Strain Name:
C57BL/6J-MtgxR1766Btlr/Mmmh
Stock Number:
039798-MU
Citation ID:
RRID:MMRRC_039798-MU
Other Names:
R1766 (G1), C57BL/6J-MtgxR1766Btlr
Major Collection:

Strain Information

Mitf
Name: melanogenesis associated transcription factor
Synonyms: mi, wh, BCC2, bHLHe32, Gsfbcc2
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 6
NCBI: 17342
HGNC: HGNC:7105
Homologene: 4892
Rptor
Name: regulatory associated protein of MTOR, complex 1
Synonyms: raptor, 4932417H02Rik, Rap
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 11
NCBI: 74370
Homologene: 80210
Ccne2
Name: cyclin E2
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 4
NCBI: 12448
HGNC: HGNC:1590
Homologene: 7660
Gsta4
Name: glutathione S-transferase, alpha 4
Synonyms: GST 5.7, mGsta4
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 9
NCBI: 14860
VEGA: 9
HGNC: HGNC:4626
Homologene: 135605
S100a1
Name: S100 calcium binding protein A1
Synonyms: S100a, S100
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 3
NCBI: 20193
Homologene: 4566
Ntrk1
Name: neurotrophic tyrosine kinase, receptor, type 1
Synonyms: TrkA, Tkr
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 3
NCBI: 18211
HGNC: HGNC:8031
Homologene: 1898
Tiparp
Name: TCDD-inducible poly(ADP-ribose) polymerase
Synonyms: DDF1, PARP7, PARP-7
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 3
NCBI: 99929
Homologene: 9167
Arhgef10
Name: Rho guanine nucleotide exchange factor 10
Synonyms: 6430549H08Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 8
NCBI: 234094
Homologene: 22827
Dnmt1
Name: DNA methyltransferase 1
Synonyms: MTase, Dnmt1o, Cxxc9, MommeD2
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 9
NCBI: 13433
VEGA: 9
HGNC: HGNC:2976
Homologene: 124071
Zfand5
Name: zinc finger, AN1-type domain 5
Synonyms: 2310057A04Rik, Zfp216, 5830475F03Rik, Za20d2
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 19
NCBI: 22682
Homologene: 21215
Rapgef2
Name: Rap guanine nucleotide exchange factor (GEF) 2
Synonyms: 5830453M24Rik, Pdzgef1, RA-GEF-1, CNRasGEF, nRapGEP
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 3
NCBI: 76089
Homologene: 35477
Arl5b
Name: ADP-ribosylation factor-like 5B
Synonyms: 4930587A11Rik, Arl8
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 2
NCBI: 75869
Homologene: 101695
Clcn6
Name: chloride channel, voltage-sensitive 6
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 4
NCBI: 26372
HGNC: HGNC:2024
Homologene: 985
Ankrd17
Name: ankyrin repeat domain 17
Synonyms: Gtar, 4933425K22Rik, A130069E23Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 5
NCBI: 81702
Homologene: 82403
Tmem87b
Name: transmembrane protein 87B
Synonyms: 2810431I02Rik, 2610301K12Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 2
NCBI: 72477
Homologene: 69513
Tubgcp5
Name: tubulin, gamma complex component 5
Synonyms: GCP5, B130010C12Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 7
NCBI: 233276
Homologene: 14172
Ywhae
Name: tyrosine 3-monooxygenase/tryptophan 5-monooxygenase activation protein, epsilon polypeptide
Synonyms: 14-3-3 epsilon
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 11
NCBI: 22627
Homologene: 100743
Kpna6
Name: karyopherin subunit alpha 6
Synonyms: IPOA7, NPI-2, importin alpha 7
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 4
NCBI: 16650
HGNC: HGNC:6399
Homologene: 22472
Smchd1
Name: SMC hinge domain containing 1
Synonyms: 4931400A14Rik, MommeD1
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 17
NCBI: 74355
Homologene: 23665
Mdm2
Name: transformed mouse 3T3 cell double minute 2
