Strain Name:
Stock Number:
Citation ID:
Other Names:
R1874 (G1), C57BL/6J-MtgxR1874Btlr
Major Collection:

Gene Information

Name: fibrinogen alpha chain
Synonyms: Fib, ENSMUSG00000059807
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 3
NCBI: 14161
Homologene: 428
Name: p21 (RAC1) activated kinase 1
Synonyms: PAK-1, Paka
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 7
NCBI: 18479
Homologene: 1936
Name: BPI fold containing family B, member 3
Synonyms: Rya3
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 2
NCBI: 378700
Homologene: 18807
Name: paxillin
Synonyms: Pax
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 5
NCBI: 19303
Homologene: 37697
Name: Bloom syndrome, RecQ like helicase
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 7
NCBI: 12144
Homologene: 47902
Name: CLIP associating protein 1
Synonyms: 5730583A19Rik, 1700030C23Rik, mCLASP1, CLASP1alpha, CLASP1, B130045P17Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 1
NCBI: 76707
Homologene: 41024
Name: BRD4 interacting chromatin remodeling complex associated protein like
Synonyms: BC032203, Gltscr1l
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 17
NCBI: 210982
VEGA: 17
Homologene: 19366
Name: GLI-Kruppel family member GLI2
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 1
NCBI: 14633
Homologene: 12725
Name: protein phosphatase 1, regulatory subunit 9A
Synonyms: 4930518N04Rik, neurabin-I, A230094E16Rik, 2810430P21Rik, Neurabin I, NRB
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 6
NCBI: 243725
Homologene: 14247
Name: tripartite motif-containing 6
Synonyms: D7Ertd684e, C430046K18Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 7
NCBI: 94088
Homologene: 14381
Name: DnaJ heat shock protein family (Hsp40) member C7
Synonyms: mDj11, Ttc2, 2010003F24Rik, mTpr2, 2010004G07Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 11
NCBI: 56354
Homologene: 68306
Name: B-TFIID TATA-box binding protein associated factor 1
Synonyms: E430027O22Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 19
NCBI: 107182
Homologene: 31978
Name: kinesin family member 1B
Synonyms: D4Mil1e, Kif1b alpha, Kif1b beta, KIF1Bp130, KIF1Bp204, N-3 kinesin, A530096N05Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 4
NCBI: 16561
Homologene: 99835
Name: FRY microtubule binding protein
Synonyms: cg003, 9330186A19Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 5
NCBI: 320365
Homologene: 113770
Name: copine I
Synonyms: 1810028N16Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 2
NCBI: 266692
Homologene: 36501
Name: terminal uridylyl transferase 4
Synonyms: 6030404K05Rik, 9230115F04Rik, Tent3a, Zcchc11
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 4
NCBI: 230594
Homologene: 35279
Name: WD repeat domain 7
Synonyms: TGF-beta resistance associated gene, TRAG
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 18
NCBI: 104082
VEGA: 18
Homologene: 11408
Name: ubiquitination factor E4B
Synonyms: UFD2, 4933406G05Rik, 4930551I19Rik, UFD2a, D4Bwg0973e, Ufd2p
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 4
NCBI: 63958
Homologene: 107623
Name: GTPase activating protein and VPS9 domains 1
Synonyms: 2010005B09Rik, 4432404J10Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 2
NCBI: 66691
Homologene: 32637
Name: NBR1, autophagy cargo receptor
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 11
NCBI: 17966
Homologene: 7438
Name: centromere protein F
Synonyms: 6530404A22Rik, Lek1, mitosin
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 1
NCBI: 108000
Homologene: 22969
Name: ankyrin 3, epithelial
Synonyms: Ank-3, Ankyrin-3, AnkG, 2900054D09Rik, Ankyrin-G
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 10
NCBI: 11735
Homologene: 56908
Name: opioid receptor, mu 1
Synonyms: MOR-1, muOR, mor, Oprm, MOP-R, MOP receptor
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 10
NCBI: 18390
Homologene: 37368
Name: mutL homolog 3
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 12
NCBI: 217716
VEGA: 12
Homologene: 91153
Name: N(alpha)-acetyltransferase 16, NatA auxiliary subunit
