Loading Mouse GIF
Loading...

Strain Name:
C57BL/6J-MtgxR1921Btlr/Mmmh
Stock Number:
039939-MU
Citation ID:
RRID:MMRRC_039939-MU
Other Names:
R1921 (G1), C57BL/6J-MtgxR1921Btlr
Major Collection:

Strain Information

Atrn
Name: attractin
Synonyms: Mgca
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 11990
HGNC: HGNC:885
Homologene: 22542
Sptbn1
Name: spectrin beta, non-erythrocytic 1
Synonyms: beta fodrin, Spnb-2, spectrin G, brain spectrin, elf3, elf1, 9930031C03Rik, non-erythrocytic, Spnb2
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 20742
Homologene: 2354
Cadps
Name: Ca2+-dependent secretion activator
Synonyms: CAPS1
Type: Gene
Species: Mouse
Chromosome: 14
NCBI: 27062
VEGA: 14
HGNC: HGNC:1426
Homologene: 2755
Satb1
Name: special AT-rich sequence binding protein 1
Synonyms: 2610306G12Rik
Type: Gene
Species: Mouse
Chromosome: 17
NCBI: 20230
Homologene: 2232
Frem2
Name: Fras1 related extracellular matrix protein 2
Synonyms: 8430406N05Rik, 6030440P17Rik, my, ne, b2b1562Clo
Type: Gene
Species: Mouse
Chromosome: 3
NCBI: 242022
Homologene: 18454
Dst
Name: dystonin
Synonyms: bullous pemphigoid antigen 1, BPAG1-n, BPAG1, Bpag1, Bpag, ah, bullous pemphigoid antigen 1, athetoid, Macf2, 2310001O04Rik, nmf203, A830042E19Rik, nmf339
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 13518
HGNC: HGNC:1090
Homologene: 136716
Arhgef10
Name: Rho guanine nucleotide exchange factor 10
Synonyms: 6430549H08Rik
Type: Gene
Species: Mouse
Chromosome: 8
NCBI: 234094
Homologene: 22827
Genetic Alterations
ENU-induced transitions at the following base pair locations (GRCm38):
  • T to C, chromosome 1 at 34,161,029 bp
  • T to C, chromosome 1 at 46,029,501 bp
  • A to G, chromosome 1 at 56,891,158 bp
  • T to C, chromosome 1 at 58,180,651 bp
  • A to G, chromosome 1 at 87,597,301 bp
  • A to G, chromosome 1 at 132,610,805 bp
  • A to G, chromosome 1 at 135,966,063 bp
  • G to T, chromosome 1 at 170,004,245 bp
  • A to G, chromosome 1 at 172,545,112 bp
  • T to C, chromosome 2 at 38,694,096 bp
  • T to C, chromosome 2 at 69,523,287 bp
  • T to A, chromosome 2 at 82,980,783 bp
  • A to T, chromosome 2 at 82,986,820 bp
  • A to G, chromosome 2 at 89,156,581 bp
  • A to T, chromosome 2 at 106,357,107 bp
  • G to A, chromosome 2 at 120,930,968 bp
  • T to A, chromosome 2 at 130,274,531 bp
  • A to G, chromosome 2 at 130,995,051 bp
  • A to T, chromosome 2 at 143,988,291 bp
  • A to G, chromosome 2 at 150,758,812 bp
  • A to T, chromosome 2 at 153,812,615 bp
  • A to T, chromosome 2 at 164,255,928 bp
  • T to A, chromosome 2 at 166,795,823 bp
  • A to T, chromosome 3 at 8,900,174 bp
  • T to C, chromosome 3 at 35,834,325 bp
  • A to T, chromosome 3 at 53,653,495 bp
  • T to C, chromosome 3 at 90,542,396 bp
  • C to T, chromosome 3 at 103,969,122 bp
  • T to A, chromosome 4 at 59,412,191 bp
  • G to A, chromosome 4 at 129,631,722 bp
  • A to G, chromosome 4 at 136,933,819 bp
  • C to T, chromosome 4 at 155,866,538 bp
  • T to C, chromosome 4 at 156,248,709 bp
  • T to A, chromosome 5 at 43,765,490 bp
  • T to A, chromosome 5 at 92,962,365 bp
  • A to G, chromosome 5 at 104,310,212 bp
