene: 20842
Ptprv
Name: protein tyrosine phosphatase, receptor type, V
Synonyms: OST-PTP, Esp, mOST-PTP, OST
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 1
Alteration at locus: Chemically Induced
NCBI: 13924
Homologene: 7306
Gpr25
Name: G protein-coupled receptor 25
Synonyms: LOC383563
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 1
Alteration at locus: Chemically Induced
NCBI: 383563
HGNC: HGNC:4480
Homologene: 3872
Gm5152
Name: predicted gene 5152
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 5
Alteration at locus: Chemically Induced
NCBI: 381612
Zfp260
Name: zinc finger protein 260
Synonyms: Zfp63, Ozrf1, PEX1
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 7
Alteration at locus: Chemically Induced
NCBI: 26466
Homologene: 40802
Syngr4
Name: synaptogyrin 4
Synonyms: 1700016O14Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 7
Alteration at locus: Chemically Induced
NCBI: 58867
Homologene: 8258
Krtap12-1
Name: keratin associated protein 12-1
Synonyms: D10Jhu14e
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 10
Alteration at locus: Chemically Induced
NCBI: 16694
VEGA: 10
Homologene: 135687
Genetic Alterations
ENU-induced transitions at the following base pair locations (GRCm38):
  • A to G, chromosome 1 at 34,537,234 bp
  • A to G, chromosome 1 at 45,407,123 bp
  • A to T, chromosome 1 at 66,527,892 bp
  • G to A, chromosome 1 at 75,486,756 bp
  • T to C, chromosome 1 at 84,370,784 bp
  • A to T, chromosome 1 at 97,728,957 bp
  • T to A, chromosome 1 at 97,786,104 bp
  • T to C, chromosome 1 at 104,978,968 bp
  • G to A, chromosome 1 at 107,515,635 bp
  • C to A, chromosome 1 at 107,523,834 bp
  • C to T, chromosome 1 at 107,523,890 bp
  • C to T, chromosome 1 at 107,523,894 bp
  • G to A, chromosome 1 at 107,523,975 bp
  • A to C, chromosome 1 at 107,524,543 bp
  • C to T, chromosome 1 at 107,538,473 bp
  • A to G, chromosome 1 at 107,597,527 bp
  • G to A, chromosome 1 at 107,598,954 bp
  • A to C, chromosome 1 at 107,607,004 bp
  • C to G, chromosome 1 at 110,065,735 bp
  • C to A, chromosome 1 at 110,893,384 bp
  • T to C, chromosome 1 at 111,859,457 bp
  • G to C, chromosome 1 at 111,859,994 bp
  • C to A, chromosome 1 at 116,455,004 bp
  • T to C, chromosome 1 at 116,455,101 bp
  • C to T, chromosome 1 at 116,455,143 bp
  • G to A, chromosome 1 at 116,455,224 bp
  • C to T, chromosome 1 at 118,868,087 bp
  • A to T, chromosome 1 at 119,002,029 bp
  • G to T, chromosome 1 at 119,002,044 bp
  • T to C, chromosome 1 at 120,031,656 bp
  • G to T, chromosome 1 at 120,063,246 bp
  • G to A, chromosome 1 at 120,063,257 bp
  • C to T, chromosome 1 at 120,120,108 bp
  • T to C, chromosome 1 at 120,227,750 bp
  • G to A, chromosome 1 at 120,234,378 bp
  • T to C, chromosome 1 at 120,243,757 bp
  • T to C, chromosome 1 at 120,270,115 bp
  • A to G, chromosome 1 at 120,603,621 bp
  • A to G, chromosome 1 at 121,456,061 bp
  • C to T, chromosome 1 at 121,456,126 bp
  • T to C, chromosome 1 at 121,461,939 bp
  • T to C, chromosome 1 at 121,559,334 bp
  • C to T, chromosome 1 at 128,589,277 bp
  • C to T, chromosome 1 at 129,628,891 bp
  • T to A, chromosome 1 at 129,667,937 bp
  • G to C, chromosome 1 at 129,678,183 bp
  • T to C, chromosome 1 at 129,915,756 bp
  • T to G, chromosome 1 at 130,103,066 bp
