Strain Name:
C57BL/6J-MtgxR1933Btlr/Mmmh
Stock Number:
039951-MU
Citation ID:
RRID:MMRRC_039951-MU
Other Names:
R1933 (G1), C57BL/6J-MtgxR1933Btlr
Major Collection:

Gene Information

Arhgef7
Name: Rho guanine nucleotide exchange factor (GEF7)
Synonyms: Cool, p85SPR, Pak interacting exchange factor, PIX, betaPix-b, betaPix-c, cool-1, betaPix
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 8
NCBI: 54126
Homologene: 2895
Il21r
Name: interleukin 21 receptor
Synonyms: NILR
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 7
NCBI: 60504
HGNC: HGNC:6006
Homologene: 11040
Il21
Name: interleukin 21
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 3
NCBI: 60505
HGNC: HGNC:6005
Homologene: 11032
Foxp1
Name: forkhead box P1
Synonyms: 4932443N09Rik, 3110052D19Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 6
NCBI: 108655
HGNC: HGNC:3823
Homologene: 13092
Adra2a
Name: adrenergic receptor, alpha 2a
Synonyms: alpha2A-adrenergic receptor, Adra-2, alpha(2A)AR, Adra-2a, alpha2A, alpha2A-AR
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 19
NCBI: 11551
VEGA: 19
HGNC: HGNC:281
Homologene: 47944
Slc25a13
Name: solute carrier family 25 (mitochondrial carrier, adenine nucleotide translocator), member 13
Synonyms: citrin, Ctrn
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 6
NCBI: 50799
Homologene: 22800
Ttc39b
Name: tetratricopeptide repeat domain 39B
Synonyms: 9130422G05Rik, 1810054D07Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 4
NCBI: 69863
Homologene: 25228
Ube3c
Name: ubiquitin protein ligase E3C
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 5
NCBI: 100763
Homologene: 8783
Btaf1
Name: B-TFIID TATA-box binding protein associated factor 1
Synonyms: E430027O22Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 19
NCBI: 107182
Homologene: 31978
Agrn
Name: agrin
Synonyms: NMF380, Agrin, nmf380
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 4
NCBI: 11603
HGNC: HGNC:329
Homologene: 27907
Ppp2r5e
Name: protein phosphatase 2, regulatory subunit B', epsilon
Synonyms: protein phosphatase 2A subunit beta, 4633401M22Rik, B56beta
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 12
NCBI: 26932
VEGA: 12
HGNC: HGNC:9313
Homologene: 55962
Srbd1
Name: S1 RNA binding domain 1
Synonyms: D530025C17Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 17
NCBI: 78586
VEGA: 17
Homologene: 9994
Trit1
Name: tRNA isopentenyltransferase 1
Synonyms: 2310075G14Rik, MOD5
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 4
NCBI: 66966
Homologene: 7010
Csde1
Name: cold shock domain containing E1, RNA binding
Synonyms: unr, D3Jfr1
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 3
NCBI: 229663
Homologene: 5179
Rbbp4
Name: retinoblastoma binding protein 4, chromatin remodeling factor
Synonyms: CAF-1 p48 subunit, RBAP48
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 4
NCBI: 19646
HGNC: HGNC:9887
Homologene: 21153
Psma3
Name: proteasome subunit alpha 3
Synonyms: Lmpc8
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 12
NCBI: 19167
HGNC: HGNC:9532
Homologene: 2082
Rad50
Name: RAD50 double strand break repair protein
Synonyms: Mrell, Rad50l
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 11
NCBI: 19360
HGNC: HGNC:9816
Homologene: 38092
Clec16a
Name: C-type lectin domain family 16, member A
Synonyms: curt, 4932416N17Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 16
NCBI: 74374
Homologene: 71019
Dcaf13
Name: DDB1 and CUL4 associated factor 13
Synonyms: Wdsof1, LOC223499
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 15
NCBI: 223499
Homologene: 6430
Clpb
Name: ClpB caseinolytic peptidase B
Synonyms: Skd3
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 7
NCBI: 20480
Homologene: 32067
Commd9
Name: COMM domain containing 9
Synonyms: 1810029F08Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 2
NCBI: 76501
Homologene: 8584
Myh14
Name: myosin, heavy polypeptide 14
Synonyms: 2400004E04Rik, NMHC II-C
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 7
NCBI: 71960
Homologene: 23480
Scn10a
Name: sodium channel, voltage-gated, type X, alpha
Synonyms: Nav1.8
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 9
NCBI: 20264
VEGA: 9
Homologene: 21300
Podxl2
Name: podocalyxin-like 2
Synonyms: D130074J02Rik, Endoglycan, PODLX2
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 6
NCBI: 319655
Homologene: 9254
Xpot