  • C to T, chromosome 5 at 114,124,226 bp
  • A to G, chromosome 6 at 18,030,253 bp
  • A to G, chromosome 6 at 31,428,178 bp
  • A to G, chromosome 6 at 90,662,895 bp
  • C to A, chromosome 6 at 121,654,612 bp
  • T to C, chromosome 6 at 142,365,589 bp
  • A to C, chromosome 7 at 10,490,016 bp
  • T to A, chromosome 7 at 21,272,605 bp
  • A to G, chromosome 7 at 29,054,944 bp
  • T to C, chromosome 7 at 79,348,356 bp
  • G to A, chromosome 7 at 83,549,568 bp
  • A to G, chromosome 7 at 118,833,748 bp
  • A to T, chromosome 8 at 12,621,932 bp
  • A to G, chromosome 8 at 14,843,624 bp
  • C to T, chromosome 8 at 14,956,987 bp
  • A to G, chromosome 8 at 22,395,761 bp
  • T to C, chromosome 8 at 95,056,016 bp
  • T to A, chromosome 8 at 106,688,794 bp
  • A to T, chromosome 8 at 111,486,950 bp
  • A to G, chromosome 8 at 123,954,713 bp
  • A to G, chromosome 9 at 31,089,870 bp
  • T to C, chromosome 9 at 38,061,685 bp
  • C to A, chromosome 9 at 44,254,134 bp
  • G to A, chromosome 9 at 61,411,340 bp
  • T to A, chromosome 9 at 75,272,837 bp
  • A to G, chromosome 9 at 85,703,082 bp
  • T to C, chromosome 9 at 95,999,497 bp
  • T to C, chromosome 10 at 18,143,004 bp
  • A to G, chromosome 10 at 23,961,341 bp
  • A to C, chromosome 10 at 52,319,651 bp
  • T to C, chromosome 10 at 64,088,378 bp
  • T to A, chromosome 10 at 78,970,141 bp
  • T to C, chromosome 10 at 79,860,102 bp
  • T to A, chromosome 10 at 81,338,215 bp
  • A to T, chromosome 10 at 95,413,038 bp
  • T to C, chromosome 11 at 30,104,469 bp
  • T to A, chromosome 11 at 96,366,112 bp
  • T to C, chromosome 11 at 97,537,254 bp
  • A to T, chromosome 12 at 33,398,435 bp
  • C to T, chromosome 12 at 100,415,130 bp
  • A to G, chromosome 12 at 102,793,796 bp
  • T to C, chromosome 14 at 12,465,859 bp
  • T to C, chromosome 14 at 22,577,870 bp
  • T to C, chromosome 14 at 24,176,571 bp
  • A to G, chromosome 14 at 44,853,281 bp
  • T to C, chromosome 14 at 52,008,234 bp
  • A to C, chromosome 14 at 68,512,625 bp
  • T to A, chromosome 15 at 58,625,231 bp
  • C to T, chromosome 15 at 89,790,776 bp
  • T to A, chromosome 16 at 5,106,124 bp
  • C to T, chromosome 16 at 14,128,601 bp
  • T to A, chromosome 16 at 15,714,215 bp
  • A to G, chromosome 16 at 17,082,579 bp
  • T to A, chromosome 16 at 23,431,410 bp
  • A to T, chromosome 16 at 34,392,093 bp
  • A to G, chromosome 16 at 56,822,302 bp
  • A to G, chromosome 17 at 12,888,928 bp
  • T to A, chromosome 17 at 18,424,313 bp
  • C to A, chromosome 17 at 51,742,115 bp
  • T to A, chromosome 17 at 57,524,839 bp
  • C to T, chromosome 18 at 60,603,589 bp
  • T to C, chromosome 18 at 60,838,855 bp
  • T to C, chromosome 18 at 65,167,575 bp
  • CGAGGAGGAGGAGGAGGAGG to CGAGGAGGAGGAGGAGG, chromosome 19 at 5,370,058 bp
  • G to A, chromosome 19 at 8,966,102 bp
Genotype Determination
Phenotype
G1 male heterozygous mice are viable and fertile. The G1 mice were not characterized prior to archiving.
Strain GQC Summary
Gene Specific Genotyping:

To request gene-specific and other genotyping services for a strain, please contact the distribution MMRRC Center for more information.

