Strain Name:
Stock Number:
Citation ID:
Other Names:
R1921 (G1), C57BL/6J-MtgxR1921Btlr
Major Collection:

Strain Information

Name: attractin
Synonyms: Mgca
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 2
NCBI: 11990
Homologene: 22542
Name: spectrin beta, non-erythrocytic 1
Synonyms: beta fodrin, Spnb-2, spectrin G, brain spectrin, elf3, elf1, 9930031C03Rik, non-erythrocytic, Spnb2
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 11
NCBI: 20742
Homologene: 2354
Name: Ca2+-dependent secretion activator
Synonyms: CAPS1
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 14
NCBI: 27062
VEGA: 14
Homologene: 2755
Name: special AT-rich sequence binding protein 1
Synonyms: 2610306G12Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 17
NCBI: 20230
Homologene: 2232
Name: Fras1 related extracellular matrix protein 2
Synonyms: 8430406N05Rik, 6030440P17Rik, my, ne, b2b1562Clo
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 3
NCBI: 242022
Homologene: 18454
Name: dystonin
Synonyms: bullous pemphigoid antigen 1, BPAG1-n, BPAG1, Bpag1, Bpag, ah, bullous pemphigoid antigen 1, athetoid, Macf2, 2310001O04Rik, nmf203, A830042E19Rik, nmf339
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 1
NCBI: 13518
Homologene: 136716
Name: Rho guanine nucleotide exchange factor (GEF) 10
Synonyms: 6430549H08Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 8
NCBI: 234094
Homologene: 22827
Name: 5'-3' exoribonuclease 1
Synonyms: mXrn1, Dhm2
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 9
NCBI: 24127
Homologene: 5894
Name: low density lipoprotein receptor-related protein 2
Synonyms: Megalin, Gp330, D230004K18Rik, b2b1625.2Clo
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 2
NCBI: 14725
Homologene: 20952
Name: protein kinase, DNA activated, catalytic polypeptide
Synonyms: DNA-PKcs, slip, DNAPDcs, XRCC7, DNA-PK, DOXNPH, dxnph
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 16
NCBI: 19090
Homologene: 5037
Name: VPS35 endosomal protein sorting factor like
Synonyms: 9030624J02Rik, Vsp35l
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 7
NCBI: 71517
Homologene: 10659
Name: shroom family member 3
Synonyms: D5Ertd287e, Shrm, Shrm3
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 5
NCBI: 27428
Homologene: 9263
Name: WD repeat domain 59
Synonyms: 5430401O09Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 8
NCBI: 319481
Homologene: 38685
Name: ubiquitin protein ligase E3 component n-recognin 1
Synonyms: E3 alpha
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 2
NCBI: 22222
Homologene: 7582
Name: transport and golgi organization 6
Synonyms: Tmco7, Tango6
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 8
NCBI: 272538
Homologene: 52121
Name: neural precursor cell expressed, developmentally down-regulated gene 4-like
Synonyms: 1300012C07Rik, Nedd4-2, Nedd4b
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 18
NCBI: 83814
VEGA: 18
Homologene: 86986
Name: taxilin alpha
Synonyms: 2600010N21Rik, Txln, IL14
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 4
NCBI: 109658
Homologene: 14062
Name: treacle ribosome biogenesis factor 1
Synonyms: treacle
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 18
NCBI: 21453
Homologene: 68049
Name: Eph receptor A8
Synonyms: EphA8, Hek3, Eek
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 4
NCBI: 13842
Homologene: 22436
Name: polypyrimidine tract binding protein 1
Synonyms: hnRNP I, Ptb
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 10
NCBI: 19205
Homologene: 49188
Name: leucine rich melanocyte differentiation associated
Synonyms: Oca7, 1700112E06Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 14
NCBI: 76633
Homologene: 49975
Name: NOP56 ribonucleoprotein
Synonyms: NOP56, 56kDa with KKE/D repeat, 2310044F10Rik, Nol5a
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 2
NCBI: 67134
Homologene: 4660
Name: meiosis regulator and mRNA stability 1
Synonyms: 4921513D23Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 16
NCBI: 223989
VEGA: 16
Homologene: 40967
Name: zinc finger protein interacting with K protein 1
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 7
NCBI: 22775
Homologene: 32076
Name: special AT-rich sequence binding protein 2
Synonyms: BAP002
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 1
NCBI: 212712
Homologene: 32249
Name: nuclear receptor subfamily 5, group A, member 1