Name: exportin, tRNA (nuclear export receptor for tRNAs)
Synonyms: EXPORTIN-T, C79645, 1110004L07Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 10
NCBI: 73192
VEGA: 10
Homologene: 38291
Tenm4
Name: teneurin transmembrane protein 4
Synonyms: Ten-m4, l(7)-3Rn, Doc4, Odz4, ELM2, l7Rn3
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 7
NCBI: 23966
Homologene: 8034
Zfp451
Name: zinc finger protein 451
Synonyms: 4933435G09Rik, Kiaa0576-hp, 4930515K21Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 1
NCBI: 98403
Homologene: 9188
Lrrtm1
Name: leucine rich repeat transmembrane neuronal 1
Synonyms: 4632401D06Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 6
NCBI: 74342
Homologene: 41763
Susd1
Name: sushi domain containing 1
Synonyms: Gm12528
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 4
NCBI: 634731
Homologene: 11204
Lrrtm3
Name: leucine rich repeat transmembrane neuronal 3
Synonyms: 9630044H04Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 10
NCBI: 216028
Homologene: 37110
Gad1
Name: glutamate decarboxylase 1
Synonyms: GAD67, GAD44, Z49976, Gad-1, GAD25, EP10
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 2
NCBI: 14415
HGNC: HGNC:4092
Homologene: 635
Rpn1
Name: ribophorin I
Synonyms: Rpn-1, D6Wsu137e
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 6
NCBI: 103963
Homologene: 2213
Cct5
Name: chaperonin containing Tcp1, subunit 5 (epsilon)
Synonyms: Ccte, TCPE
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 15
NCBI: 12465
HGNC: HGNC:1618
Homologene: 6287
Mtr
Name: 5-methyltetrahydrofolate-homocysteine methyltransferase
Synonyms: methionine synthase, MS, D830038K18Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 13
NCBI: 238505
VEGA: 13
HGNC: HGNC:7468
Homologene: 37280
St14
Name: suppression of tumorigenicity 14 (colon carcinoma)
Synonyms: Epithin, matriptase, Tmprss14, MT-SP1, Prss14
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 9
NCBI: 19143
Homologene: 7906
Limd1
Name: LIM domains containing 1
Synonyms: D9Ertd192e
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 9
NCBI: 29806
VEGA: 9
HGNC: HGNC:6612
Homologene: 8478
Vps4a
Name: vacuolar protein sorting 4A
Synonyms: 4930589C15Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 8
NCBI: 116733
Homologene: 69132
Farsa
Name: phenylalanyl-tRNA synthetase, alpha subunit
Synonyms: 0610012A19Rik, Farsla
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 8
NCBI: 66590
HGNC: HGNC:3592
Homologene: 3280
Sugp1
Name: SURP and G patch domain containing 1
Synonyms: Sf4
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 8
NCBI: 70616
Homologene: 12360
Efl1
Name: elongation factor like GTPase 1
Synonyms: 4932434J20Rik, D7Ertd791e, Eftud1, 6030468D11Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 7
NCBI: 101592
Homologene: 11599
Zfhx2
Name: zinc finger homeobox 2
Synonyms: zfh-5
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 14
NCBI: 239102
Homologene: 52657
Fbxl19
Name: F-box and leucine-rich repeat protein 19
Synonyms: Fbl19
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 7
NCBI: 233902
Homologene: 129692
Wnt5a
Name: wingless-type MMTV integration site family, member 5A
Synonyms: Wnt-5a, 8030457G12Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 14
NCBI: 22418
Homologene: 20720
Grpr
Name: gastrin releasing peptide receptor
Synonyms: bombesin receptor, GRP-R
Type: Gene
Species: Mus musculus (mouse)
Chromosome: X
NCBI: 14829
HGNC: HGNC:4609
Homologene: 21098
Trpc6
Name: transient receptor potential cation channel, subfamily C, member 6
Synonyms: Trrp6, mtrp6
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 9
NCBI: 22068
VEGA: 9
Homologene: 37944
Syne2
Name: spectrin repeat containing, nuclear envelope 2
Synonyms: D12Ertd777e, syne-2, dice, 6820443O06Rik, Cpfl8, nesprin-2, diminished cone electroretinogram, Nesp2g
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 12
NCBI: 319565
Homologene: 56700
Dnah12
Name: dynein, axonemal, heavy chain 12
Synonyms: DHC3, Dnahc7l, DLP12, Dnahc12, Hdhc3, 4921531P07Rik, LOC380889, HL19, HL-19
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 14
NCBI: 110083
HGNC: HGNC:2943
Homologene: 56821
Pkhd1l1
Name: polycystic kidney and hepatic disease 1-like 1
Synonyms: PKHDL1, fibrocystin L, D86 mRNA
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 15
NCBI: 192190
Homologene: 16332
Wdfy4