Synonyms: Mdm-2, 1700007J15Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 10
NCBI: 17246
HGNC: HGNC:6973
Homologene: 1793
Ppp2ca
Name: protein phosphatase 2 (formerly 2A), catalytic subunit, alpha isoform
Synonyms: PP2A
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 11
NCBI: 19052
HGNC: HGNC:9299
Homologene: 37660
Sh3glb1
Name: SH3-domain GRB2-like B1 (endophilin)
Synonyms: Bif-1, Endophilin B1
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 3
NCBI: 54673
Homologene: 9337
Taf2
Name: TATA-box binding protein associated factor 2
Synonyms: TAFII150, CIF150, TAF2B, 4732460C16Rik, 150kDa
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 15
NCBI: 319944
VEGA: 15
Homologene: 31137
Ncapd3
Name: non-SMC condensin II complex, subunit D3
Synonyms: 4632407J06Rik, 2810487N22Rik, B130055D15Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 9
NCBI: 78658
VEGA: 9
Homologene: 41021
Rims2
Name: regulating synaptic membrane exocytosis 2
Synonyms: RIM2, 2810036I15Rik, Syt3-rs
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 15
NCBI: 116838
VEGA: 15
Homologene: 81639
Gpsm1
Name: G-protein signalling modulator 1 (AGS3-like, C. elegans)
Synonyms: 1810037C22Rik, Ags3
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 2
NCBI: 67839
Homologene: 16987
Scube1
Name: signal peptide, CUB domain, EGF-like 1
Synonyms: A630023E24Rik, 7330410C13Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 15
NCBI: 64706
Homologene: 11224
Gabrq
Name: gamma-aminobutyric acid type A receptor subunit theta
Type: Gene
Species: Mus musculus (mouse)
Chromosome: X
NCBI: 57249
Homologene: 10233
Ppp4r3a
Name: protein phosphatase 4 regulatory subunit 3A
Synonyms: 1110034C04Rik, Smek1
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 12
NCBI: 68734
VEGA: 12
Homologene: 69510
Fam193a
Name: family with sequence homology 193, member A
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 5
NCBI: 231128
Homologene: 2746
Ptgfrn
Name: prostaglandin F2 receptor negative regulator
Synonyms: CD9P-1, 4833445A08Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 3
NCBI: 19221
HGNC: HGNC:9601
Homologene: 7908
Cdh9
Name: cadherin 9
Synonyms: T1-cadherin
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 15
NCBI: 12565
HGNC: HGNC:1768
Homologene: 9450
Dync2h1
Name: dynein cytoplasmic 2 heavy chain 1
Synonyms: DHC1b, DHC2, 4432416O06Rik, D330044F14Rik, D030010H02Rik, Dnchc2, b2b414Clo, m407Asp, m152Asp
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 9
NCBI: 110350
HGNC: HGNC:2962
Homologene: 14468
Pigk
Name: phosphatidylinositol glycan anchor biosynthesis, class K
Synonyms: 3000001O05Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 3
NCBI: 329777
HGNC: HGNC:8965
Homologene: 4002
Nop9
Name: NOP9 nucleolar protein
Synonyms: 2610027L16Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 14
NCBI: 67842
Homologene: 41678
Chd6
Name: chromodomain helicase DNA binding protein 6
Synonyms: 6330406J24Rik, 5430439G14Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 2
NCBI: 71389
Homologene: 32772
Ice1
Name: interactor of little elongation complex ELL subunit 1
Synonyms: BC018507
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 13
NCBI: 218333
VEGA: 13
Homologene: 18902
Dpy19l4
Name: dpy-19 like 4
Synonyms: LOC381510, Narg3
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 4
NCBI: 381510
Homologene: 18773
Siglece
Name: sialic acid binding Ig-like lectin E
Synonyms: mSiglec-E, Siglecl1, Siglec5
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 7
NCBI: 83382
Homologene: 130669
Dnhd1
Name: dynein heavy chain domain 1
