Loading Mouse GIF
Loading...

Strain Name:
C57BL/6J-MtgxR1933Btlr/Mmmh
Stock Number:
039951-MU
Citation ID:
RRID:MMRRC_039951-MU
Other Names:
R1933 (G1), C57BL/6J-MtgxR1933Btlr
Major Collection:

Strain Information

Arhgef7
Name: Rho guanine nucleotide exchange factor
Synonyms: Cool, PIX, Pak interacting exchange factor, p85SPR, betaPix-c, betaPix-b, cool-1, betaPix
Type: Gene
Species: Mouse
Chromosome: 8
NCBI: 54126
Homologene: 2895
Il21r
Name: interleukin 21 receptor
Synonyms: NILR
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 60504
HGNC: HGNC:6006
Homologene: 11040
Foxp1
Name: forkhead box P1
Synonyms: 4932443N09Rik, 3110052D19Rik
Type: Gene
Species: Mouse
Chromosome: 6
NCBI: 108655
HGNC: HGNC:3823
Homologene: 13092
Adra2a
Name: adrenergic receptor, alpha 2a
Synonyms: alpha2A, alpha2A-adrenergic receptor, Adra-2a, Adra-2, alpha2A-AR, alpha(2A)AR
Type: Gene
Species: Mouse
Chromosome: 19
NCBI: 11551
VEGA: 19
HGNC: HGNC:281
Homologene: 47944
Slc25a13
Name: solute carrier family 25 (mitochondrial carrier, adenine nucleotide translocator), member 13
Synonyms: Ctrn, citrin
Type: Gene
Species: Mouse
Chromosome: 6
NCBI: 50799
Homologene: 22800
Ttc39b
Name: tetratricopeptide repeat domain 39B
Synonyms: 9130422G05Rik, 1810054D07Rik
Type: Gene
Species: Mouse
Chromosome: 4
NCBI: 69863
Homologene: 25228
Genetic Alterations
ENU-induced transitions at the following base pair locations (GRCm38):
  • T to C, chromosome 1 at 33,777,822 bp
  • A to G, chromosome 1 at 106,876,121 bp
  • A to T, chromosome 1 at 161,151,300 bp
  • A to T, chromosome 2 at 17,375,292 bp
  • T to G, chromosome 2 at 70,587,392 bp
  • T to A, chromosome 2 at 87,135,844 bp
  • G to A, chromosome 2 at 101,901,031 bp
  • T to A, chromosome 2 at 120,698,656 bp
  • C to T, chromosome 3 at 37,232,486 bp
  • T to A, chromosome 3 at 103,056,481 bp
  • A to T, chromosome 4 at 59,351,695 bp
  • G to A, chromosome 4 at 63,415,639 bp
  • A to G, chromosome 4 at 83,232,720 bp
  • T to A, chromosome 4 at 123,048,888 bp
  • A to G, chromosome 4 at 129,317,849 bp
  • T to C, chromosome 4 at 152,435,866 bp
  • GCTCT to GCTCTCT, chromosome 4 at 156,166,519 bp
  • T to C, chromosome 5 at 29,619,659 bp
  • G to T, chromosome 5 at 30,114,862 bp
  • T to G, chromosome 5 at 64,925,438 bp
  • A to T, chromosome 5 at 131,487,880 bp
  • C to T, chromosome 6 at 6,109,262 bp
  • T to A, chromosome 6 at 58,307,420 bp
  • A to T, chromosome 6 at 77,244,966 bp
  • G to T, chromosome 6 at 82,930,927 bp
  • T to A, chromosome 6 at 88,093,859 bp
  • C to T, chromosome 6 at 88,849,605 bp
  • TTGCTGCTGCTGCTGCTGCTGCTGTTGCTGCTGCTGCTGTTGCTGCTGCTG to TTGCTGCTGCTGCTGCTGCTGTTGCTGCTGCTGCTGTTGCTGCTGCTG, chromosome 6 at 99,075,965 bp
  • G to A, chromosome 6 at 124,861,447 bp
  • T to A, chromosome 6 at 129,054,245 bp
  • T to A, chromosome 6 at 130,065,244 bp
  • T to A, chromosome 7 at 15,868,376 bp
  • C to T, chromosome 7 at 44,615,348 bp
  • C to T, chromosome 7 at 82,763,117 bp
  • A to G, chromosome 7 at 96,895,326 bp
  • T to G, chromosome 7 at 101,779,211 bp
  • G to T, chromosome 7 at 103,929,130 bp
  • A to C, chromosome 7 at 108,565,523 bp
  • C to T, chromosome 7 at 125,628,981 bp
  • T to A, chromosome 7 at 126,827,672 bp
  • C to A, chromosome 7 at 127,750,929 bp