Synonyms: 1300019C06Rik, Narg1l
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 14
NCBI: 66897
Homologene: 134838
Name: protection of telomeres 1B
Synonyms: 2810458H16Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 17
NCBI: 72836
VEGA: 17
Homologene: 87058
Name: WT1 interacting protein
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 7
NCBI: 101543
Homologene: 64353
Name: tight junction protein 1
Synonyms: ZO-1, ZO1
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 7
NCBI: 21872
Homologene: 2445
Name: polymerase (DNA directed), epsilon
Synonyms: pol-epsilon
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 5
NCBI: 18973
Homologene: 4539
Name: sorting nexin 29
Synonyms: LOC381035, LOC385605, 4933437K13Rik, Gm11170, Rundc2a
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 16
NCBI: 74478
Homologene: 32706
Name: F-box and leucine-rich repeat protein 18
Synonyms: C330021B20Rik, B130019G13Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 5
NCBI: 231863
Homologene: 41603
Name: castor zinc finger 1
Synonyms: 2410019P08Rik, D4Ertd432e, castor, Cst
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 4
NCBI: 69743
Homologene: 9824
Name: ankyrin repeat domain 34B
Synonyms: 6430502M16Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 13
NCBI: 218440
Homologene: 18450
Name: RAD1 checkpoint DNA exonuclease
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 15
NCBI: 19355
Homologene: 37695
Name: dihydrolipoamide S-succinyltransferase (E2 component of 2-oxo-glutarate complex)
Synonyms: 4930529O08Rik, 1600017E01Rik, 4632413C10Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 12
NCBI: 78920
VEGA: 12
Homologene: 1456
Name: lipoprotein lipase
Synonyms: O 1-4-5
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 8
NCBI: 16956
Homologene: 200
Name: grainyhead like transcription factor 1
Synonyms: p70 MGR, p61 MGR, LBP-32, Tcfcp2l2
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 12
NCBI: 195733
VEGA: 12
Homologene: 32219
Name: von Willebrand factor C domain containing 2
Synonyms: A930041G11Rik, Brorin, cradin
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 11
NCBI: 319922
Homologene: 18542
Name: carboxypeptidase X 2 (M14 family)
Synonyms: 4632435C11Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 7
NCBI: 55987
Homologene: 69259
Name: notch 1
Synonyms: lin-12, Tan1, Mis6, 9930111A19Rik, Motch A, N1
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 2
NCBI: 18128
Homologene: 32049
Name: prolyl 4-hydroxylase, beta polypeptide
Synonyms: ERp59, protein disulfide isomerase, Thbp, Pdia1, PDI
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 11
NCBI: 18453
Homologene: 55495
Name: PMS1 homolog 1, mismatch repair system component
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 1
NCBI: 227099
Homologene: 449
Name: G protein-coupled receptor kinase 6
Synonyms: Gprk6
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 13
NCBI: 26385
VEGA: 13
Homologene: 37570
Name: bromodomain containing 8
Synonyms: p120, SMAP, 2610007E11Rik, 4432404P07Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 18
NCBI: 78656
Homologene: 41790
Name: calsyntenin 1
Synonyms: calsyntenin-1, Cst-1, 1810034E21Rik, alcadein alpha
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 4
NCBI: 65945
Homologene: 8814
Name: A kinase (PRKA) anchor protein 11
Synonyms: 6330501D17Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 14
NCBI: 219181
Homologene: 8279
Name: cadherin 23 (otocadherin)
Synonyms: 4930542A03Rik, USH1D, mdfw, ahl, bob, nmf112, nmf181, nmf252, sals
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 10
NCBI: 22295
Homologene: 11142
Name: cubilin (intrinsic factor-cobalamin receptor)
Synonyms: D2Wsu88e
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 2
NCBI: 65969
Homologene: 37434
Name: hemicentin 1
Synonyms: LOC240793, EG545370
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 1
NCBI: 545370
Homologene: 23741
Name: serine/threonine kinase 32A
Synonyms: YANK1, A930015B13Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 18