Synonyms: 8030491N06Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 7
NCBI: 77505
Homologene: 131117
Marveld2
Name: MARVEL (membrane-associating) domain containing 2
Synonyms: Mrvldc2, Tricellulin, Tric, Tric-c, Tric-b, Tric-a
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 13
NCBI: 218518
VEGA: 13
Homologene: 27037
Eif4e1b
Name: eukaryotic translation initiation factor 4E family member 1B
Synonyms: Eif4eloo
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 13
NCBI: 218268
Homologene: 100945
Muc5ac
Name: mucin 5, subtypes A and C, tracheobronchial/gastric
Synonyms: MGM, 2210005L13Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 7
NCBI: 17833
HGNC: HGNC:7515
Homologene: 137237
Gabra5
Name: gamma-aminobutyric acid type A receptor subunit alpha 5
Synonyms: A230018I05Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 7
NCBI: 110886
HGNC: HGNC:4079
Homologene: 20219
Lama3
Name: laminin, alpha 3
Synonyms: nicein, 150kDa, [a]3B
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 18
NCBI: 16774
HGNC: HGNC:6483
Homologene: 18279
Slc4a8
Name: solute carrier family 4 (anion exchanger), member 8
Synonyms: sodium bicarbonate cotransporter isoform 3 kNBC-3, KNBC-3, NDCBE
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 15
NCBI: 59033
Homologene: 68419
Vwa7
Name: von Willebrand factor A domain containing 7
Synonyms: G7c, D17H6S56E-3
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 17
NCBI: 27762
Homologene: 11895
Pdzph1
Name: PDZ and pleckstrin homology domains 1
Synonyms: 2610034M16Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 17
NCBI: 69239
Homologene: 130756
Vmn2r116
Name: vomeronasal 2, receptor 116
Synonyms: EG619697, V2Rp5
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 17
NCBI: 619697
Homologene: 86604
Chrd
Name: chordin
Synonyms: Chd
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 16
NCBI: 12667
HGNC: HGNC:1949
Homologene: 2774
Krt73
Name: keratin 73
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 15
NCBI: 223915
Homologene: 27875
Trim14
Name: tripartite motif-containing 14
Synonyms: 5830400N10Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 4
NCBI: 74735
Homologene: 13241
Vipr1
Name: vasoactive intestinal peptide receptor 1
Synonyms: VIP-R1, VPAC1, VIP receptor subtype 1
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 9
NCBI: 22354
Homologene: 3399
Sh3pxd2a
Name: SH3 and PX domains 2A
Synonyms: Fish, Sh3md1, Tks5, 2310014D11Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 19
NCBI: 14218
VEGA: 19
Homologene: 7317
Sorbs2
Name: sorbin and SH3 domain containing 2
Synonyms: 9430041O17Rik, 2010203O03Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 8
NCBI: 234214
Homologene: 83295
Zdhhc8
Name: zinc finger, DHHC domain containing 8
Synonyms: D16H22S1738E, E330009O14Rik, Op53c05
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 16
NCBI: 27801
VEGA: 16
Homologene: 8363
Myh4
Name: myosin, heavy polypeptide 4, skeletal muscle
Synonyms: MyHC-IIb, MHC2B, Myhsf, MM, MYH-2B, Minmus, Minimsc
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 11
NCBI: 17884
HGNC: HGNC:7574
Homologene: 123880
Igsf3
Name: immunoglobulin superfamily, member 3
Synonyms: 4833439O17Rik, 2810035F16Rik, 1700016K10Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 3
NCBI: 78908
HGNC: HGNC:5950
Homologene: 1182
Nrap
Name: nebulin-related anchoring protein
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 19
NCBI: 18175
HGNC: HGNC:7988
Homologene: 4499
Ankrd24
Name: ankyrin repeat domain 24
Synonyms: 5730519E19Rik, 4631433D01Rik, D10Bur2e
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 10