  • A to C, chromosome 1 at 130,116,631 bp
  • T to C, chromosome 1 at 130,116,717 bp
  • C to T, chromosome 1 at 130,449,423 bp
  • G to A, chromosome 1 at 130,458,078 bp
  • C to A, chromosome 1 at 130,459,633 bp
  • A to G, chromosome 1 at 130,596,651 bp
  • A to G, chromosome 1 at 130,596,814 bp
  • C to A, chromosome 1 at 130,619,414 bp
  • C to G, chromosome 1 at 130,642,988 bp
  • A to C, chromosome 1 at 130,804,627 bp
  • C to A, chromosome 1 at 130,804,690 bp
  • A to G, chromosome 1 at 130,811,580 bp
  • G to A, chromosome 1 at 130,812,629 bp
  • A to G, chromosome 1 at 130,812,692 bp
  • T to C, chromosome 1 at 130,812,738 bp
  • A to G, chromosome 1 at 130,812,809 bp
  • C to T, chromosome 1 at 130,812,816 bp
  • A to G, chromosome 1 at 130,814,597 bp
  • C to T, chromosome 1 at 130,844,522 bp
  • A to G, chromosome 1 at 130,875,974 bp
  • T to C, chromosome 1 at 130,878,269 bp
  • G to T, chromosome 1 at 131,056,406 bp
  • C to A, chromosome 1 at 131,265,937 bp
  • T to C, chromosome 1 at 131,269,823 bp
  • T to C, chromosome 1 at 131,530,668 bp
  • C to T, chromosome 1 at 131,538,895 bp
  • T to C, chromosome 1 at 131,697,817 bp
  • G to T, chromosome 1 at 131,697,819 bp
  • T to C, chromosome 1 at 131,698,409 bp
  • C to T, chromosome 1 at 131,758,590 bp
  • C to T, chromosome 1 at 131,763,870 bp
  • T to C, chromosome 1 at 131,765,876 bp
  • A to G, chromosome 1 at 131,872,110 bp
  • C to T, chromosome 1 at 132,067,883 bp
  • T to C, chromosome 1 at 132,115,859 bp
  • G to A, chromosome 1 at 132,453,334 bp
  • C to T, chromosome 1 at 132,456,984 bp
  • T to C, chromosome 1 at 132,627,929 bp
  • C to T, chromosome 1 at 133,066,627 bp
  • C to T, chromosome 1 at 133,071,339 bp
  • C to T, chromosome 1 at 133,098,620 bp
  • A to G, chromosome 1 at 133,098,621 bp
  • G to T, chromosome 1 at 133,282,278 bp
  • C to G, chromosome 1 at 133,287,846 bp
  • T to A, chromosome 1 at 133,354,206 bp
  • C to T, chromosome 1 at 133,354,237 bp
  • A to G, chromosome 1 at 133,354,287 bp
  • C to T, chromosome 1 at 133,354,787 bp
  • A to C, chromosome 1 at 133,356,457 bp
  • T to C, chromosome 1 at 133,358,537 bp
  • A to T, chromosome 1 at 133,359,079 bp
  • A to T, chromosome 1 at 133,359,983 bp
  • C to G, chromosome 1 at 133,360,007 bp
  • A to G, chromosome 1 at 133,363,923 bp
  • C to A, chromosome 1 at 133,365,587 bp
  • G to T, chromosome 1 at 133,365,765 bp
  • C to T, chromosome 1 at 133,365,816 bp
  • G to A, chromosome 1 at 133,365,817 bp
  • T to C, chromosome 1 at 133,373,123 bp
  • T to C, chromosome 1 at 133,373,127 bp
  • T to A, chromosome 1 at 133,376,915 bp
  • A to G, chromosome 1 at 133,387,076 bp
  • G to A, chromosome 1 at 133,622,154 bp
  • C to T, chromosome 1 at 133,624,621 bp
  • A to G, chromosome 1 at 133,638,523 bp
  • T to C, chromosome 1 at 133,679,978 bp
  • T to C, chromosome 1 at 133,680,569 bp
  • G to A, chromosome 1 at 133,683,634 bp
  • A to T, chromosome 1 at 133,903,796 bp
  • C to G, chromosome 1 at 133,905,170 bp
  • C to T, chromosome 1 at 133,915,131 bp
  • T to C, chromosome 1 at 134,149,361 bp
  • C to T, chromosome 1 at 134,151,204 bp
  • C to T, chromosome 1 at 134,188,529 bp
  • A to G, chromosome 1 at 134,193,732 bp
  • C to T, chromosome 1 at 134,197,480 bp
  • C to G, chromosome 1 at 134,303,789 bp