NCBI: 269019
VEGA: 18
Homologene: 65357
Name: myelin-associated glycoprotein
Synonyms: Gma, siglec-4a
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 7
NCBI: 17136
Homologene: 1771
Name: sidekick cell adhesion molecule 2
Synonyms: 5330435L01Rik, 4632412F08Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 11
NCBI: 237979
Homologene: 10406
Name: von Willebrand factor A domain containing 7
Synonyms: G7c, D17H6S56E-3
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 17
NCBI: 27762
Homologene: 11895
Name: SEC14-like lipid binding 1
Synonyms: 1200017E04Rik, 2810012L19Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 11
NCBI: 74136
Homologene: 37719
Name: NYN domain and retroviral integrase containing
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 14
NCBI: 277154
VEGA: 14
Homologene: 19483
Name: insulin receptor substrate 1
Synonyms: IRS-1, G972R
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 1
NCBI: 16367
Homologene: 4049
Name: BPI fold containing family B, member 5
Synonyms: BC018465
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 2
NCBI: 228802
Homologene: 64814
Name: Von Willebrand factor
Synonyms: B130011O06Rik, 6820430P06Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 6
NCBI: 22371
Homologene: 466
Name: NAD synthetase 1
Synonyms: 9130012B15Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 7
NCBI: 78914
Homologene: 6098
Name: otogelin
Synonyms: Otgn
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 7
NCBI: 18419
Homologene: 8421
Name: SLX4 structure-specific endonuclease subunit homolog (S. cerevisiae)
Synonyms: D16Bwg1016e, Btbd12
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 16
NCBI: 52864
Homologene: 23770
Name: serine (or cysteine) peptidase inhibitor, clade A (alpha-1 antiproteinase, antitrypsin), member 3J
Synonyms: alpha-1 antiproteinase, Gm4931
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 12
NCBI: 238395
Homologene: 120222
Name: myosin, heavy polypeptide 3, skeletal muscle, embryonic
Synonyms: MyHC-emb, Myhs-e, Myhse
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 11
NCBI: 17883
Homologene: 20553
Name: solute carrier family 6 (neurotransmitter transporter, glycine), member 9
Synonyms: Glyt-1, Glyt1
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 4
NCBI: 14664
Homologene: 5050
Name: myeloid nuclear differentiation antigen like
Synonyms: Ifi212
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 1
NCBI: 100040462
Homologene: 115929
Name: thrombospondin, type I, domain containing 7A
Synonyms: LOC330267
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 6
NCBI: 330267
Homologene: 46582
Name: solute carrier family 6 (neurotransmitter transporter, L-proline), member 7
Synonyms: Prot
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 18
NCBI: 240332
VEGA: 18
Homologene: 8592
Name: cadherin, EGF LAG seven-pass G-type receptor 3
Synonyms: Fmi1, flamingo, Adgrc3
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 9
NCBI: 107934
Homologene: 1077
Name: SPEG complex locus
Synonyms: BPEG, SPEGbeta, SPEGalpha, D1Bwg1450e, SPEG, Apeg1
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 1
NCBI: 11790
Homologene: 55619
Name: MANSC domain containing 4
Synonyms: Gm5887
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 6
NCBI: 545893
Homologene: 86837
Name: echinoderm microtubule associated protein like 6
Synonyms: 2900083P10Rik, C230094A16Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 11
NCBI: 237711
Homologene: 104282
Name: pregnancy-specific beta-1-glycoprotein 21
Synonyms: cea8, 1600019C01Rik, 1600026N13Rik, 1600025N01Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 7
NCBI: 72242
Homologene: 110989
Name: ankyrin repeat and MYND domain containing 2
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 12
NCBI: 217473
VEGA: 12
Homologene: 10662
Name: transmembrane protein 143
Synonyms: 2310076O21Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 7
NCBI: 70209
Homologene: 10105
Name: pancreatic lipase-related protein 2