Name: WD repeat and FYVE domain containing 4
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 14
NCBI: 545030
Homologene: 83473
Cdh16
Name: cadherin 16
Synonyms: KSP-cadherin
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 8
NCBI: 12556
HGNC: HGNC:1755
Homologene: 2997
Dscam
Name: DS cell adhesion molecule
Synonyms: Down syndrome cell adhesion molecule, 4932410A21Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 16
NCBI: 13508
HGNC: HGNC:3039
Homologene: 74393
Stard9
Name: START domain containing 9
Synonyms: 4831403C07Rik, E230025N21Rik, Kif16a, N-3 kinesin
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 2
NCBI: 668880
Homologene: 130712
Olfr631
Name: olfactory receptor 631
Synonyms: GA_x6K02T2PBJ9-6662699-6663658, MOR3-1
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 7
NCBI: 258961
Homologene: 64935
Myh2
Name: myosin, heavy polypeptide 2, skeletal muscle, adult
Synonyms: MyHC-IIa, Myhsf1, Myhs-f, Myhs-f1, MHC2A
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 11
NCBI: 17882
HGNC: HGNC:7572
Homologene: 23019
4930458L03Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 13
Ccdc110
Name: coiled-coil domain containing 110
Synonyms: LOC212392
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 8
NCBI: 212392
Homologene: 17668
Srgap1
Name: SLIT-ROBO Rho GTPase activating protein 1
Synonyms: Arhgap13, 4930572H05Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 10
NCBI: 117600
Homologene: 56898
Sema4f
Name: sema domain, immunoglobulin domain (Ig), TM domain, and short cytoplasmic domain
Synonyms: Sema W
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 6
NCBI: 20355
Homologene: 3147
Adam25
Name: a disintegrin and metallopeptidase domain 25 (testase 2)
Synonyms: testase 2
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 8
NCBI: 23793
HGNC: HGNC:199
Homologene: 128364
Dpy19l1
Name: dpy-19-like 1 (C. elegans)
Synonyms: 1100001I19Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 9
NCBI: 244745
Homologene: 14762
Nebl
Name: nebulette
Synonyms: A630080F05Rik, Lnebl, 1200007O21Rik, D830029A09Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 2
NCBI: 74103
Homologene: 128431
Bsn
Name: bassoon
Synonyms: presynaptic cytomatrix protein
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 9
NCBI: 12217
HGNC: HGNC:1117
Homologene: 31161
Inpp4b
Name: inositol polyphosphate-4-phosphatase, type II
Synonyms: E130107I17Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 8
NCBI: 234515
HGNC: HGNC:6075
Homologene: 20832
Myh4
Name: myosin, heavy polypeptide 4, skeletal muscle
Synonyms: Minimsc, MyHC-IIb, Minmus, Myhsf, MHC2B, MM, MYH-2B
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 11
NCBI: 17884
HGNC: HGNC:7574
Homologene: 123880
Frem3
Name: Fras1 related extracellular matrix protein 3
Synonyms: LOC333315
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 8
NCBI: 333315
Homologene: 35388
Whrn
Name: whirlin
Synonyms: wi, Dfnb31, 1110035G07Rik, C430046P22Rik, Ush2d
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 4
NCBI: 73750
Homologene: 18739
Mpeg1
Name: macrophage expressed gene 1
Synonyms: Mpg-1, MPS1, Perforin-2
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 19
NCBI: 17476
VEGA: 19
Homologene: 11216
Garem2
Name: GRB2 associated regulator of MAPK1 subtype 2
Synonyms: LOC242915, Fam59b, Gareml
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 5
NCBI: 242915
Homologene: 19063
Gm20382
Name: predicted gene, 20382
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 5
Ccdc78
Name: coiled-coil domain containing 78
Synonyms: LOC381146, LOC381077
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 17
NCBI: 381077
VEGA: 17
Homologene: 105408
Rasgrf1
Name: RAS protein-specific guanine nucleotide-releasing factor 1
Synonyms: Grfbeta, Grf1, CDC25Mm, CDC25
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 9
NCBI: 19417
HGNC: HGNC:9875
Homologene: 74972
Olfr504
Name: olfactory receptor 504
Synonyms: MOR40-15, GA_x6K02T2PBJ9-10895499-10894543, MOR40-7P
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 7
NCBI: 258163
Homologene: 17189
Tlr1
Name: toll-like receptor 1
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 5
NCBI: 21897
Homologene: 20694
Klrb1f
Name: killer cell lectin-like receptor subfamily B member 1F
Synonyms: Nkrp1f, A630024B12Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 6
NCBI: 232408
