Loading Mouse GIF
Loading...

Strain Name:
C57BL/6J-MtgxR1874Btlr/Mmmh
Stock Number:
039896-MU
Citation ID:
RRID:MMRRC_039896-MU
Other Names:
R1874 (G1), C57BL/6J-MtgxR1874Btlr
Major Collection:

Strain Information

Fga
Name: fibrinogen alpha chain
Synonyms: Fib, ENSMUSG00000059807
Type: Gene
Species: Mouse
Chromosome: 3
NCBI: 14161
HGNC: HGNC:3661
Homologene: 428
Pak1
Name: p21 (RAC1) activated kinase 1
Synonyms: PAK-1, Paka
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 18479
HGNC: HGNC:8590
Homologene: 1936
Bpifb3
Name: BPI fold containing family B, member 3
Synonyms: Rya3
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 378700
Homologene: 18807
Blm
Name: Bloom syndrome, RecQ like helicase
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 12144
HGNC: HGNC:1058
Homologene: 47902
Clasp1
Name: CLIP associating protein 1
Synonyms: 5730583A19Rik, 1700030C23Rik, mCLASP1, CLASP1alpha, CLASP1, B130045P17Rik
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 76707
Homologene: 41024
Bicral
Name: BRD4 interacting chromatin remodeling complex associated protein like
Synonyms: BC032203, Gltscr1l
Type: Gene
Species: Mouse
Chromosome: 17
NCBI: 210982
VEGA: 17
Homologene: 19366
Genetic Alterations
ENU-induced transitions at the following base pair locations (GRCm38):
  • A to T, chromosome 1 at 53,207,233 bp
  • T to C, chromosome 1 at 75,423,906 bp
  • TTCTCTGAGTGGCCACAGCGTCT to TTCT, chromosome 1 at 82,289,853 bp
  • G to T, chromosome 1 at 118,600,585 bp
  • C to A, chromosome 1 at 119,002,049 bp
  • A to G, chromosome 1 at 130,742,691 bp
  • A to C, chromosome 1 at 150,720,695 bp
  • C to T, chromosome 1 at 155,812,639 bp
  • A to T, chromosome 1 at 169,955,993 bp
  • G to A, chromosome 1 at 173,860,367 bp
  • A to C, chromosome 1 at 187,193,915 bp
  • A to G, chromosome 1 at 189,683,816 bp
  • T to A, chromosome 2 at 13,323,002 bp
  • T to C, chromosome 2 at 26,481,579 bp
  • A to T, chromosome 2 at 34,706,021 bp
  • A to C, chromosome 2 at 110,884,872 bp
  • A to G, chromosome 2 at 153,925,840 bp
  • A to G, chromosome 2 at 154,227,202 bp
  • A to G, chromosome 2 at 156,078,382 bp
  • A to G, chromosome 3 at 75,429,347 bp
  • A to T, chromosome 3 at 83,032,721 bp
  • A to T, chromosome 3 at 123,026,116 bp
  • T to C, chromosome 4 at 106,653,716 bp
  • T to A, chromosome 4 at 108,550,725 bp
  • C to A, chromosome 4 at 117,843,150 bp
  • T to A, chromosome 4 at 131,769,755 bp
  • C to G, chromosome 4 at 148,943,211 bp
  • C to T, chromosome 4 at 149,187,632 bp
  • A to G, chromosome 4 at 149,347,971 bp
  • A to G, chromosome 4 at 149,643,741 bp
  • C to A, chromosome 5 at 108,660,595 bp
  • T to A, chromosome 5 at 108,802,418 bp
  • T to C, chromosome 5 at 109,942,553 bp
  • G to A, chromosome 5 at 110,323,664 bp
  • T to C, chromosome 5 at 115,544,990 bp
  • T to A, chromosome 5 at 116,453,506 bp
  • C to T, chromosome 5 at 123,879,265 bp
  • G to A, chromosome 5 at 142,886,223 bp
  • A to G, chromosome 5 at 150,345,921 bp
  • C to T, chromosome 6 at 4,906,348 bp
  • A to T, chromosome 6 at 12,555,435 bp
  • G to A, chromosome 6 at 48,723,515 bp
  • A to T, chromosome 6 at 125,628,372 bp
  • T to G, chromosome 6 at 147,075,190 bp
  • T to C, chromosome 7 at 18,650,816 bp
  • A to G, chromosome 7 at 30,819,414 bp