Synonyms: Ad4BP, SF1, SF-1, Ftz-F1, steroidogenic factor 1, adrenal 4-binding protein, ELP, Ftzf1
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 2
NCBI: 26423
Homologene: 3638
Name: zinc finger protein 219
Synonyms: 2010302A17Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 14
NCBI: 69890
VEGA: 14
Homologene: 9504
Name: F-box and leucine-rich repeat protein 5
Synonyms: Fir4, Fbl4
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 5
NCBI: 242960
Homologene: 8129
Name: integrin binding sialoprotein
Synonyms: BSP, bone sialoprotein, Bsp2, Bsp
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 5
NCBI: 15891
Homologene: 3644
Name: transducin-like enhancer of split 3
Synonyms: Grg3b, Grg3a, ESG, 2610103N05Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 9
NCBI: 21887
Homologene: 21059
Name: sushi domain containing 1
Synonyms: Gm12528
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 4
NCBI: 634731
Homologene: 11204
Name: leucine rich repeat transmembrane neuronal 3
Synonyms: 9630044H04Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 10
NCBI: 216028
Homologene: 37110
Name: suppressor of cytokine signaling 2
Synonyms: SOCS-2, cytokine-inducible SH2 protein 2, STAT-induced STAT inhibitor 2, SSI-2, CIS2, JAB, Cish2, D130043N08Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 10
NCBI: 216233
Homologene: 2880
Name: suppression of tumorigenicity 14 (colon carcinoma)
Synonyms: Prss14, Epithin, MT-SP1, matriptase, Tmprss14
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 9
NCBI: 19143
Homologene: 7906
Name: muskelin 1, intracellular mediator containing kelch motifs
Synonyms: A130067F06Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 6
NCBI: 27418
Homologene: 8305
Name: discoidin, CUB and LCCL domain containing 1
Synonyms: 4631413K11Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 10
NCBI: 66686
Homologene: 12010
Name: terminal uridylyl transferase 1, U6 snRNA-specific
Synonyms: PAPD2, 2700038E08Rik, Rbm21, TUTase6, Tent1
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 19
NCBI: 70044
VEGA: 19
Homologene: 69361
Name: inhibitor of Bruton agammaglobulinemia tyrosine kinase
Synonyms: 5430411K16Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 9
NCBI: 108837
Homologene: 34661
Name: ribosome binding protein 1
Synonyms: mRRp0, ES/130, p180, mRRp1.8, mRRp2, mRRp5.4, mRRp10, mRRp16.8, mRRp15b, mRRp15a, mRRp41, mRRp47, 1700087N07Rik, 5730465C04Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 2
NCBI: 81910
Homologene: 68138
Name: tetratricopeptide repeat domain 7B
Synonyms: Ttc7l1
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 12
NCBI: 104718
VEGA: 12
Homologene: 14675
Name: tubulin, gamma complex associated protein 3
Synonyms: Spc98p, GCP3
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 8
NCBI: 259279
Homologene: 4609
Name: kalirin, RhoGEF kinase
Synonyms: LOC224126, Hapip, 2210407G14Rik, E530005C20Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 16
NCBI: 545156
Homologene: 57160
Name: GIPC PDZ domain containing family, member 3
Synonyms: Gipc3, Rgs19ip3, Ahl5
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 10
NCBI: 209047
Homologene: 77068
Name: discoidin domain receptor family, member 2
Synonyms: Ntrkr3
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 1
NCBI: 18214
Homologene: 68505
Name: ryanodine receptor 1, skeletal muscle
Synonyms: calcium release channel isoform 1, Ryr, skrr
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 7
NCBI: 20190
Homologene: 68069
Name: eukaryotic translation initiation factor 1A domain containing
Synonyms: 2010003J03Rik, Eif1ad1
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 19
NCBI: 69860
VEGA: 19
Homologene: 41860
Name: receptor transporter protein 1
Synonyms: LOC239766, LOC385871
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 16
NCBI: 239766
VEGA: 16
Homologene: 17806
Name: fer-1-like 6 (C. elegans)
Synonyms: EG631797
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 15
NCBI: 631797
Homologene: 53396
Name: fibrous sheath-interacting protein 2
Synonyms: OTTMUSG00000013335
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 2
NCBI: 241516
Homologene: 110349
Name: doublecortin domain containing 5
Synonyms: 4732421G10Rik, EG436559
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 2
NCBI: 329482
Homologene: 79722
Name: dynein regulatory complex subunit 7