Homologene: 135762
Fbxw19
Name: F-box and WD-40 domain protein 19
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 9
NCBI: 235612
Homologene: 110776
Kcnab2
Name: potassium voltage-gated channel, shaker-related subfamily, beta member 2
Synonyms: I2rf5, F5, I2rf5, Kcnb3
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 4
NCBI: 16498
HGNC: HGNC:6229
Homologene: 56492
Fam57b
Name: family with sequence similarity 57, member B
Synonyms: 1500016O10Rik, A330104J06Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 7
NCBI: 68952
Homologene: 69491
Crx
Name: cone-rod homeobox
Synonyms: Crx1
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 7
NCBI: 12951
HGNC: HGNC:2383
Homologene: 467
Vmn1r29
Name: vomeronasal 1 receptor 29
Synonyms: V1rc2
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 6
NCBI: 113859
Homologene: 123821
Sgcg
Name: sarcoglycan, gamma (dystrophin-associated glycoprotein)
Synonyms: gamma-SG, 5430420E18Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 14
NCBI: 24053
Homologene: 194
Tktl2
Name: transketolase-like 2
Synonyms: 4933401I19Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 8
NCBI: 74419
Homologene: 69456
Glra3
Name: glycine receptor, alpha 3 subunit
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 8
NCBI: 110304
HGNC: HGNC:4328
Homologene: 142
Srl
Name: sarcalumenin
Synonyms: sarcalumenin, sar, 9830004M20Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 16
NCBI: 106393
Homologene: 45500
Ankrd45
Name: ankyrin repeat domain 45
Synonyms: 4933409K03Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 1
NCBI: 73844
Homologene: 19617
Olfr1110
Name: olfactory receptor 1110
Synonyms: GA_x6K02T2Q125-48621299-48620361, MOR172-4
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 2
NCBI: 258765
Gpr162
Name: G protein-coupled receptor 162
Synonyms: A-2, Grca
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 6
NCBI: 14788
Homologene: 8400
Heatr4
Name: HEAT repeat containing 4
Synonyms: Gm17673
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 12
NCBI: 101055670
Homologene: 45728
Prss53
Name: protease, serine 53
Synonyms: BC039632
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 7
NCBI: 330657
Homologene: 80097
Celf4
Name: CUGBP, Elav-like family member 4
Synonyms: Brul4, C130060B05Rik, A230070D14Rik, Brunol4, BRUNOL-4
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 18
NCBI: 108013
VEGA: 18
Homologene: 23202
Serpinb5
Name: serine (or cysteine) peptidase inhibitor, clade B, member 5
Synonyms: ovalbumin, Spi7, Maspin, 1110036M19Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 1
NCBI: 20724
HGNC: HGNC:8949
Homologene: 20580
Klra4
Name: killer cell lectin-like receptor, subfamily A, member 4
Synonyms: Ly49d, ly49r129, Chok
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 6
NCBI: 16635
Homologene: 110821
Sytl3
Name: synaptotagmin-like 3
Synonyms: Slp3, Slp3-a, Slp3-b
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 17
NCBI: 83672
Homologene: 12855
Epor
Name: erythropoietin receptor
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 9
NCBI: 13857
VEGA: 9
HGNC: HGNC:3416
Homologene: 95
Cd300c2
Name: CD300C molecule 2
Synonyms: MAIR-II, AF251705, LMIR2, Cd300d, Clm4, Igsf7, DIgR1
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 11
NCBI: 140497
Homologene: 74580
Tbca
Name: tubulin cofactor A
Synonyms: cofactor A, Tbca13, co-chaperonin associated with a- & b-tubulin
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 13
NCBI: 21371
VEGA: 13
Homologene: 3388
Gm8206
Name: predicted gene 8206
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 14
Gm10101
Name: predicted gene 10101
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 14
Genetic Alterations
ENU-induced transitions at the following base pair locations (GRCm38):
  • T to C, chromosome 1 at 33,777,822 bp
  • A to G, chromosome 1 at 106,876,121 bp
  • A to T, chromosome 1 at 161,151,300 bp
  • A to T, chromosome 2 at 17,375,292 bp
  • T to G, chromosome 2 at 70,587,392 bp
  • T to A, chromosome 2 at 87,135,844 bp
  • G to A, chromosome 2 at 101,901,031 bp
  • T to A, chromosome 2 at 120,698,656 bp
  • C to T, chromosome 3 at 37,232,486 bp
  • T to A, chromosome 3 at 103,056,481 bp
  • A to T, chromosome 4 at 59,351,695 bp
  • G to A, chromosome 4 at 63,415,639 bp
  • A to G, chromosome 4 at 83,232,720 bp
  • T to A, chromosome 4 at 123,048,888 bp