  • T to C, chromosome 7 at 127,886,262 bp
  • C to A, chromosome 8 at 11,808,712 bp
  • C to A, chromosome 8 at 11,808,713 bp
  • A to T, chromosome 8 at 40,754,885 bp
  • A to G, chromosome 8 at 45,943,250 bp
  • G to T, chromosome 8 at 55,940,907 bp
  • G to A, chromosome 8 at 66,512,347 bp
  • A to G, chromosome 8 at 70,056,575 bp
  • A to G, chromosome 8 at 80,612,890 bp
  • A to G, chromosome 8 at 81,902,888 bp
  • T to C, chromosome 8 at 84,861,151 bp
  • A to G, chromosome 8 at 104,617,963 bp
  • G to A, chromosome 8 at 104,619,063 bp
  • T to C, chromosome 8 at 107,044,558 bp
  • G to A, chromosome 9 at 8,656,545 bp
  • C to T, chromosome 9 at 21,959,859 bp
  • A to T, chromosome 9 at 24,434,387 bp
  • G to A, chromosome 9 at 31,106,212 bp
  • G to T, chromosome 9 at 89,953,913 bp
  • A to G, chromosome 9 at 108,116,444 bp
  • A to T, chromosome 9 at 109,481,650 bp
  • T to A, chromosome 9 at 119,609,998 bp
  • G to A, chromosome 9 at 123,500,241 bp
  • A to G, chromosome 10 at 64,088,513 bp
  • A to G, chromosome 10 at 121,593,661 bp
  • G to T, chromosome 10 at 121,925,903 bp
  • G to T, chromosome 11 at 53,680,061 bp
  • G to T, chromosome 11 at 67,177,464 bp
  • G to C, chromosome 11 at 67,252,168 bp
  • A to T, chromosome 11 at 115,000,859 bp
  • T to A, chromosome 12 at 70,984,694 bp
  • C to G, chromosome 12 at 75,469,567 bp
  • T to A, chromosome 12 at 75,931,163 bp
  • T to C, chromosome 12 at 83,955,856 bp
  • A to T, chromosome 13 at 12,230,930 bp
  • T to C, chromosome 13 at 64,920,610 bp
  • C to A, chromosome 13 at 94,789,011 bp
  • A to T, chromosome 14 at 6,022,475 bp
  • T to A, chromosome 14 at 26,734,495 bp
  • C to T, chromosome 14 at 28,511,845 bp
  • T to C, chromosome 14 at 33,133,344 bp
  • T to C, chromosome 14 at 46,830,289 bp
  • T to C, chromosome 14 at 55,075,238 bp
  • C to T, chromosome 14 at 61,232,412 bp
  • G to T, chromosome 15 at 31,591,008 bp
  • T to A, chromosome 15 at 39,138,088 bp
  • A to T, chromosome 15 at 44,540,884 bp
  • A to G, chromosome 16 at 4,492,350 bp
  • T to C, chromosome 16 at 10,688,539 bp
  • A to G, chromosome 16 at 96,593,214 bp
  • T to A, chromosome 17 at 6,733,046 bp
  • T to A, chromosome 17 at 25,787,070 bp
  • A to G, chromosome 17 at 86,102,893 bp
  • A to G, chromosome 18 at 25,486,976 bp
  • A to T, chromosome 19 at 12,462,647 bp
  • T to A, chromosome 19 at 36,972,957 bp
  • T to A, chromosome 19 at 54,046,406 bp
  • C to A, chromosome X at 163,549,141 bp
Genotype Determination
Phenotype
G1 male heterozygous mice are viable and fertile. The G1 mice were not characterized prior to archiving.
Strain GQC Summary
Gene Specific Genotyping:

To request gene-specific and other genotyping services for a strain, please contact the distribution MMRRC Center for more information.

Background Genetic Quality:

The MMRRC has developed a Genetic Quality Control pipeline using the MiniMUGA array to provide additional information to identify and validate genetic backgrounds of MMRRC strains. For more information on whether genetic background data is available, please contact MMRRC_GeneticQC@med.unc.edu. Note: that MiniMUGA genetic background data is not available on all strains, but can be ordered if desired.

