Loading Mouse GIF
Loading...

Strain Name:
C57BL/6J-MtgxR1766Btlr/Mmmh
Stock Number:
039798-MU
Citation ID:
RRID:MMRRC_039798-MU
Other Names:
R1766 (G1), C57BL/6J-MtgxR1766Btlr
Major Collection:

Strain Information

Mitf
Name: melanogenesis associated transcription factor
Synonyms: mi, wh, BCC2, bHLHe32, Gsfbcc2
Type: Gene
Species: Mouse
Chromosome: 6
NCBI: 17342
HGNC: HGNC:7105
Homologene: 4892
Rptor
Name: regulatory associated protein of MTOR, complex 1
Synonyms: raptor, 4932417H02Rik, Rap
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 74370
Homologene: 80210
Gsta4
Name: glutathione S-transferase, alpha 4
Synonyms: GST 5.7, mGsta4
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 14860
VEGA: 9
Homologene: 135605
S100a1
Name: S100 calcium binding protein A1
Synonyms: S100a, S100
Type: Gene
Species: Mouse
Chromosome: 3
NCBI: 20193
Homologene: 4566
Ntrk1
Name: neurotrophic tyrosine kinase, receptor, type 1
Synonyms: TrkA, Tkr
Type: Gene
Species: Mouse
Chromosome: 3
NCBI: 18211
HGNC: HGNC:8031
Homologene: 1898
Tiparp
Name: TCDD-inducible poly(ADP-ribose) polymerase
Synonyms: DDF1, PARP-7, PARP7
Type: Gene
Species: Mouse
Chromosome: 3
NCBI: 99929
Homologene: 9167
Genetic Alterations
ENU-induced transitions at the following base pair locations (GRCm38):
  • T to C, chromosome 2 at 15,069,837 bp
  • G to A, chromosome 2 at 26,325,383 bp
  • T to A, chromosome 2 at 128,839,170 bp
  • A to T, chromosome 2 at 158,505,934 bp
  • G to A, chromosome 2 at 160,966,639 bp
  • A to T, chromosome 3 at 65,532,049 bp
  • A to T, chromosome 3 at 79,092,703 bp
  • A to T, chromosome 3 at 87,778,518 bp
  • A to G, chromosome 3 at 90,511,292 bp
  • A to T, chromosome 3 at 101,050,122 bp
  • T to A, chromosome 3 at 101,431,282 bp
  • T to C, chromosome 3 at 144,712,685 bp
  • T to G, chromosome 3 at 152,740,156 bp
  • A to G, chromosome 4 at 11,202,977 bp
  • C to T, chromosome 4 at 11,303,360 bp
  • A to G, chromosome 4 at 46,522,039 bp
  • C to T, chromosome 4 at 120,096,671 bp
  • T to C, chromosome 4 at 129,657,442 bp
  • C to T, chromosome 4 at 144,159,122 bp
  • A to G, chromosome 4 at 148,037,978 bp
  • C to T, chromosome 5 at 34,462,131 bp
  • T to A, chromosome 5 at 90,264,797 bp
  • C to T, chromosome 5 at 98,566,546 bp
  • T to G, chromosome 5 at 105,896,612 bp
  • G to A, chromosome 5 at 108,671,792 bp
  • G to T, chromosome 5 at 109,092,044 bp
  • T to C, chromosome 6 at 97,941,099 bp
  • T to A, chromosome 7 at 6,073,114 bp
  • G to A, chromosome 7 at 43,651,532 bp
  • T to A, chromosome 7 at 55,815,020 bp
  • A to T, chromosome 7 at 57,508,048 bp
  • A to G, chromosome 7 at 103,682,861 bp
  • G to A, chromosome 7 at 105,693,972 bp
  • A to T, chromosome 7 at 120,889,760 bp
  • A to G, chromosome 7 at 126,442,000 bp
  • A to G, chromosome 7 at 126,490,472 bp
  • A to T, chromosome 7 at 141,801,088 bp
  • A to T, chromosome 8 at 14,979,836 bp
  • A to G, chromosome 8 at 45,770,576 bp
  • T to C, chromosome 9 at 7,015,526 bp
  • A to G, chromosome 9 at 19,338,858 bp
  • T to C, chromosome 9 at 20,918,327 bp
  • T to C, chromosome 9 at 22,278,532 bp
  • T to C, chromosome 9 at 27,051,608 bp
  • C to A, chromosome 9 at 78,204,329 bp
  • CAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGA to CAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGA, chromosome 9 at 119,160,716 bp
  • A to T, chromosome 9 at 121,661,419 bp
  • G to A, chromosome 10 at 29,354,277 bp
  • A to G, chromosome 10 at 33,364,008 bp
  • T to C, chromosome 10 at 42,454,495 bp
  • G to A, chromosome 10 at 81,638,638 bp
  • T to C, chromosome 10 at 117,696,022 bp
  • T to C, chromosome 10 at 129,093,747 bp
  • A to G, chromosome 11 at 22,973,637 bp
  • C to A, chromosome 11 at 52,121,946 bp
  • C to A, chromosome 11 at 67,256,295 bp
  • G to T, chromosome 11 at 75,165,794 bp
  • T to C, chromosome 11 at 75,755,665 bp
  • T to A, chromosome 11 at 119,725,061 bp
  • A to G, chromosome 12 at 101,058,482 bp
  • A to C, chromosome 13 at 48,819,557 bp
  • G to A, chromosome 13 at 54,786,891 bp
  • G to A, chromosome 13 at 60,785,040 bp
  • T to C, chromosome 13 at 70,604,442 bp
  • A to G, chromosome 13 at 100,597,419 bp
  • T to A, chromosome 13 at 117,656,734 bp
  • A to T, chromosome 14 at 32,835,886 bp
  • T to C, chromosome 14 at 50,346,220 bp
  • C to T, chromosome 14 at 55,752,134 bp
  • A to G, chromosome 15 at 16,778,306 bp
  • T to A, chromosome 15 at 39,462,580 bp
  • A to G, chromosome 15 at 55,071,397 bp
  • T to A, chromosome 15 at 66,541,699 bp
  • T to A, chromosome 15 at 83,721,945 bp
  • T to C, chromosome 15 at 100,787,212 bp
  • C to T, chromosome 15 at 101,793,928 bp
  • A to G, chromosome 16 at 18,225,225 bp
  • A to G, chromosome 16 at 20,737,441 bp
  • A to G, chromosome 16 at 38,625,590 bp
  • A to C, chromosome 17 at 23,401,766 bp
  • A to G, chromosome 17 at 29,849,787 bp
  • G to T, chromosome 17 at 35,023,943 bp
  • T to A, chromosome 17 at 50,698,978 bp
  • C to T, chromosome 17 at 58,973,752 bp
  • A to T, chromosome 17 at 71,391,379 bp
  • A to G, chromosome 18 at 12,402,062 bp
  • A to G, chromosome 19 at 5,716,406 bp
  • A to G, chromosome 19 at 21,280,524 bp
  • T to C, chromosome 19 at 47,273,250 bp
  • G to T, chromosome 19 at 48,603,875 bp
  • T to A, chromosome 19 at 56,335,042 bp
  • G to A, chromosome X at 72,833,383 bp
  • T to C, chromosome X at 112,241,085 bp
Genotype Determination
Phenotype
G1 male heterozygous mice are viable and fertile. The G1 mice were not characterized prior to archiving.
Strain GQC Summary
The MMRRC Centers have developed a Strain GQC pipeline using MiniMUGA array genotyping to provide additional information on strain backgrounds for MMRRC strains. For more information on whether data may be available, or to request genotyping for a strain of interest, please contact MMRRC_GeneticQC@med.unc.edu. Older strains may not have this information available.
Suggested Control Mice
Littermates of all relevant genotypes.
Donor
Bruce Beutler, M.D., University of Texas Southwestern Medical Center.
Primary Reference
MUTAGENETIX record for R1766 (G1). B. Beutler and colleagues, Center for the Genetics of Host Defense, UT Southwestern, Dallas, TX.
Strain Development
C57BL/6J mice were injected with ENU, resulting in G0 mice that were bred back to C57BL/6J. Sperm was archived from G1 male mice that produced viable G2 mice.