NCBI: 70615
Homologene: 49885
Hic1
Name: hypermethylated in cancer 1
Synonyms: HIC-1
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 11
NCBI: 15248
HGNC: HGNC:4909
Homologene: 4740
Tufm
Name: Tu translation elongation factor, mitochondrial
Synonyms: EF-TuMT, 2300002G02Rik, C76308
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 7
NCBI: 233870
Homologene: 2490
Mdga1
Name: MAM domain containing glycosylphosphatidylinositol anchor 1
Synonyms: 1200011I03Rik, Mamdc3
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 17
NCBI: 74762
Homologene: 17780
Phf2
Name: PHD finger protein 2
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 13
NCBI: 18676
VEGA: 13
HGNC: HGNC:8920
Homologene: 3934
Arhgap31
Name: Rho GTPase activating protein 31
Synonyms: CdGAP
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 16
NCBI: 12549
Homologene: 10644
Gm7334
Name: predicted gene 7334
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 17
NCBI: 654432
VEGA: 17
Fam170b
Name: family with sequence similarity 170, member B
Synonyms: 4922501K12Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 14
NCBI: 105511
VEGA: 14
Homologene: 19055
Ehbp1l1
Name: EH domain binding protein 1-like 1
Synonyms: G430002G23Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 19
NCBI: 114601
VEGA: 19
Homologene: 136059
Hivep3
Name: human immunodeficiency virus type I enhancer binding protein 3
Synonyms: Krc, E030045D18Rik, 2900056N03Rik, Shn3, Schnurri-3
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 4
NCBI: 16656
Homologene: 7803
Zfp326
Name: zinc finger protein 326
Synonyms: ZAN75, 5730470H14Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 5
NCBI: 54367
Homologene: 10297
Nlrp4c
Name: NLR family, pyrin domain containing 4C
Synonyms: Nalp-alpha, Rnh2, Nalp4c
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 7
NCBI: 83564
Homologene: 75315
Sorcs3
Name: sortilin-related VPS10 domain containing receptor 3
Synonyms: 6330404A12Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 19
NCBI: 66673
VEGA: 19
Homologene: 8986
Vmn2r12
Name: vomeronasal 2, receptor 12
Synonyms: Gm6769
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 5
NCBI: 627569
Homologene: 129606
Hcn1
Name: hyperpolarization activated cyclic nucleotide gated potassium channel 1
Synonyms: HAC2, Bcng1, C630013B14Rik, hyperpolarization-activated, cyclic nucleotide-gated K+ 1
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 13
NCBI: 15165
HGNC: HGNC:4845
Homologene: 32093
Eef2k
Name: eukaryotic elongation factor-2 kinase
Synonyms: eEF-2K
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 7
NCBI: 13631
Homologene: 7299
Trdn
Name: triadin
Synonyms: 2310045H21Rik, triadin-3, triadin-2, triadin-1, triadin 3, triadin 2, triadin 1, EG432451
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 10
NCBI: 76757
VEGA: 10
Homologene: 38137
Or7g27
Name: olfactory receptor family 7 subfamily G member 27
Synonyms: GA_x6K02T2PVTD-13076685-13077623, MOR150-1P, MOR150-2, MOR150-1P, MOR150-1, Olfr1522-ps1, Olfr845
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 9
NCBI: 258249
Homologene: 133689
BC051665
Name: cDNA sequence BC051665
Synonyms: cathepsin L-like
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 13
NCBI: 218275
VEGA: 13
HGNC: HGNC:2537
Homologene: 74298
Or4q3
Name: olfactory receptor family 4 subfamily Q member 3
Synonyms: GA_x6K02T2PMLR-6042130-6041183, MOR243-1, Olfr735
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 14
NCBI: 257909
Homologene: 71977
Slc26a1
Name: solute carrier family 26 (sulfate transporter), member 1
Synonyms: Sat1