Suggested Control Mice
Littermates of all relevant genotypes.
Donor
Bruce Beutler, M.D., University of Texas Southwestern Medical Center.
Primary Reference
MUTAGENETIX record for R1933 (G1). B. Beutler and colleagues, Center for the Genetics of Host Defense, UT Southwestern, Dallas, TX.
Strain Development
C57BL/6J mice were injected with ENU, resulting in G0 mice that were bred back to C57BL/6J. Sperm was archived from G1 male mice that produced viable G2 mice.


Disclaimer: If MMRRC Strain Genetic Quality Control (GQC; based on MiniMUGA genotyping and analysis) has been completed for this strain, the information might differ from the genetic background information provided by the submitter. MiniMUGA genetic analysis is done on a strain’s tissue samples taken when archived by or ordered from the assigned MMRRC Center.

Colony and Husbandry Information

Colony Surveillance Program and Current Health Reports

Mice recovered from a cryo-archive will have health surveillance performed on recipient females. Health reports will be provided prior to shipment. If you require additional health status information, please email mmrrc@missouri.edu.
Coat Color
Black
MMRRC Breeding System
Random intra-strain mating
Breeding Scheme(s)
When maintaining a live colony, heterozygous mice may be bred together, bred with wild-type siblings, or bred with C57BL/6J inbred mice.
Overall Breeding Performance
Undetermined; during development, mating was done with heterozygous males; viability, fertility and other breeding statistics for heterozygous females and homozygotes are unverified, but presumably would be similar to the C57BL/6J background strain
Average litter size
Undetermined
Recommended wean age
3 weeks

Order Information

Limited quantities of breeder mice (recovered litter) are available from a cryoarchive; recovered litter usually available to ship in 3 to 4 months.

Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

Distribution of this strain requires submission of the MMRRC Conditions of Use (COU). A link to the COU web form will be provided via email after an order has been placed; the form should be completed then or the email forwarded to your institutional official for completion.

The submitter or their institution limits the distribution to non-profit institutions only.

Additional charges may apply for any special requests. Shipping costs are in addition to the basic distribution/resuscitation fees. Information on shipping costs and any additional charges will be provided by the supplying MMRRC facility.

Click button to Request this one strain. (Use the MMRRC Catalog Search to request more than one strain.)
MMRRC Item # Description Distribution Fee / Unit (US $)
*Shipping & Handling not included*
Units Notes
039951-MU-RESUS Litter recovered from cryo-archive $5,475.00 / Non-Profit Litter Recovered litter4; additional fees for any special requests.
Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

Some MMRRC strains were submitted by the donor as cryopreserved germplasm, and because these strains were not cryopreserved by the MMRRC, we have not assessed the quality, nor genotype, of this material. Our expertise in reviving mice from various qualities of frozen sperm and embryos, using methods like IVF and ICSI, gives us confidence in successful recoveries in most cases. However, due to the uncertain quality of these samples, we'll limit revival attempts to two per order. Additional attempts are available for a fee, on top of standard charges, if requested. It's important to note that some strains may lack the expected mutation, so we can't assure successful order fulfillment until we attempt to revive the strain.

1 The distribution fee covers the expense of rederiving mice from a live mouse; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

2 An aliquot contains a sufficient number of embryos (in one or more vials or straws and based on the transfer success rate of the MMRRC facility) to transfer into one to three recipients. The MMRRC makes no guarantee concerning embryo transfer success experienced in the recipient investigator's laboratory. Neither gender nor genotype ratios are guaranteed.

3 An aliquot is one straw or vial with sufficient sperm to recover at least one litter of mice, as per provided protocols, when performed at the MMRRC facility. The MMRRC makes no guarantee concerning the success of these procedures when performed outside the MMRRC facilities.

4 The distribution fee covers the expense of resuscitating mice from the cryo-archive; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

To request material from the MMRRC: Please fill out our on-line request form (accessible from the catalog search results page, or click the Request this Strain button in the fees section). If you have questions or need assistance completing this form, you may call Customer Service at (800) 910-2291 (in USA or Canada) or (530) 757-5710 (international calls). Before you call, please have with you: the MMRRC item number, quantity needed, Bill-to and Ship-to contact information.