Synonyms: PLRP2
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 19
NCBI: 18947
VEGA: 19
Homologene: 3936
Name: cytochrome P450, family 4, subfamily f, polypeptide 39
Synonyms: 4732474A20Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 17
NCBI: 320997
VEGA: 17
Homologene: 69814
Name: spermatogenesis associated 17
Synonyms: 4930504I07Rik, 1700065F16Rik, 4930513F16Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 1
NCBI: 74717
Homologene: 12551
Name: X-linked Kx blood group related 6
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 14
NCBI: 219149
Homologene: 18287
Name: diacylglycerol kinase, theta
Synonyms: Dagk4, 110kDa, DAGK7, Dgkd, Dgk theta
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 5
NCBI: 110524
Homologene: 20352
Name: serine (or cysteine) peptidase inhibitor, clade B, member 9d
Synonyms: ovalbumin, Spi9, AT2
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 13
NCBI: 20726
Homologene: 69093
Name: transmembrane protein 45A2
Synonyms: 2310005G13Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 16
NCBI: 69457
VEGA: 16
Homologene: 131266
Name: TBC1 domain family, member 31
Synonyms: LOC210544, D330013L20Rik, Wdr67
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 15
NCBI: 210544
Homologene: 17089
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 3
Name: zinc finger protein 422, pseudogene
Synonyms: Krox-25-2, Zfp422-rs1
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 17
NCBI: 100416808
Name: predicted gene 15446
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 5
NCBI: 100642166
Name: APOBEC1 complementation factor
Synonyms: ACF, apobec-1 complementation factor, 1810073H04Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 19
NCBI: 69865
VEGA: 19
Homologene: 16363
Name: serine/arginine repetitive matrix 4
Synonyms: fp, flopsy, B230202K19Rik, nSR100, 1500001A10Rik, bv
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 5
NCBI: 68955
Homologene: 49869
Name: olfactory receptor family 2 subfamily N member 1D
Synonyms: MOR256-7, GA_x6K02T2PSCP-2779375-2780313, Olfr136
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 17
NCBI: 258803
Homologene: 119758
Name: hydroxysteroid (17-beta) dehydrogenase 7
Synonyms: ERG27
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 1
NCBI: 15490
Homologene: 40728
Name: protein tyrosine phosphatase, receptor type, U
Synonyms: Ptprl, RPTPlambda
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 4
NCBI: 19273
Homologene: 4168
Name: galactose-3-O-sulfotransferase 1
Synonyms: galactosylceramide sulfotransferase, 3'-phosphoadenylylsulfate-galactosylceramide 3'-sulfotransferase, GalCer sulfotransferase, Gcst, Cst
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 11
NCBI: 53897
Homologene: 3574
Name: vomeronasal 2, receptor 8
Synonyms: EG627479
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 5
NCBI: 627479
Homologene: 129606
Name: expressed sequence AA986860
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 1
NCBI: 212439
Homologene: 49741
Name: catenin (cadherin associated protein), alpha 3
Synonyms: Vr22, Catna3, 4930429L08Rik, alphaT-catenin
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 10
NCBI: 216033
Homologene: 56583
Name: anoctamin 3
Synonyms: B230324K02Rik, Tmem16c
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 2
NCBI: 228432
Homologene: 57147
Name: PIH1 domain containing 2
Synonyms: 2700059L22Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 9
NCBI: 72614
Homologene: 12474
Name: F-box and WD-40 domain protein 22
Synonyms: Gm5164
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 9
NCBI: 382156
Homologene: 110776
Name: MAS-related GPR, member A2B
Synonyms: MrgA2, Mrgpra2
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 7
NCBI: 235712
Homologene: 79615
Name: olfactory receptor family 51 subfamily A member 43
Synonyms: GA_x6K02T2PBJ9-6803062-6802118, MOR13-1, Olfr644
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 7
NCBI: 259125
Homologene: 17491
Name: F-box and leucine-rich repeat protein 7