  • C to A, chromosome 1 at 134,304,275 bp
  • C to T, chromosome 1 at 134,407,667 bp
  • C to T, chromosome 1 at 134,408,389 bp
  • A to G, chromosome 1 at 134,604,431 bp
  • T to G, chromosome 1 at 134,605,705 bp
  • C to G, chromosome 1 at 134,605,709 bp
  • ACTCTCTCT to ACTCTCTCTCT, chromosome 1 at 134,746,741 bp
  • G to A, chromosome 1 at 134,865,964 bp
  • C to T, chromosome 1 at 134,886,408 bp
  • AG to AGG, chromosome 1 at 134,971,364 bp
  • C to T, chromosome 1 at 134,972,167 bp
  • G to A, chromosome 1 at 134,972,201 bp
  • C to T, chromosome 1 at 134,987,088 bp
  • A to T, chromosome 1 at 134,988,009 bp
  • G to T, chromosome 1 at 134,990,635 bp
  • A to G, chromosome 1 at 135,000,469 bp
  • G to A, chromosome 1 at 135,003,275 bp
  • C to T, chromosome 1 at 135,003,451 bp
  • C to T, chromosome 1 at 135,003,476 bp
  • T to C, chromosome 1 at 135,111,440 bp
  • A to G, chromosome 1 at 135,134,475 bp
  • A to G, chromosome 1 at 135,256,335 bp
  • A to C, chromosome 1 at 135,257,299 bp
  • C to T, chromosome 1 at 135,263,096 bp
  • C to G, chromosome 1 at 135,283,629 bp
  • C to T, chromosome 1 at 135,364,073 bp
  • ATCCTCCTCCTCCTCCTC to ATCCTCCTCCTCCTCCTCCTC, chromosome 1 at 135,386,268 bp
  • A to G, chromosome 1 at 135,386,810 bp
  • C to T, chromosome 1 at 135,388,501 bp
  • A to C, chromosome 1 at 135,388,683 bp
  • A to G, chromosome 1 at 135,402,250 bp
  • A to G, chromosome 1 at 135,404,215 bp
  • A to G, chromosome 1 at 135,404,334 bp
  • G to C, chromosome 1 at 135,405,985 bp
  • T to C, chromosome 1 at 135,406,745 bp
  • A to G, chromosome 1 at 135,452,798 bp
  • T to C, chromosome 1 at 135,468,845 bp
  • T to C, chromosome 1 at 135,471,182 bp
  • C to A, chromosome 1 at 135,532,727 bp
  • A to T, chromosome 1 at 135,584,727 bp
  • G to A, chromosome 1 at 135,592,515 bp
  • A to T, chromosome 1 at 135,607,339 bp
  • A to G, chromosome 1 at 135,607,421 bp
  • C to T, chromosome 1 at 135,607,423 bp
  • C to A, chromosome 1 at 135,607,716 bp
  • C to T, chromosome 1 at 135,827,381 bp
  • C to T, chromosome 1 at 135,828,023 bp
  • C to T, chromosome 1 at 135,841,897 bp
  • A to G, chromosome 1 at 135,841,997 bp
  • C to T, chromosome 1 at 135,843,763 bp
  • C to T, chromosome 1 at 135,845,506 bp
  • TG to TGG, chromosome 1 at 135,846,761 bp
  • C to A, chromosome 1 at 135,847,786 bp
  • T to C, chromosome 1 at 135,852,024 bp
  • G to A, chromosome 1 at 135,954,556 bp
  • G to A, chromosome 1 at 135,959,928 bp
  • G to A, chromosome 1 at 135,968,199 bp
  • T to C, chromosome 1 at 135,970,411 bp
  • C to T, chromosome 1 at 135,972,127 bp
  • AGGG to AGG, chromosome 1 at 135,974,852 bp
  • C to T, chromosome 1 at 135,979,915 bp
  • G to A, chromosome 1 at 135,982,475 bp
  • T to C, chromosome 1 at 135,998,625 bp
  • T to C, chromosome 1 at 135,998,683 bp
  • C to G, chromosome 1 at 136,073,723 bp
  • T to C, chromosome 1 at 136,111,963 bp
  • T to C, chromosome 1 at 136,118,716 bp
  • C to T, chromosome 1 at 136,145,123 bp
  • T to C, chromosome 1 at 136,147,490 bp
  • C to T, chromosome 1 at 136,147,721 bp
  • A to C, chromosome 1 at 136,148,385 bp
  • G to A, chromosome 1 at 136,160,218 bp
  • T to C, chromosome 1 at 136,160,292 bp
  • A to G, chromosome 1 at 136,163,059 bp
  • T to A, chromosome 1 at 136,163,156 bp