Synonyms: LOC330830, SRG-L, Ccdc135
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 8
NCBI: 330830
Homologene: 12996
Name: poly(A)-specific ribonuclease (PARN)-like domain containing 1
Synonyms: LOC240023
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 17
NCBI: 240023
VEGA: 17
Homologene: 15054
Name: DLG associated protein 2
Synonyms: SAP90/PSD-95-associated protein 2, PSD-95/SAP90-binding protein 2, 6430596N04Rik, DAP2, Sapap2
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 8
NCBI: 244310
Homologene: 3484
Name: S100 calcium binding protein A16
Synonyms: 2300002L21Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 3
NCBI: 67860
Homologene: 12201
Name: epithelial cell transforming sequence 2 oncogene-like
Synonyms: Gm10331, C330021H03Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 10
NCBI: 100045792
Homologene: 46005
Name: alpha-2-macroglobulin
Synonyms: A2mp
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 6
NCBI: 232345
Homologene: 37248
Name: ATPase, class VI, type 11B
Synonyms: 1110019I14Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 3
NCBI: 76295
Homologene: 32919
Name: ectonucleoside triphosphate diphosphohydrolase 6
Synonyms: NTPDase-6, Cd39l2, 2700026H11Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 2
NCBI: 12497
Homologene: 68170
Name: aldehyde oxidase 3
Synonyms: AOH1, 1200011D03Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 1
NCBI: 71724
Homologene: 90899
Name: seminal vesicle secretory protein 3B
Synonyms: SVS III, 9530004A22Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 2
NCBI: 329557
Homologene: 110771
Name: neuraminidase 2
Synonyms: brain sialidase, cystolic sialidase, MSS, MBS, MTS
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 1
NCBI: 23956
Homologene: 3927
Name: olfactory receptor family 4 subfamily C member 119
Synonyms: GA_x6K02T2Q125-50635980-50635046, MOR233-15, Olfr1224
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 2
NCBI: 258026
Name: serine/threonine kinase 2
Synonyms: Gm4776
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 1
NCBI: 212225
Name: trace amine-associated receptor 4
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 10
NCBI: 209513
Homologene: 45509
Name: discs large MAGUK scaffold protein 5
Synonyms: 4933429D20Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 14
NCBI: 71228
Homologene: 3486
Name: myosin VC
Synonyms: 9130003O20Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 9
NCBI: 208943
Homologene: 135711
Name: IQ motif and Sec7 domain 1
Synonyms: cI-43, D6Ertd349e, BRAG2
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 6
NCBI: 232227
Homologene: 82429
Name: putative homeodomain transcription factor 1
Synonyms: Phft
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 3
NCBI: 18685
Homologene: 4817
Name: immunoglobulin-like and fibronectin type III domain containing 1
Synonyms: 9830123M21Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 1
NCBI: 226438
Homologene: 130054
Name: cilia and flagella associated protein 45
Synonyms: 1700028D05Rik, Nesg1, Ccdc19
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 1
NCBI: 71870
Homologene: 71837
Name: a disintegrin and metallopeptidase domain 7
Synonyms: EAP1
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 14
NCBI: 11500
Homologene: 2830
Name: transformation related protein 53 regulating kinase B
Synonyms: PRPK, mNori-2p, 4933401B08Rik, Nori-2, 5630401H01Rik, Trp53rk
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 2
NCBI: 76367
Homologene: 6042
Name: synaptotagmin X
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 15
NCBI: 54526
Homologene: 10303
Name: vomeronasal 2, receptor 120
Synonyms: EG224916
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 17
NCBI: 224916
Name: neurofascin
Synonyms: D430023G06Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 1
NCBI: 269116
Homologene: 24945
Name: ATP-binding cassette, sub-family B (MDR/TAP), member 10
Synonyms: ABC-me
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 8
NCBI: 56199
Homologene: 6474
Name: alkB homolog 2, alpha-ketoglutarate-dependent dioxygenase
Synonyms: Abh2, mABH2
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 5
NCBI: 231642
Homologene: 18393
Name: olfactory receptor family 7 subfamily A member 37
Synonyms: GA_x6K02T2QGN0-2842591-2841662, MOR139-2, Olfr1353
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 10