Synonyms: Fbl6, FBL7, D230018M15Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 15
NCBI: 448987
VEGA: 15
Homologene: 69121
Name: beta-1,4-N-acetyl-galactosaminyl transferase 4
Synonyms: LOC381951
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 7
NCBI: 330671
Homologene: 27982
Name: UDP glycosyltransferases 3 family, polypeptide A2
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 15
NCBI: 223337
Homologene: 122787
Name: sirtuin 5
Synonyms: 0610012J09Rik, 1500032M05Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 13
NCBI: 68346
VEGA: 13
Homologene: 40825
Name: adrenergic receptor, beta 3
Synonyms: beta 3-AR, Beta-3 adrenoceptor, Beta-3 AR, beta3-adrenergic receptor, Adrb-3
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 8
NCBI: 11556
Homologene: 37250
Name: transmembrane protein 45b
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 9
NCBI: 235135
Homologene: 16349
Name: olfactory receptor family 10 subfamily G member 6
Synonyms: GA_x6K02T2PVTD-33720892-33721824, MOR223-8, Olfr981
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 9
NCBI: 258283
Homologene: 64849
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 14
Name: GTPase, IMAP family member 7
Synonyms: IAN7, Ian3
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 6
NCBI: 231932
Homologene: 134307
Name: myozenin 2
Synonyms: calsarcin-1, 1110012I24Rik, Fatz-2
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 3
NCBI: 59006
Homologene: 9583
Name: prolyl-tRNA synthetase (mitochondrial)(putative)
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 4
NCBI: 230577
Homologene: 5830
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 14
Name: UDP-glucose pyrophosphorylase 2
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 11
NCBI: 216558
Homologene: 121676
Name: coordinator of PRMT5, differentiation stimulator
Synonyms: MGC11316, 1700029I03Rik, COPR5, 2410022L05Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 8
NCBI: 66423
Homologene: 10180
Name: quiescin Q6 sulfhydryl oxidase 1
Synonyms: 1300003H02Rik, Qscn6, QSOX, b2b2673Clo
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 1
NCBI: 104009
Homologene: 37690
Name: hydrocarboxylic acid receptor 1
Synonyms: Gpr81
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 5
NCBI: 243270
Homologene: 13060
Name: free fatty acid receptor 2
Synonyms: Gpr43
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 7
NCBI: 233079
Homologene: 133911
Genetic Alterations
ENU-induced transitions at the following base pair locations (GRCm38):
  • A to T, chromosome 1 at 53,207,233 bp
  • T to C, chromosome 1 at 75,423,906 bp
  • TTCTCTGAGTGGCCACAGCGTCT to TTCT, chromosome 1 at 82,289,853 bp
  • G to T, chromosome 1 at 118,600,585 bp
  • C to A, chromosome 1 at 119,002,049 bp
  • A to G, chromosome 1 at 130,742,691 bp
  • A to C, chromosome 1 at 150,720,695 bp
  • C to T, chromosome 1 at 155,812,639 bp
  • A to T, chromosome 1 at 169,955,993 bp
  • G to A, chromosome 1 at 173,860,367 bp
  • A to C, chromosome 1 at 187,193,915 bp
  • A to G, chromosome 1 at 189,683,816 bp
  • T to A, chromosome 2 at 13,323,002 bp
  • T to C, chromosome 2 at 26,481,579 bp
  • A to T, chromosome 2 at 34,706,021 bp
  • A to C, chromosome 2 at 110,884,872 bp
  • A to G, chromosome 2 at 153,925,840 bp
  • A to G, chromosome 2 at 154,227,202 bp
  • A to G, chromosome 2 at 156,078,382 bp
  • A to G, chromosome 3 at 75,429,347 bp
  • A to T, chromosome 3 at 83,032,721 bp
  • A to T, chromosome 3 at 123,026,116 bp
  • T to C, chromosome 4 at 106,653,716 bp
  • T to A, chromosome 4 at 108,550,725 bp
  • C to A, chromosome 4 at 117,843,150 bp
  • T to A, chromosome 4 at 131,769,755 bp
  • C to G, chromosome 4 at 148,943,211 bp
  • C to T, chromosome 4 at 149,187,632 bp
  • A to G, chromosome 4 at 149,347,971 bp
  • A to G, chromosome 4 at 149,643,741 bp
  • C to A, chromosome 5 at 108,660,595 bp
  • T to A, chromosome 5 at 108,802,418 bp
  • T to C, chromosome 5 at 109,942,553 bp
  • G to A, chromosome 5 at 110,323,664 bp
  • T to C, chromosome 5 at 115,544,990 bp