  • G to C, chromosome 1 at 136,192,144 bp
  • G to A, chromosome 1 at 136,227,590 bp
  • G to A, chromosome 1 at 136,260,710 bp
  • C to T, chromosome 1 at 136,281,315 bp
  • C to T, chromosome 1 at 136,295,507 bp
  • T to C, chromosome 1 at 136,417,053 bp
  • T to C, chromosome 1 at 136,432,578 bp
  • A to G, chromosome 1 at 136,468,279 bp
  • A to G, chromosome 1 at 136,468,975 bp
  • G to A, chromosome 1 at 136,478,365 bp
  • A to G, chromosome 1 at 136,490,332 bp
  • CC to CCGAC, chromosome 1 at 136,490,395 bp
  • T to G, chromosome 1 at 136,496,556 bp
  • C to T, chromosome 1 at 136,503,431 bp
  • T to C, chromosome 1 at 136,515,961 bp
  • T to C, chromosome 1 at 136,525,783 bp
  • C to A, chromosome 1 at 136,952,125 bp
  • A to G, chromosome 1 at 138,080,273 bp
  • T to G, chromosome 1 at 138,099,676 bp
  • A to G, chromosome 1 at 138,107,823 bp
  • C to A, chromosome 1 at 138,107,824 bp
  • A to G, chromosome 1 at 138,107,837 bp
  • T to C, chromosome 1 at 138,112,254 bp
  • T to C, chromosome 1 at 138,966,234 bp
  • T to C, chromosome 1 at 139,039,996 bp
  • C to T, chromosome 1 at 139,059,141 bp
  • T to C, chromosome 1 at 139,234,779 bp
  • A to T, chromosome 1 at 139,237,622 bp
  • G to A, chromosome 1 at 139,241,138 bp
  • C to T, chromosome 1 at 139,242,995 bp
  • C to T, chromosome 1 at 139,243,417 bp
  • A to G, chromosome 1 at 139,473,574 bp
  • A to G, chromosome 1 at 139,813,442 bp
  • A to C, chromosome 1 at 139,813,459 bp
  • T to C, chromosome 1 at 140,136,788 bp
  • C to T, chromosome 1 at 140,147,697 bp
  • G to A, chromosome 1 at 140,354,547 bp
  • C to T, chromosome 1 at 143,760,014 bp
  • T to C, chromosome 1 at 143,760,034 bp
  • A to G, chromosome 1 at 143,765,929 bp
  • A to G, chromosome 1 at 144,773,509 bp
  • A to G, chromosome 1 at 161,827,655 bp
  • T to C, chromosome 2 at 28,505,052 bp
  • C to T, chromosome 2 at 69,261,566 bp
  • T to C, chromosome 2 at 70,721,077 bp
  • C to T, chromosome 2 at 76,813,339 bp
  • C to G, chromosome 2 at 80,347,662 bp
  • T to A, chromosome 2 at 83,915,340 bp
  • T to A, chromosome 2 at 89,325,566 bp
  • C to T, chromosome 2 at 89,439,583 bp
  • C to T, chromosome 2 at 92,360,299 bp
  • T to C, chromosome 2 at 118,791,550 bp
  • C to T, chromosome 2 at 154,546,015 bp
  • T to C, chromosome 2 at 163,247,785 bp
  • G to T, chromosome 2 at 165,687,663 bp
  • A to T, chromosome 3 at 5,401,730 bp
  • A to G, chromosome 3 at 88,436,838 bp
  • T to C, chromosome 3 at 104,800,282 bp
  • C to A, chromosome 3 at 145,007,778 bp
  • G to T, chromosome 4 at 6,823,150 bp
  • A to G, chromosome 4 at 41,206,849 bp
  • G to A, chromosome 4 at 58,293,563 bp
  • T to C, chromosome 4 at 88,397,891 bp
  • A to G, chromosome 4 at 120,095,174 bp
  • T to C, chromosome 4 at 152,260,912 bp
  • T to C, chromosome 5 at 10,245,204 bp
  • C to T, chromosome 5 at 90,904,158 bp
  • G to T, chromosome 5 at 111,420,014 bp
  • T to C, chromosome 5 at 134,606,369 bp
  • C to A, chromosome 6 at 42,744,135 bp
  • T to C, chromosome 6 at 84,112,235 bp
  • T to A, chromosome 6 at 88,376,205 bp
  • T to A, chromosome 6 at 89,714,315 bp
  • A to C, chromosome 6 at 118,610,544 bp
  • C to T, chromosome 6 at 122,954,041 bp
  • G to A, chromosome 7 at 4,129,349 bp
  • T to A, chromosome 7 at 6,073,222 bp
  • T to C, chromosome 7 at 24,261,310 bp