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 5
NCBI: 231583
Homologene: 32539
Rabep2
Name: rabaptin, RAB GTPase binding effector protein 2
Synonyms: 2610011A08Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 7
NCBI: 70314
Homologene: 23489
Afg1l
Name: AFG1 like ATPase
Synonyms: Lace1
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 10
NCBI: 215951
Homologene: 5782
1700010H22Rik
Name: RIKEN cDNA 1700010H22 gene
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 5
NCBI: 75500
Gm10608
Name: predicted gene 10608
Synonyms: EG546165
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 9
NCBI: 546165
VEGA: 9
Rnf146
Name: ring finger protein 146
Synonyms: 2610509H23Rik, Iduna
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 10
NCBI: 68031
Homologene: 12227
Zfp810
Name: zinc finger protein 810
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 9
NCBI: 235050
VEGA: 9
Homologene: 138299
Or52z15
Name: olfactory receptor family 52 subfamily Z member 15
Synonyms: GA_x6K02T2PBJ9-6416276-6417237, MOR31-15P, Olfr625
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 7
NCBI: 258169
Tmem71
Name: transmembrane protein 71
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 15
NCBI: 213068
VEGA: 15
Homologene: 51638
Or6c38
Name: olfactory receptor family 6 subfamily C member 38
Synonyms: GA_x6K02T2PULF-10779441-10778503, MOR114-4, Olfr768
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 10
NCBI: 258863
Homologene: 17159
Zrsr2-ps1
Name: zinc finger (CCCH type), RNA binding motif and serine/arginine rich 2, pseudogene 1
Synonyms: U2afbp-rs, Irlgs2, D11Ncvs75, 35kDa, SP2, U2af1-rs1, Zrsr1
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 11
NCBI: 22183
Homologene: 84793
Adig
Name: adipogenin
Synonyms: SMAF1
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 2
NCBI: 246747
4933403O08Rik
Name: RIKEN cDNA 4933403O08 gene
Type: Gene
Species: Mus musculus (mouse)
Chromosome: X
NCBI: 71030
Homologene: 136349
Genetic Alterations
ENU-induced transitions at the following base pair locations (GRCm38):
  • T to C, chromosome 2 at 15,069,837 bp
  • G to A, chromosome 2 at 26,325,383 bp
  • T to A, chromosome 2 at 128,839,170 bp
  • A to T, chromosome 2 at 158,505,934 bp
  • G to A, chromosome 2 at 160,966,639 bp
  • A to T, chromosome 3 at 65,532,049 bp
  • A to T, chromosome 3 at 79,092,703 bp
  • A to T, chromosome 3 at 87,778,518 bp
  • A to G, chromosome 3 at 90,511,292 bp
  • A to T, chromosome 3 at 101,050,122 bp
  • T to A, chromosome 3 at 101,431,282 bp
  • T to C, chromosome 3 at 144,712,685 bp
  • T to G, chromosome 3 at 152,740,156 bp
  • A to G, chromosome 4 at 11,202,977 bp
  • C to T, chromosome 4 at 11,303,360 bp
  • A to G, chromosome 4 at 46,522,039 bp
  • C to T, chromosome 4 at 120,096,671 bp
  • T to C, chromosome 4 at 129,657,442 bp
  • C to T, chromosome 4 at 144,159,122 bp
  • A to G, chromosome 4 at 148,037,978 bp
  • C to T, chromosome 5 at 34,462,131 bp
  • T to A, chromosome 5 at 90,264,797 bp
  • C to T, chromosome 5 at 98,566,546 bp
  • T to G, chromosome 5 at 105,896,612 bp
  • G to A, chromosome 5 at 108,671,792 bp
  • G to T, chromosome 5 at 109,092,044 bp
  • T to C, chromosome 6 at 97,941,099 bp
  • T to A, chromosome 7 at 6,073,114 bp
  • G to A, chromosome 7 at 43,651,532 bp
  • T to A, chromosome 7 at 55,815,020 bp
  • A to T, chromosome 7 at 57,508,048 bp
  • A to G, chromosome 7 at 103,682,861 bp
  • G to A, chromosome 7 at 105,693,972 bp
  • A to T, chromosome 7 at 120,889,760 bp
  • A to G, chromosome 7 at 126,442,000 bp
  • A to G, chromosome 7 at 126,490,472 bp