  • T to A, chromosome 5 at 116,453,506 bp
  • C to T, chromosome 5 at 123,879,265 bp
  • G to A, chromosome 5 at 142,886,223 bp
  • A to G, chromosome 5 at 150,345,921 bp
  • C to T, chromosome 6 at 4,906,348 bp
  • A to T, chromosome 6 at 12,555,435 bp
  • G to A, chromosome 6 at 48,723,515 bp
  • A to T, chromosome 6 at 125,628,372 bp
  • T to G, chromosome 6 at 147,075,190 bp
  • T to C, chromosome 7 at 18,650,816 bp
  • A to G, chromosome 7 at 30,819,414 bp
  • G to A, chromosome 7 at 30,909,051 bp
  • G to T, chromosome 7 at 34,132,483 bp
  • A to G, chromosome 7 at 45,916,564 bp
  • T to A, chromosome 7 at 46,273,695 bp
  • T to A, chromosome 7 at 47,463,994 bp
  • A to T, chromosome 7 at 65,319,253 bp
  • A to G, chromosome 7 at 80,497,418 bp
  • T to C, chromosome 7 at 97,871,580 bp
  • T to C, chromosome 7 at 104,068,129 bp
  • T to C, chromosome 7 at 104,231,902 bp
  • T to C, chromosome 7 at 132,059,834 bp
  • T to A, chromosome 7 at 141,070,526 bp
  • A to G, chromosome 7 at 143,797,844 bp
  • A to G, chromosome 8 at 13,885,112 bp
  • C to A, chromosome 8 at 27,227,563 bp
  • T to A, chromosome 8 at 68,896,619 bp
  • T to A, chromosome 9 at 31,429,087 bp
  • T to A, chromosome 9 at 40,022,855 bp
  • A to G, chromosome 9 at 50,620,945 bp
  • T to C, chromosome 9 at 108,835,838 bp
  • A to T, chromosome 9 at 109,385,111 bp
  • A to G, chromosome 10 at 6,789,035 bp
  • A to G, chromosome 10 at 60,436,818 bp
  • A to G, chromosome 10 at 63,504,107 bp
  • A to T, chromosome 10 at 69,898,083 bp
  • A to G, chromosome 11 at 3,998,231 bp
  • C to A, chromosome 11 at 11,261,495 bp
  • G to T, chromosome 11 at 21,329,048 bp
  • T to G, chromosome 11 at 29,831,136 bp
  • A to G, chromosome 11 at 67,093,179 bp
  • C to T, chromosome 11 at 100,599,313 bp
  • T to C, chromosome 11 at 101,565,794 bp
  • C to T, chromosome 11 at 113,834,956 bp
  • G to C, chromosome 11 at 117,143,767 bp
  • C to T, chromosome 11 at 120,562,166 bp
  • T to C, chromosome 12 at 24,586,156 bp
  • T to A, chromosome 12 at 36,165,931 bp
  • A to T, chromosome 12 at 85,131,074 bp
  • A to G, chromosome 12 at 85,237,513 bp
  • G to T, chromosome 12 at 104,319,699 bp
  • T to A, chromosome 13 at 33,197,963 bp
  • C to T, chromosome 13 at 43,370,791 bp
  • T to C, chromosome 13 at 55,450,273 bp
  • A to G, chromosome 13 at 92,439,556 bp
  • A to G, chromosome 14 at 8,090,145 bp
  • C to T, chromosome 14 at 19,418,824 bp
  • A to T, chromosome 14 at 55,863,493 bp
  • C to A, chromosome 14 at 63,798,296 bp
  • T to A, chromosome 14 at 78,511,866 bp
  • T to C, chromosome 14 at 79,355,743 bp
  • A to T, chromosome 15 at 9,365,351 bp
  • A to G, chromosome 15 at 10,488,006 bp
  • G to A, chromosome 15 at 26,894,998 bp
  • G to A, chromosome 15 at 57,916,110 bp
  • A to G, chromosome 16 at 3,986,848 bp
  • A to G, chromosome 16 at 11,367,681 bp
  • A to G, chromosome 16 at 57,047,084 bp
  • T to A, chromosome 17 at 32,483,324 bp
  • T to C, chromosome 17 at 33,305,453 bp
  • C to G, chromosome 17 at 35,017,112 bp
  • C to T, chromosome 17 at 38,335,969 bp
  • T to A, chromosome 17 at 46,825,178 bp
  • T to A, chromosome 17 at 55,654,805 bp
  • G to C, chromosome 18 at 34,610,474 bp
  • A to G, chromosome 18 at 43,261,316 bp
  • T to A, chromosome 18 at 61,001,398 bp
  • A to G, chromosome 18 at 63,728,504 bp
  • A to G, chromosome 19 at 31,945,774 bp
  • A to T, chromosome 19 at 36,980,583 bp
  • G to T, chromosome 19 at 58,763,389 bp
Genotype Determination
G1 male heterozygous mice are viable and fertile. The G1 mice were not characterized prior to archiving.
Strain Development
C57BL/6J mice were injected with ENU, resulting in G0 mice that were bred back to C57BL/6J. Sperm was archived from G1 male mice that produced viable G2 mice.
Suggested Control Mice
Wild-type littermates or C57BL/6J mice
Bruce Beutler, M.D., University of Texas Southwestern Medical Center.
Primary Reference
MUTAGENETIX record for R1874 (G1). B. Beutler and colleagues, Center for the Genetics of Host Defense, UT Southwestern, Dallas, TX.