  • A to T, chromosome 7 at 30,104,806 bp
  • A to G, chromosome 7 at 45,888,722 bp
  • T to C, chromosome 7 at 80,362,438 bp
  • C to A, chromosome 7 at 86,920,789 bp
  • T to A, chromosome 7 at 97,904,695 bp
  • G to C, chromosome 7 at 100,482,720 bp
  • A to G, chromosome 7 at 105,574,227 bp
  • C to T, chromosome 7 at 120,278,306 bp
  • A to T, chromosome 7 at 144,179,853 bp
  • T to A, chromosome 8 at 40,796,558 bp
  • T to A, chromosome 8 at 43,521,677 bp
  • T to C, chromosome 8 at 62,017,728 bp
  • A to T, chromosome 8 at 63,348,947 bp
  • T to A, chromosome 8 at 70,108,086 bp
  • T to A, chromosome 8 at 84,832,292 bp
  • G to A, chromosome 8 at 124,605,711 bp
  • C to A, chromosome 9 at 44,319,743 bp
  • T to A, chromosome 9 at 44,384,655 bp
  • T to C, chromosome 9 at 53,375,588 bp
  • T to A, chromosome 9 at 79,633,468 bp
  • G to A, chromosome 9 at 95,897,581 bp
  • T to G, chromosome 9 at 107,912,256 bp
  • C to T, chromosome 10 at 77,720,992 bp
  • C to A, chromosome 10 at 82,060,707 bp
  • T to C, chromosome 10 at 88,436,095 bp
  • A to G, chromosome 10 at 127,507,766 bp
  • C to T, chromosome 11 at 62,118,818 bp
  • A to T, chromosome 11 at 77,498,982 bp
  • G to A, chromosome 11 at 79,047,305 bp
  • A to T, chromosome 11 at 87,583,436 bp
  • T to G, chromosome 11 at 95,276,547 bp
  • C to T, chromosome 11 at 101,076,403 bp
  • T to C, chromosome 11 at 120,083,906 bp
  • A to G, chromosome 11 at 120,678,516 bp
  • T to G, chromosome 12 at 11,317,853 bp
  • A to T, chromosome 12 at 44,571,675 bp
  • G to A, chromosome 12 at 54,898,788 bp
  • G to T, chromosome 12 at 75,114,229 bp
  • A to G, chromosome 12 at 80,759,239 bp
  • G to T, chromosome 12 at 91,022,491 bp
  • T to C, chromosome 12 at 116,415,566 bp
  • T to C, chromosome 13 at 8,890,411 bp
  • T to A, chromosome 13 at 22,328,371 bp
  • T to A, chromosome 13 at 44,906,276 bp
  • A to T, chromosome 13 at 51,482,916 bp
  • T to A, chromosome 13 at 64,740,592 bp
  • G to A, chromosome 13 at 74,304,041 bp
  • G to A, chromosome 14 at 20,665,819 bp
  • A to T, chromosome 15 at 12,245,019 bp
  • T to A, chromosome 15 at 65,829,724 bp
  • A to G, chromosome 15 at 73,586,038 bp
  • G to A, chromosome 15 at 85,820,427 bp
  • C to G, chromosome 16 at 17,089,419 bp
  • G to C, chromosome 16 at 21,762,253 bp
  • T to G, chromosome 16 at 33,738,583 bp
  • C to T, chromosome 17 at 42,666,898 bp
  • T to A, chromosome 18 at 22,097,723 bp
  • A to G, chromosome 18 at 34,312,318 bp
  • A to G, chromosome 18 at 53,719,214 bp
  • A to T, chromosome 18 at 69,642,970 bp
  • C to A, chromosome 19 at 5,496,111 bp
  • A to G, chromosome 19 at 11,785,523 bp
  • G to A, chromosome 19 at 26,691,457 bp
Genotype Determination
Phenotype
G1 male heterozygous mice are viable and fertile. The G1 mice were not characterized prior to archiving.
Strain Development
C57BL/6J mice were injected with ENU, resulting in G0 mice that were bred back to C57BL/6J. Sperm was archived from G1 male mice that produced viable G2 mice.
Suggested Control Mice
Wild-type littermates or C57BL/6J mice
Donor
Bruce Beutler, M.D., University of Texas Southwestern Medical Center.
Primary Reference
MUTAGENETIX record for R1739 (G1). B. Beutler and colleagues, Center for the Genetics of Host Defense, UT Southwestern, Dallas, TX.