NCBI: 259044
Homologene: 131345
Name: abhydrolase domain containing 2
Synonyms: 2210009N18Rik, LABH2
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 7
NCBI: 54608
Homologene: 23121
Name: RecQ protein-like
Synonyms: RecQ1
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 6
NCBI: 19691
Homologene: 56279
Name: NLR family member X1
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 9
NCBI: 270151
Homologene: 11623
Name: vomeronasal 2, receptor 95
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 17
NCBI: 328759
Homologene: 115024
Name: synaptopodin
Synonyms: 9330140I15Rik, 9030217H17Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 18
NCBI: 104027
Homologene: 5274
Name: periplakin
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 16
NCBI: 19041
VEGA: 16
Homologene: 2026
Name: prostaglandin D receptor
Synonyms: DP
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 14
NCBI: 19214
Homologene: 736
Name: wingless-type MMTV integration site family, member 2
Synonyms: Wnt-2, Irp, Int1l1, m-irp, Mirp, 2610510E18Rik, Wnt2a
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 6
NCBI: 22413
Homologene: 20719
Name: BTB (POZ) domain containing 7
Synonyms: FUP1, 5730507E09Rik, E130118E17Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 12
NCBI: 238386
VEGA: 12
Homologene: 34300
Name: mitochondrial ribosomal protein S28
Synonyms: 1500012D08Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 3
NCBI: 66230
Homologene: 8519
Name: transmembrane protein 45a
Synonyms: C630002M10Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 16
NCBI: 56277
Homologene: 41215
Name: yippee like 1
Synonyms: 0610009L05Rik, mdgl-1, 1700019O22Rik, Dgl1, 4921520K19Rik, 1700016N17Rik, 4930511F14Rik, Ppil2
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 16
NCBI: 106369
Homologene: 50340
Name: SRC kinase signaling inhibitor 1
Synonyms: P140, p140Cap
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 11
NCBI: 56013
Homologene: 10324
Name: EF-hand calcium binding domain 10
Synonyms: 4930504H06Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 12
NCBI: 75040
VEGA: 12
Homologene: 19147
Name: EF-hand calcium binding domain 8
Synonyms: EG329541
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 2
NCBI: 100504221
Name: olfactory receptor family 8 subfamily B member 38
Synonyms: GA_x6K02T2PVTD-31740639-31741568, MOR162-12, Olfr885
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 9
NCBI: 257885
Homologene: 79400
Name: ceramide-1-phosphate transfer protein
Synonyms: Gltpd1
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 4
NCBI: 79554
Homologene: 11550
Name: sterile alpha motif domain containing 11
Synonyms: mr-s
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 4
NCBI: 231004
Homologene: 34983
Name: vomeronasal 1 receptor 125
Synonyms: Gm8519
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 7
NCBI: 667215
Homologene: 104166
Name: predicted gene 10610
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 7
NCBI: 100038384
Name: solute carrier family 25 (mitochondrial carrier ornithine transporter), member 15
Synonyms: Ornt1, D630044L02Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 8
NCBI: 18408
Homologene: 6957
Name: homeobox B1
Synonyms: Hox-2.9
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 11
NCBI: 15407
Homologene: 1615
Genetic Alterations
ENU-induced transitions at the following base pair locations (GRCm38):
  • T to C, chromosome 1 at 34,161,029 bp
  • T to C, chromosome 1 at 46,029,501 bp
  • A to G, chromosome 1 at 56,891,158 bp
  • T to C, chromosome 1 at 58,180,651 bp
  • A to G, chromosome 1 at 87,597,301 bp
  • A to G, chromosome 1 at 132,610,805 bp
  • A to G, chromosome 1 at 135,966,063 bp
  • G to T, chromosome 1 at 170,004,245 bp
  • A to G, chromosome 1 at 172,545,112 bp
  • T to C, chromosome 2 at 38,694,096 bp
  • T to C, chromosome 2 at 69,523,287 bp
  • T to A, chromosome 2 at 82,980,783 bp
  • A to T, chromosome 2 at 82,986,820 bp
  • A to G, chromosome 2 at 89,156,581 bp
  • A to T, chromosome 2 at 106,357,107 bp
  • G to A, chromosome 2 at 120,930,968 bp
  • T to A, chromosome 2 at 130,274,531 bp
  • A to G, chromosome 2 at 130,995,051 bp
  • A to T, chromosome 2 at 143,988,291 bp
  • A to G, chromosome 2 at 150,758,812 bp
  • A to T, chromosome 2 at 153,812,615 bp
  • A to T, chromosome 2 at 164,255,928 bp