  • A to T, chromosome 7 at 141,801,088 bp
  • A to T, chromosome 8 at 14,979,836 bp
  • A to G, chromosome 8 at 45,770,576 bp
  • T to C, chromosome 9 at 7,015,526 bp
  • A to G, chromosome 9 at 19,338,858 bp
  • T to C, chromosome 9 at 20,918,327 bp
  • T to C, chromosome 9 at 22,278,532 bp
  • T to C, chromosome 9 at 27,051,608 bp
  • C to A, chromosome 9 at 78,204,329 bp
  • CAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGA to CAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGA, chromosome 9 at 119,160,716 bp
  • A to T, chromosome 9 at 121,661,419 bp
  • G to A, chromosome 10 at 29,354,277 bp
  • A to G, chromosome 10 at 33,364,008 bp
  • T to C, chromosome 10 at 42,454,495 bp
  • G to A, chromosome 10 at 81,638,638 bp
  • T to C, chromosome 10 at 117,696,022 bp
  • T to C, chromosome 10 at 129,093,747 bp
  • A to G, chromosome 11 at 22,973,637 bp
  • C to A, chromosome 11 at 52,121,946 bp
  • C to A, chromosome 11 at 67,256,295 bp
  • G to T, chromosome 11 at 75,165,794 bp
  • T to C, chromosome 11 at 75,755,665 bp
  • T to A, chromosome 11 at 119,725,061 bp
  • A to G, chromosome 12 at 101,058,482 bp
  • A to C, chromosome 13 at 48,819,557 bp
  • G to A, chromosome 13 at 54,786,891 bp
  • G to A, chromosome 13 at 60,785,040 bp
  • T to C, chromosome 13 at 70,604,442 bp
  • A to G, chromosome 13 at 100,597,419 bp
  • T to A, chromosome 13 at 117,656,734 bp
  • A to T, chromosome 14 at 32,835,886 bp
  • T to C, chromosome 14 at 50,346,220 bp
  • C to T, chromosome 14 at 55,752,134 bp
  • A to G, chromosome 15 at 16,778,306 bp
  • T to A, chromosome 15 at 39,462,580 bp
  • A to G, chromosome 15 at 55,071,397 bp
  • T to A, chromosome 15 at 66,541,699 bp
  • T to A, chromosome 15 at 83,721,945 bp
  • T to C, chromosome 15 at 100,787,212 bp
  • C to T, chromosome 15 at 101,793,928 bp
  • A to G, chromosome 16 at 18,225,225 bp
  • A to G, chromosome 16 at 20,737,441 bp
  • A to G, chromosome 16 at 38,625,590 bp
  • A to C, chromosome 17 at 23,401,766 bp
  • A to G, chromosome 17 at 29,849,787 bp
  • G to T, chromosome 17 at 35,023,943 bp
  • T to A, chromosome 17 at 50,698,978 bp
  • C to T, chromosome 17 at 58,973,752 bp
  • A to T, chromosome 17 at 71,391,379 bp
  • A to G, chromosome 18 at 12,402,062 bp
  • A to G, chromosome 19 at 5,716,406 bp
  • A to G, chromosome 19 at 21,280,524 bp
  • T to C, chromosome 19 at 47,273,250 bp
  • G to T, chromosome 19 at 48,603,875 bp
  • T to A, chromosome 19 at 56,335,042 bp
  • G to A, chromosome X at 72,833,383 bp
  • T to C, chromosome X at 112,241,085 bp
Genotype Determination
Phenotype
G1 male heterozygous mice are viable and fertile. The G1 mice were not characterized prior to archiving.
Strain Development
C57BL/6J mice were injected with ENU, resulting in G0 mice that were bred back to C57BL/6J. Sperm was archived from G1 male mice that produced viable G2 mice.
Suggested Control Mice
Wild-type littermates or C57BL/6J mice
MMRRC Genetic QC Summary
The MMRRC Centers have developed a genetic QC pipeline using MiniMUGA array genotyping to provide additional information on strain backgrounds for MMRRC congenic and inbred strains. For more information on when data may be available, or to request genotyping for a strain of interest, please contact mmrrc@missouri.edu. Older strains may not have this information.
Donor
Bruce Beutler, M.D., University of Texas Southwestern Medical Center.
Primary Reference
MUTAGENETIX record for R1766 (G1). B. Beutler and colleagues, Center for the Genetics of Host Defense, UT Southwestern, Dallas, TX.