Disclaimer: If MMRRC Strain Genetic Quality Control (GQC; based on MiniMUGA genotyping and analysis) has been completed for this strain, the information might differ from the genetic background information provided by the submitter. MiniMUGA genetic analysis is done on a strain’s tissue samples taken when archived by or ordered from the assigned MMRRC Center.

Colony and Husbandry Information

Colony Surveillance Program and Current Health Reports

Mice recovered from a cryo-archive will have health surveillance performed on recipient females. Health reports will be provided prior to shipment. If you require additional health status information, please email mmrrc@missouri.edu.
Coat Color
Black
MMRRC Breeding System
Random intra-strain mating
Breeding Scheme(s)
When maintaining a live colony, heterozygous mice may be bred together, bred with wild-type siblings, or bred with C57BL/6J inbred mice.
Overall Breeding Performance
Undetermined; during development, mating was done with heterozygous males; viability, fertility and other breeding statistics for heterozygous females and homozygotes are unverified, but presumably would be similar to the C57BL/6J background strain
Average litter size
Undetermined
Recommended wean age
3 weeks

Order Request Information

Limited quantities of breeder mice (recovered litter) are available from a cryoarchive; recovered litter usually available to ship in 3 to 4 months.

Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

Distribution of this strain requires submission of the MMRRC Conditions of Use (COU). A link to the COU web form will be provided via email after an order has been placed; the form should be completed then or the email forwarded to your institutional official for completion.

The donor or their institution limits the distribution to non-profit institutions only.

Additional charges may apply for any special requests. Shipping costs are in addition to the basic distribution/resuscitation fees. Information on shipping costs and any additional charges will be provided by the supplying MMRRC facility.

Click button to Request this one strain. (Use the MMRRC Catalog Search to request more than one strain.)
MMRRC Item # Description Distribution Fee / Unit (US $)
*Shipping & Handling not included*
Units Notes
039798-MU-RESUS Litter recovered from cryo-archive $5,475.00 / Non-Profit Litter Recovered litter4; additional fees for any special requests.
Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

Some MMRRC strains were submitted by the donor as cryopreserved germplasm, and because these strains were not cryopreserved by the MMRRC, we have not assessed the quality, nor genotype, of this material. Our expertise in reviving mice from various qualities of frozen sperm and embryos, using methods like IVF and ICSI, gives us confidence in successful recoveries in most cases. However, due to the uncertain quality of these samples, we'll limit revival attempts to two per order. Additional attempts are available for a fee, on top of standard charges, if requested. It's important to note that some strains may lack the expected mutation, so we can't assure successful order fulfillment until we attempt to revive the strain.

1 The distribution fee covers the expense of rederiving mice from a live mouse; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

2 An aliquot contains a sufficient number of embryos (in one or more vials or straws and based on the transfer success rate of the MMRRC facility) to transfer into one to three recipients. The MMRRC makes no guarantee concerning embryo transfer success experienced in the recipient investigator's laboratory. Neither gender nor genotype ratios are guaranteed.

3 An aliquot is one straw or vial with sufficient sperm to recover at least one litter of mice, as per provided protocols, when performed at the MMRRC facility. The MMRRC makes no guarantee concerning the success of these procedures when performed outside the MMRRC facilities.

4 The distribution fee covers the expense of resuscitating mice from the cryo-archive; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

To request material from the MMRRC: Please fill out our on-line request form (accessible from the catalog search results page, or click the Request this Strain button in the fees section). If you have questions or need assistance completing this form, you may call Customer Service at (800) 910-2291 (in USA or Canada) or (530) 757-5710 (international calls). Before you call, please have with you: the MMRRC item number, quantity needed, Bill-to and Ship-to contact information.