  • T to A, chromosome 2 at 166,795,823 bp
  • A to T, chromosome 3 at 8,900,174 bp
  • T to C, chromosome 3 at 35,834,325 bp
  • A to T, chromosome 3 at 53,653,495 bp
  • T to C, chromosome 3 at 90,542,396 bp
  • C to T, chromosome 3 at 103,969,122 bp
  • T to A, chromosome 4 at 59,412,191 bp
  • G to A, chromosome 4 at 129,631,722 bp
  • A to G, chromosome 4 at 136,933,819 bp
  • C to T, chromosome 4 at 155,866,538 bp
  • T to C, chromosome 4 at 156,248,709 bp
  • T to A, chromosome 5 at 43,765,490 bp
  • T to A, chromosome 5 at 92,962,365 bp
  • A to G, chromosome 5 at 104,310,212 bp
  • C to T, chromosome 5 at 114,124,226 bp
  • A to G, chromosome 6 at 18,030,253 bp
  • A to G, chromosome 6 at 31,428,178 bp
  • A to G, chromosome 6 at 90,662,895 bp
  • C to A, chromosome 6 at 121,654,612 bp
  • T to C, chromosome 6 at 142,365,589 bp
  • A to C, chromosome 7 at 10,490,016 bp
  • T to A, chromosome 7 at 21,272,605 bp
  • A to G, chromosome 7 at 29,054,944 bp
  • T to C, chromosome 7 at 79,348,356 bp
  • G to A, chromosome 7 at 83,549,568 bp
  • A to G, chromosome 7 at 118,833,748 bp
  • A to T, chromosome 8 at 12,621,932 bp
  • A to G, chromosome 8 at 14,843,624 bp
  • C to T, chromosome 8 at 14,956,987 bp
  • A to G, chromosome 8 at 22,395,761 bp
  • T to C, chromosome 8 at 95,056,016 bp
  • T to A, chromosome 8 at 106,688,794 bp
  • A to T, chromosome 8 at 111,486,950 bp
  • A to G, chromosome 8 at 123,954,713 bp
  • A to G, chromosome 9 at 31,089,870 bp
  • T to C, chromosome 9 at 38,061,685 bp
  • C to A, chromosome 9 at 44,254,134 bp
  • G to A, chromosome 9 at 61,411,340 bp
  • T to A, chromosome 9 at 75,272,837 bp
  • A to G, chromosome 9 at 85,703,082 bp
  • T to C, chromosome 9 at 95,999,497 bp
  • T to C, chromosome 10 at 18,143,004 bp
  • A to G, chromosome 10 at 23,961,341 bp
  • A to C, chromosome 10 at 52,319,651 bp
  • T to C, chromosome 10 at 64,088,378 bp
  • T to A, chromosome 10 at 78,970,141 bp
  • T to C, chromosome 10 at 79,860,102 bp
  • T to A, chromosome 10 at 81,338,215 bp
  • A to T, chromosome 10 at 95,413,038 bp
  • T to C, chromosome 11 at 30,104,469 bp
  • T to A, chromosome 11 at 96,366,112 bp
  • T to C, chromosome 11 at 97,537,254 bp
  • A to T, chromosome 12 at 33,398,435 bp
  • C to T, chromosome 12 at 100,415,130 bp
  • A to G, chromosome 12 at 102,793,796 bp
  • T to C, chromosome 14 at 12,465,859 bp
  • T to C, chromosome 14 at 22,577,870 bp
  • T to C, chromosome 14 at 24,176,571 bp
  • A to G, chromosome 14 at 44,853,281 bp
  • T to C, chromosome 14 at 52,008,234 bp
  • A to C, chromosome 14 at 68,512,625 bp
  • T to A, chromosome 15 at 58,625,231 bp
  • C to T, chromosome 15 at 89,790,776 bp
  • T to A, chromosome 16 at 5,106,124 bp
  • C to T, chromosome 16 at 14,128,601 bp
  • T to A, chromosome 16 at 15,714,215 bp
  • A to G, chromosome 16 at 17,082,579 bp
  • T to A, chromosome 16 at 23,431,410 bp
  • A to T, chromosome 16 at 34,392,093 bp
  • A to G, chromosome 16 at 56,822,302 bp
  • A to G, chromosome 17 at 12,888,928 bp
  • T to A, chromosome 17 at 18,424,313 bp
  • C to A, chromosome 17 at 51,742,115 bp
  • T to A, chromosome 17 at 57,524,839 bp
  • C to T, chromosome 18 at 60,603,589 bp
  • T to C, chromosome 18 at 60,838,855 bp
  • T to C, chromosome 18 at 65,167,575 bp
  • CGAGGAGGAGGAGGAGGAGG to CGAGGAGGAGGAGGAGG, chromosome 19 at 5,370,058 bp
  • G to A, chromosome 19 at 8,966,102 bp
Genotype Determination
G1 male heterozygous mice are viable and fertile. The G1 mice were not characterized prior to archiving.
Strain Development
C57BL/6J mice were injected with ENU, resulting in G0 mice that were bred back to C57BL/6J. Sperm was archived from G1 male mice that produced viable G2 mice.
Suggested Control Mice
Wild-type littermates or C57BL/6J mice
MMRRC Genetic QC Summary
The MMRRC Centers have developed a genetic QC pipeline using MiniMUGA array genotyping to provide additional information on strain backgrounds for MMRRC congenic and inbred strains. For more information on when data may be available, or to request genotyping for a strain of interest, please contact Older strains may not have this information.
Bruce Beutler, M.D., University of Texas Southwestern Medical Center.
Primary Reference
MUTAGENETIX record for R1921 (G1). B. Beutler and colleagues, Center for the Genetics of Host Defense, UT Southwestern, Dallas, TX.