Colony and Husbandry Information

Colony Surveillance Program and Current Health Reports

Mice recovered from a cryo-archive will have health surveillance performed on recipient females. Health reports will be provided prior to shipment. If you require additional health status information, please email mmrrc@missouri.edu .
Coat Color
Black
MMRRC Breeding System
Random intra-strain mating
Breeding Scheme(s)
When maintaining a live colony, heterozygous mice may be bred together, bred with wild-type siblings, or bred with C57BL/6J inbred mice.
Overall Breeding Performance
Undetermined; during development, mating was done with heterozygous males; viability, fertility and other breeding statistics for heterozygous females and homozygotes are unverified, but presumably would be similar to the C57BL/6J background strain
Average litter size
Undetermined
Recommended wean age
3 weeks

Order Request Information

Limited quantities of breeder mice (recovered litter) are available from a cryoarchive; recovered litter usually available to ship in 3 to 4 months.

Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

Distribution of this strain requires submission of the MMRRC Conditions of Use (COU). A link to the COU web form will be provided via email after an order has been placed; the form should be completed then or the email forwarded to your institutional official for completion.

The donor or their institution limits the distribution to non-profit institutions only.

Additional charges may apply for any special requests. Shipping costs are in addition to the basic distribution/resuscitation fees. Information on shipping costs and any additional charges will be provided by the supplying MMRRC facility.

Click button to Request this one strain. (Use the MMRRC Catalog Search to request more than one strain.)
MMRRC Item # Description Distribution Fee / Unit (US $)
*Shipping & Handling not included*
Units Notes
039798-MU-RESUS Litter recovered from cryo-archive $5,475.00 / Non-Profit Litter Recovered litter4; additional fees for any special requests.
Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

Some MMRRC strains were submitted by the donor as cryopreserved germplasm, and because these strains were not cryopreserved by the MMRRC, we have not assessed the quality of this material. We have extensive experience with recovery of mice from cryopreserved sperm and embryos of varying quality, including using techniques such as IVF and ICSI, and are confident that we will have success in most, if not all, cases. However, because of the unknown quality of these frozen samples, we will restrict recovery efforts to two attempts for each order. Subsequent attempts can be performed on a fee-for-service basis, in addition to the standard fees, upon request.

1 The distribution fee covers the expense of rederiving mice from a live mouse; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

2 An aliquot contains a sufficient number of embryos (in one or more vials or straws and based on the transfer success rate of the MMRRC facility) to transfer into one to three recipients. The MMRRC makes no guarantee concerning embryo transfer success experienced in the recipient investigator's laboratory. Neither gender nor genotype ratios are guaranteed.

3 An aliquot is one straw or vial with sufficient sperm to recover at least one litter of mice, as per provided protocols, when performed at the MMRRC facility. The MMRRC makes no guarantee concerning the success of these procedures when performed outside the MMRRC facilities.

4 The distribution fee covers the expense of resuscitating mice from the cryo-archive; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

To request material from the MMRRC: Please fill out our on-line request form (accessible from the catalog search results page, or click the Request this Strain button in the fees section). If you have questions or need assistance completing this form, you may call Customer Service at (800) 910-2291 (in USA or Canada) or (530) 757-5710 (international calls). Before you call, please have with you: the MMRRC item number, quantity needed, Bill-to and Ship-to contact information.