Colony and Husbandry Information

Colony Surveillance Program and Current Health Reports

Mice recovered from a cryo-archive will have health surveillance performed on recipient females. Health reports will be provided prior to shipment. If you require additional health status information, please email mmrrc@missouri.edu .
Coat Color
Black
MMRRC Breeding System
Random intra-strain mating
Breeding Scheme(s)
When maintaining a live colony, heterozygous mice may be bred together, bred with wild-type siblings, or bred with C57BL/6J inbred mice.
Overall Breeding Performance
Undetermined; during development, mating was done with heterozygous males; viability, fertility and other breeding statistics for heterozygous females and homozygotes are unverified, but presumably would be similar to the C57BL/6J background strain
Average litter size
Undetermined
Recommended wean age
3 weeks

Order Request Information

Limited quantities of breeder mice (recovered litter) are available from a cryoarchive; recovered litter usually available to ship in 3 to 4 months.

Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

Distribution of this strain requires submission of the MMRRC Conditions of Use (COU). A link to the COU web form will be provided via email after an order has been placed; the form should be completed then or the email forwarded to your institutional official for completion.

The donor or their institution limits the distribution to non-profit institutions only.

Additional charges may apply for any special requests. Shipping costs are in addition to the basic distribution/resuscitation fees. Information on shipping costs and any additional charges will be provided by the supplying MMRRC facility.

Click button to Request this one strain. (Use the MMRRC Catalog Search to request more than one strain.)
MMRRC Item # Description Distribution Fee / Unit (US $) Units Notes
039771-MU-RESUS Litter recovered from cryo-archive $5,475.00 / Non-Profit Litter Recovered litter1; additional fees for any special requests.
Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

Some MMRRC strains were submitted by the donor as cryopreserved germplasm, and because these strains were not cryopreserved by the MMRRC, we have not assessed the quality of this material. We have extensive experience with recovery of mice from cryopreserved sperm and embryos of varying quality, including using techniques such as IVF and ICSI, and are confident that we will have success in most, if not all, cases. However, because of the unknown quality of these frozen samples, we will restrict recovery efforts to two attempts for each order. Subsequent attempts can be performed on a fee-for-service basis, in addition to the standard fees, upon request.

1 The distribution fee covers the expense of resuscitating mice from the cryo-archive; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

2 An aliquot is one straw or vial with sufficient sperm to recover at least one litter of mice, as per provided protocols, when performed at the MMRRC facility. The MMRRC makes no guarantee concerning the success of these procedures when performed outside the MMRRC facilities.

3 An aliquot contains a sufficient number of embryos (in one or more vials or straws and based on the transfer success rate of the MMRRC facility) to transfer into one to three recipients. The MMRRC makes no guarantee concerning embryo transfer success experienced in the recipient investigator's laboratory. Neither gender nor genotype ratios are guaranteed.

To request material from the MMRRC: Please fill out our on-line request form (accessible from the catalog search results page, or click the Request this Strain button in the fees section). If you have questions or need assistance completing this form, you may call Customer Service at (800) 910-2291 (in USA or Canada) or (530) 757-5710 (international calls). Before you call, please have with you: the MMRRC item number, quantity needed, Bill-to and Ship-to contact information.