Colony and Husbandry Information

Colony Surveillance Program and Current Health Reports

Mice recovered from a cryo-archive will have health surveillance performed on recipient females. Health reports will be provided prior to shipment. If you require additional health status information, please email .
Coat Color
MMRRC Breeding System
Random intra-strain mating
Breeding Scheme(s)
When maintaining a live colony, heterozygous mice may be bred together, bred with wild-type siblings, or bred with C57BL/6J inbred mice.
Overall Breeding Performance
Undetermined; during development, mating was done with heterozygous males; viability, fertility and other breeding statistics for heterozygous females and homozygotes are unverified, but presumably would be similar to the C57BL/6J background strain
Average litter size
Recommended wean age
3 weeks

Order Request Information

Limited quantities of breeder mice (recovered litter) are available from a cryoarchive; recovered litter usually available to ship in 3 to 4 months.

Cryopreserved material may be available upon request, please inquire to for more information.

Distribution of this strain requires submission of the MMRRC Conditions of Use (COU). A link to the COU web form will be provided via email after an order has been placed; the form should be completed then or the email forwarded to your institutional official for completion.

The donor or their institution limits the distribution to non-profit institutions only.

Additional charges may apply for any special requests. Shipping costs are in addition to the basic distribution/resuscitation fees. Information on shipping costs and any additional charges will be provided by the supplying MMRRC facility.

Click button to Request this one strain. (Use the MMRRC Catalog Search to request more than one strain.)
MMRRC Item # Description Distribution Fee / Unit (US $)
*Shipping & Handling not included*
Units Notes
039939-MU-RESUS Litter recovered from cryo-archive $5,475.00 / Non-Profit Litter Recovered litter4; additional fees for any special requests.
Cryopreserved material may be available upon request, please inquire to for more information.

Some MMRRC strains were submitted by the donor as cryopreserved germplasm, and because these strains were not cryopreserved by the MMRRC, we have not assessed the quality of this material. We have extensive experience with recovery of mice from cryopreserved sperm and embryos of varying quality, including using techniques such as IVF and ICSI, and are confident that we will have success in most, if not all, cases. However, because of the unknown quality of these frozen samples, we will restrict recovery efforts to two attempts for each order. Subsequent attempts can be performed on a fee-for-service basis, in addition to the standard fees, upon request.

1 The distribution fee covers the expense of rederiving mice from a live mouse; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

2 An aliquot contains a sufficient number of embryos (in one or more vials or straws and based on the transfer success rate of the MMRRC facility) to transfer into one to three recipients. The MMRRC makes no guarantee concerning embryo transfer success experienced in the recipient investigator's laboratory. Neither gender nor genotype ratios are guaranteed.

3 An aliquot is one straw or vial with sufficient sperm to recover at least one litter of mice, as per provided protocols, when performed at the MMRRC facility. The MMRRC makes no guarantee concerning the success of these procedures when performed outside the MMRRC facilities.

4 The distribution fee covers the expense of resuscitating mice from the cryo-archive; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

To request material from the MMRRC: Please fill out our on-line request form (accessible from the catalog search results page, or click the Request this Strain button in the fees section). If you have questions or need assistance completing this form, you may call Customer Service at (800) 910-2291 (in USA or Canada) or (530) 757-5710 (international calls). Before you call, please have with you: the MMRRC item number, quantity needed, Bill-to and Ship-to contact information.