Background Genetic Quality:

The MMRRC has developed a Genetic Quality Control pipeline using the MiniMUGA array to provide additional information to identify and validate genetic backgrounds of MMRRC strains. For more information on whether genetic background data is available, please contact MMRRC_GeneticQC@med.unc.edu. Note: that MiniMUGA genetic background data is not available on all strains, but can be ordered if desired.

Suggested Control Mice
Littermates of all relevant genotypes.
Submitter
Bruce Beutler, M.D., University of Texas Southwestern Medical Center.
Primary Reference
MUTAGENETIX record for R1921 (G1). B. Beutler and colleagues, Center for the Genetics of Host Defense, UT Southwestern, Dallas, TX.
Strain Development
C57BL/6J mice were injected with ENU, resulting in G0 mice that were bred back to C57BL/6J. Sperm was archived from G1 male mice that produced viable G2 mice.


Disclaimer: If MMRRC Strain Genetic Quality Control (GQC; based on MiniMUGA genotyping and analysis) has been completed for this strain, the information might differ from the genetic background information provided by the submitter. MiniMUGA genetic analysis is done on a strain’s tissue samples taken when archived by or ordered from the assigned MMRRC Center.

Colony and Husbandry Information

Colony Surveillance Program and Current Health Reports

Mice recovered from a cryo-archive will have health surveillance performed on recipient females. Health reports will be provided prior to shipment. If you require additional health status information, please email mmrrc@missouri.edu.
Coat Color
Black
MMRRC Breeding System
Random intra-strain mating
Breeding Scheme(s)
When maintaining a live colony, heterozygous mice may be bred together, bred with wild-type siblings, or bred with C57BL/6J inbred mice.
Overall Breeding Performance
Undetermined; during development, mating was done with heterozygous males; viability, fertility and other breeding statistics for heterozygous females and homozygotes are unverified, but presumably would be similar to the C57BL/6J background strain
Average litter size
Undetermined
Recommended wean age
3 weeks

Order Information

Limited quantities of breeder mice (recovered litter) are available from a cryoarchive; recovered litter usually available to ship in 3 to 4 months.

Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

Distribution of this strain requires submission of the MMRRC Conditions of Use (COU). A link to the COU web form will be provided via email after an order has been placed; the form should be completed then or the email forwarded to your institutional official for completion.

The submitter or their institution limits the distribution to non-profit institutions only.

Additional charges may apply for any special requests. Shipping costs are in addition to the basic distribution/resuscitation fees. Information on shipping costs and any additional charges will be provided by the supplying MMRRC facility.

Click button to Request this one strain. (Use the MMRRC Catalog Search to request more than one strain.)
MMRRC Item # Description Distribution Fee / Unit (US $)
*Shipping & Handling not included*
Units Notes
039939-MU-RESUS Litter recovered from cryo-archive $5,475.00 / Non-Profit Litter Recovered litter4; additional fees for any special requests.
Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

Some MMRRC strains were submitted by the submitter as cryopreserved germplasm, and because these strains were not cryopreserved by the MMRRC, we have not assessed the quality, nor genotype, of this material. Our expertise in reviving mice from various qualities of frozen sperm and embryos, using methods like IVF and ICSI, gives us confidence in successful recoveries in most cases. However, due to the uncertain quality of these samples, we'll limit revival attempts to two per order. Additional attempts are available for a fee, on top of standard charges, if requested. It's important to note that some strains may lack the expected mutation, so we can't assure successful order fulfillment until we attempt to revive the strain.

1 The distribution fee covers the expense of rederiving mice from a live mouse; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

2 An aliquot contains a sufficient number of embryos (in one or more vials or straws and based on the transfer success rate of the MMRRC facility) to transfer into one to three recipients. The MMRRC makes no guarantee concerning embryo transfer success experienced in the recipient investigator's laboratory. Neither gender nor genotype ratios are guaranteed.

3 An aliquot is one straw or vial with sufficient sperm to recover at least one litter of mice, as per provided protocols, when performed at the MMRRC facility. The MMRRC makes no guarantee concerning the success of these procedures when performed outside the MMRRC facilities.

4 The distribution fee covers the expense of resuscitating mice from the cryo-archive; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

To request material from the MMRRC: Please fill out our on-line request form (accessible from the catalog search results page, or click the Request this Strain button in the fees section). If you have questions or need assistance completing this form, you may call Customer Service at (800) 910-2291 (in USA or Canada) or (530) 757-5710 (international calls). Before you call, please have with you: the MMRRC item number, quantity needed, Bill-to and Ship-to contact information.