  • A to G, chromosome 4 at 129,317,849 bp
  • T to C, chromosome 4 at 152,435,866 bp
  • GCTCT to GCTCTCT, chromosome 4 at 156,166,519 bp
  • T to C, chromosome 5 at 29,619,659 bp
  • G to T, chromosome 5 at 30,114,862 bp
  • T to G, chromosome 5 at 64,925,438 bp
  • A to T, chromosome 5 at 131,487,880 bp
  • C to T, chromosome 6 at 6,109,262 bp
  • T to A, chromosome 6 at 58,307,420 bp
  • A to T, chromosome 6 at 77,244,966 bp
  • G to T, chromosome 6 at 82,930,927 bp
  • T to A, chromosome 6 at 88,093,859 bp
  • C to T, chromosome 6 at 88,849,605 bp
  • TTGCTGCTGCTGCTGCTGCTGCTGTTGCTGCTGCTGCTGTTGCTGCTGCTG to TTGCTGCTGCTGCTGCTGCTGTTGCTGCTGCTGCTGTTGCTGCTGCTG, chromosome 6 at 99,075,965 bp
  • G to A, chromosome 6 at 124,861,447 bp
  • T to A, chromosome 6 at 129,054,245 bp
  • T to A, chromosome 6 at 130,065,244 bp
  • T to A, chromosome 7 at 15,868,376 bp
  • C to T, chromosome 7 at 44,615,348 bp
  • C to T, chromosome 7 at 82,763,117 bp
  • A to G, chromosome 7 at 96,895,326 bp
  • T to G, chromosome 7 at 101,779,211 bp
  • G to T, chromosome 7 at 103,929,130 bp
  • A to C, chromosome 7 at 108,565,523 bp
  • C to T, chromosome 7 at 125,628,981 bp
  • T to A, chromosome 7 at 126,827,672 bp
  • C to A, chromosome 7 at 127,750,929 bp
  • T to C, chromosome 7 at 127,886,262 bp
  • C to A, chromosome 8 at 11,808,712 bp
  • C to A, chromosome 8 at 11,808,713 bp
  • A to T, chromosome 8 at 40,754,885 bp
  • A to G, chromosome 8 at 45,943,250 bp
  • G to T, chromosome 8 at 55,940,907 bp
  • G to A, chromosome 8 at 66,512,347 bp
  • A to G, chromosome 8 at 70,056,575 bp
  • A to G, chromosome 8 at 80,612,890 bp
  • A to G, chromosome 8 at 81,902,888 bp
  • T to C, chromosome 8 at 84,861,151 bp
  • A to G, chromosome 8 at 104,617,963 bp
  • G to A, chromosome 8 at 104,619,063 bp
  • T to C, chromosome 8 at 107,044,558 bp
  • G to A, chromosome 9 at 8,656,545 bp
  • C to T, chromosome 9 at 21,959,859 bp
  • A to T, chromosome 9 at 24,434,387 bp
  • G to A, chromosome 9 at 31,106,212 bp
  • G to T, chromosome 9 at 89,953,913 bp
  • A to G, chromosome 9 at 108,116,444 bp
  • A to T, chromosome 9 at 109,481,650 bp
  • T to A, chromosome 9 at 119,609,998 bp
  • G to A, chromosome 9 at 123,500,241 bp
  • A to G, chromosome 10 at 64,088,513 bp
  • A to G, chromosome 10 at 121,593,661 bp
  • G to T, chromosome 10 at 121,925,903 bp
  • G to T, chromosome 11 at 53,680,061 bp
  • G to T, chromosome 11 at 67,177,464 bp
  • G to C, chromosome 11 at 67,252,168 bp
  • A to T, chromosome 11 at 115,000,859 bp
  • T to A, chromosome 12 at 70,984,694 bp
  • C to G, chromosome 12 at 75,469,567 bp
  • T to A, chromosome 12 at 75,931,163 bp
  • T to C, chromosome 12 at 83,955,856 bp
  • A to T, chromosome 13 at 12,230,930 bp
  • T to C, chromosome 13 at 64,920,610 bp
  • C to A, chromosome 13 at 94,789,011 bp
  • A to T, chromosome 14 at 6,022,475 bp
  • T to A, chromosome 14 at 26,734,495 bp
  • C to T, chromosome 14 at 28,511,845 bp
  • T to C, chromosome 14 at 33,133,344 bp
  • T to C, chromosome 14 at 46,830,289 bp
  • T to C, chromosome 14 at 55,075,238 bp
  • C to T, chromosome 14 at 61,232,412 bp
  • G to T, chromosome 15 at 31,591,008 bp
  • T to A, chromosome 15 at 39,138,088 bp
  • A to T, chromosome 15 at 44,540,884 bp
  • A to G, chromosome 16 at 4,492,350 bp
  • T to C, chromosome 16 at 10,688,539 bp
  • A to G, chromosome 16 at 96,593,214 bp
  • T to A, chromosome 17 at 6,733,046 bp
  • T to A, chromosome 17 at 25,787,070 bp
  • A to G, chromosome 17 at 86,102,893 bp
  • A to G, chromosome 18 at 25,486,976 bp
  • A to T, chromosome 19 at 12,462,647 bp
  • T to A, chromosome 19 at 36,972,957 bp
  • T to A, chromosome 19 at 54,046,406 bp
  • C to A, chromosome X at 163,549,141 bp
Genotype Determination
Phenotype
G1 male heterozygous mice are viable and fertile. The G1 mice were not characterized prior to archiving.
Strain Development
C57BL/6J mice were injected with ENU, resulting in G0 mice that were bred back to C57BL/6J. Sperm was archived from G1 male mice that produced viable G2 mice.
Suggested Control Mice
Wild-type littermates or C57BL/6J mice
Donor
Bruce Beutler, M.D., University of Texas Southwestern Medical Center.
Primary Reference
MUTAGENETIX record for R1933 (G1). B. Beutler and colleagues, Center for the Genetics of Host Defense, UT Southwestern, Dallas, TX.