  • G to A, chromosome 7 at 30,909,051 bp
  • G to T, chromosome 7 at 34,132,483 bp
  • A to G, chromosome 7 at 45,916,564 bp
  • T to A, chromosome 7 at 46,273,695 bp
  • T to A, chromosome 7 at 47,463,994 bp
  • A to T, chromosome 7 at 65,319,253 bp
  • A to G, chromosome 7 at 80,497,418 bp
  • T to C, chromosome 7 at 97,871,580 bp
  • T to C, chromosome 7 at 104,068,129 bp
  • T to C, chromosome 7 at 104,231,902 bp
  • T to C, chromosome 7 at 132,059,834 bp
  • T to A, chromosome 7 at 141,070,526 bp
  • A to G, chromosome 7 at 143,797,844 bp
  • A to G, chromosome 8 at 13,885,112 bp
  • C to A, chromosome 8 at 27,227,563 bp
  • T to A, chromosome 8 at 68,896,619 bp
  • T to A, chromosome 9 at 31,429,087 bp
  • T to A, chromosome 9 at 40,022,855 bp
  • A to G, chromosome 9 at 50,620,945 bp
  • T to C, chromosome 9 at 108,835,838 bp
  • A to T, chromosome 9 at 109,385,111 bp
  • A to G, chromosome 10 at 6,789,035 bp
  • A to G, chromosome 10 at 60,436,818 bp
  • A to G, chromosome 10 at 63,504,107 bp
  • A to T, chromosome 10 at 69,898,083 bp
  • A to G, chromosome 11 at 3,998,231 bp
  • C to A, chromosome 11 at 11,261,495 bp
  • G to T, chromosome 11 at 21,329,048 bp
  • T to G, chromosome 11 at 29,831,136 bp
  • A to G, chromosome 11 at 67,093,179 bp
  • C to T, chromosome 11 at 100,599,313 bp
  • T to C, chromosome 11 at 101,565,794 bp
  • C to T, chromosome 11 at 113,834,956 bp
  • G to C, chromosome 11 at 117,143,767 bp
  • C to T, chromosome 11 at 120,562,166 bp
  • T to C, chromosome 12 at 24,586,156 bp
  • T to A, chromosome 12 at 36,165,931 bp
  • A to T, chromosome 12 at 85,131,074 bp
  • A to G, chromosome 12 at 85,237,513 bp
  • G to T, chromosome 12 at 104,319,699 bp
  • T to A, chromosome 13 at 33,197,963 bp
  • C to T, chromosome 13 at 43,370,791 bp
  • T to C, chromosome 13 at 55,450,273 bp
  • A to G, chromosome 13 at 92,439,556 bp
  • A to G, chromosome 14 at 8,090,145 bp
  • C to T, chromosome 14 at 19,418,824 bp
  • A to T, chromosome 14 at 55,863,493 bp
  • C to A, chromosome 14 at 63,798,296 bp
  • T to A, chromosome 14 at 78,511,866 bp
  • T to C, chromosome 14 at 79,355,743 bp
  • A to T, chromosome 15 at 9,365,351 bp
  • A to G, chromosome 15 at 10,488,006 bp
  • G to A, chromosome 15 at 26,894,998 bp
  • G to A, chromosome 15 at 57,916,110 bp
  • A to G, chromosome 16 at 3,986,848 bp
  • A to G, chromosome 16 at 11,367,681 bp
  • A to G, chromosome 16 at 57,047,084 bp
  • T to A, chromosome 17 at 32,483,324 bp
  • T to C, chromosome 17 at 33,305,453 bp
  • C to G, chromosome 17 at 35,017,112 bp
  • C to T, chromosome 17 at 38,335,969 bp
  • T to A, chromosome 17 at 46,825,178 bp
  • T to A, chromosome 17 at 55,654,805 bp
  • G to C, chromosome 18 at 34,610,474 bp
  • A to G, chromosome 18 at 43,261,316 bp
  • T to A, chromosome 18 at 61,001,398 bp
  • A to G, chromosome 18 at 63,728,504 bp
  • A to G, chromosome 19 at 31,945,774 bp
  • A to T, chromosome 19 at 36,980,583 bp
  • G to T, chromosome 19 at 58,763,389 bp
Genotype Determination
Phenotype
G1 male heterozygous mice are viable and fertile. The G1 mice were not characterized prior to archiving.
Strain GQC Summary
Gene Specific Genotyping:

To request gene-specific and other genotyping services for a strain, please contact the distribution MMRRC Center for more information.