Colony and Husbandry Information

Colony Surveillance Program and Current Health Reports

Mice recovered from a cryo-archive will have health surveillance performed on recipient females. Health reports will be provided prior to shipment. If you require additional health status information, please email .
Coat Color
MMRRC Breeding System
Random intra-strain mating
Breeding Scheme(s)
When maintaining a live colony, heterozygous mice may be bred together, bred with wild-type siblings, or bred with C57BL/6J inbred mice.
Overall Breeding Performance
Undetermined; during development, mating was done with heterozygous males; viability, fertility and other breeding statistics for heterozygous females and homozygotes are unverified, but presumably would be similar to the C57BL/6J background strain
Average litter size
Recommended wean age
3 weeks

Order Request Information

Limited quantities of breeder mice (recovered litter) are available from a cryoarchive; recovered litter usually available to ship in 3 to 4 months.

Cryopreserved material may be available upon request, please inquire to for more information.

Distribution of this strain requires submission of the MMRRC Conditions of Use (COU). A link to the COU web form will be provided via email after an order has been placed; the form should be completed then or the email forwarded to your institutional official for completion.

The donor or their institution limits the distribution to non-profit institutions only.

Additional charges may apply for any special requests. Shipping costs are in addition to the basic distribution/resuscitation fees. Information on shipping costs and any additional charges will be provided by the supplying MMRRC facility.

Click button to Request this one strain. (Use the MMRRC Catalog Search to request more than one strain.)
MMRRC Item # Description Distribution Fee / Unit (US $)
*Shipping & Handling not included*
Units Notes
039896-MU-RESUS Litter recovered from cryo-archive $5,475.00 / Non-Profit Litter Recovered litter4; additional fees for any special requests.
Cryopreserved material may be available upon request, please inquire to for more information.

Some MMRRC strains were submitted by the donor as cryopreserved germplasm, and because these strains were not cryopreserved by the MMRRC, we have not assessed the quality of this material. We have extensive experience with recovery of mice from cryopreserved sperm and embryos of varying quality, including using techniques such as IVF and ICSI, and are confident that we will have success in most, if not all, cases. However, because of the unknown quality of these frozen samples, we will restrict recovery efforts to two attempts for each order. Subsequent attempts can be performed on a fee-for-service basis, in addition to the standard fees, upon request.

1 The distribution fee covers the expense of rederiving mice from a live mouse; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

2 An aliquot contains a sufficient number of embryos (in one or more vials or straws and based on the transfer success rate of the MMRRC facility) to transfer into one to three recipients. The MMRRC makes no guarantee concerning embryo transfer success experienced in the recipient investigator's laboratory. Neither gender nor genotype ratios are guaranteed.

3 An aliquot is one straw or vial with sufficient sperm to recover at least one litter of mice, as per provided protocols, when performed at the MMRRC facility. The MMRRC makes no guarantee concerning the success of these procedures when performed outside the MMRRC facilities.

4 The distribution fee covers the expense of resuscitating mice from the cryo-archive; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

To request material from the MMRRC: Please fill out our on-line request form (accessible from the catalog search results page, or click the Request this Strain button in the fees section). If you have questions or need assistance completing this form, you may call Customer Service at (800) 910-2291 (in USA or Canada) or (530) 757-5710 (international calls). Before you call, please have with you: the MMRRC item number, quantity needed, Bill-to and Ship-to contact information.