Background Genetic Quality:

The MMRRC has developed a Genetic Quality Control pipeline using the MiniMUGA array to provide additional information to identify and validate genetic backgrounds of MMRRC strains. For more information on whether genetic background data is available, please contact MMRRC_GeneticQC@med.unc.edu. Note: that MiniMUGA genetic background data is not available on all strains, but can be ordered if desired.

Suggested Control Mice
Littermates of all relevant genotypes.
Submitter
Bruce Beutler, M.D., University of Texas Southwestern Medical Center.
Primary Reference
MUTAGENETIX record for R1874 (G1). B. Beutler and colleagues, Center for the Genetics of Host Defense, UT Southwestern, Dallas, TX.
Strain Development
C57BL/6J mice were injected with ENU, resulting in G0 mice that were bred back to C57BL/6J. Sperm was archived from G1 male mice that produced viable G2 mice.


Disclaimer: If MMRRC Strain Genetic Quality Control (GQC; based on MiniMUGA genotyping and analysis) has been completed for this strain, the information might differ from the genetic background information provided by the submitter. MiniMUGA genetic analysis is done on a strain’s tissue samples taken when archived by or ordered from the assigned MMRRC Center.

Colony and Husbandry Information

Colony Surveillance Program and Current Health Reports

Mice recovered from a cryo-archive will have health surveillance performed on recipient females. Health reports will be provided prior to shipment. If you require additional health status information, please email mmrrc@missouri.edu.
Coat Color
Black
MMRRC Breeding System
Random intra-strain mating
Breeding Scheme(s)
When maintaining a live colony, heterozygous mice may be bred together, bred with wild-type siblings, or bred with C57BL/6J inbred mice.
Overall Breeding Performance
Undetermined; during development, mating was done with heterozygous males; viability, fertility and other breeding statistics for heterozygous females and homozygotes are unverified, but presumably would be similar to the C57BL/6J background strain
Average litter size
Undetermined
Recommended wean age
3 weeks

Order Information

Limited quantities of breeder mice (recovered litter) are available from a cryoarchive; recovered litter usually available to ship in 3 to 4 months.

Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

Distribution of this strain requires submission of the MMRRC Conditions of Use (COU). A link to the COU web form will be provided via email after an order has been placed; the form should be completed then or the email forwarded to your institutional official for completion.

The submitter or their institution limits the distribution to non-profit institutions only.

Additional charges may apply for any special requests. Shipping costs are in addition to the basic distribution/resuscitation fees. Information on shipping costs and any additional charges will be provided by the supplying MMRRC facility.

Click button to Request this one strain. (Use the MMRRC Catalog Search to request more than one strain.)
MMRRC Item # Description Distribution Fee / Unit (US $)
*Shipping & Handling not included*
Units Notes
039896-MU-RESUS Litter recovered from cryo-archive $5,475.00 / Non-Profit Litter Recovered litter4; additional fees for any special requests.
Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

Some MMRRC strains were submitted by the submitter as cryopreserved germplasm, and because these strains were not cryopreserved by the MMRRC, we have not assessed the quality, nor genotype, of this material. Our expertise in reviving mice from various qualities of frozen sperm and embryos, using methods like IVF and ICSI, gives us confidence in successful recoveries in most cases. However, due to the uncertain quality of these samples, we'll limit revival attempts to two per order. Additional attempts are available for a fee, on top of standard charges, if requested. It's important to note that some strains may lack the expected mutation, so we can't assure successful order fulfillment until we attempt to revive the strain.

1 The distribution fee covers the expense of rederiving mice from a live mouse; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

2 An aliquot contains a sufficient number of embryos (in one or more vials or straws and based on the transfer success rate of the MMRRC facility) to transfer into one to three recipients. The MMRRC makes no guarantee concerning embryo transfer success experienced in the recipient investigator's laboratory. Neither gender nor genotype ratios are guaranteed.

3 An aliquot is one straw or vial with sufficient sperm to recover at least one litter of mice, as per provided protocols, when performed at the MMRRC facility. The MMRRC makes no guarantee concerning the success of these procedures when performed outside the MMRRC facilities.

4 The distribution fee covers the expense of resuscitating mice from the cryo-archive; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

To request material from the MMRRC: Please fill out our on-line request form (accessible from the catalog search results page, or click the Request this Strain button in the fees section). If you have questions or need assistance completing this form, you may call Customer Service at (800) 910-2291 (in USA or Canada) or (530) 757-5710 (international calls). Before you call, please have with you: the MMRRC item number, quantity needed, Bill-to and Ship-to contact information.