Colony and Husbandry Information

Colony Surveillance Program and Current Health Reports

Mice recovered from a cryo-archive will have health surveillance performed on recipient females. Health reports will be provided prior to shipment. If you require additional health status information, please email mmrrc@missouri.edu .
Coat Color
Black
MMRRC Breeding System
Random intra-strain mating
Breeding Scheme(s)
When maintaining a live colony, heterozygous mice may be bred together, bred with wild-type siblings, or bred with C57BL/6J inbred mice.
Overall Breeding Performance
Undetermined; during development, mating was done with heterozygous males; viability, fertility and other breeding statistics for heterozygous females and homozygotes are unverified, but presumably would be similar to the C57BL/6J background strain
Average litter size
Undetermined
Recommended wean age
3 weeks

Order Request Information

Limited quantities of breeder mice (recovered litter) are available from a cryoarchive; recovered litter usually available to ship in 3 to 4 months.

Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

Distribution of this strain requires submission of the MMRRC Conditions of Use (COU). A link to the COU web form will be provided via email after an order has been placed; the form should be completed then or the email forwarded to your institutional official for completion.

The donor or their institution limits the distribution to non-profit institutions only.

Additional charges may apply for any special requests. Shipping costs are in addition to the basic distribution/resuscitation fees. Information on shipping costs and any additional charges will be provided by the supplying MMRRC facility.

Click button to Request this one strain. (Use the MMRRC Catalog Search to request more than one strain.)
MMRRC Item # Description Distribution Fee / Unit (US $) Units Notes
039951-MU-RESUS Litter recovered from cryo-archive $5,475.00 / Non-Profit Litter Recovered litter4; additional fees for any special requests.
Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

Some MMRRC strains were submitted by the donor as cryopreserved germplasm, and because these strains were not cryopreserved by the MMRRC, we have not assessed the quality of this material. We have extensive experience with recovery of mice from cryopreserved sperm and embryos of varying quality, including using techniques such as IVF and ICSI, and are confident that we will have success in most, if not all, cases. However, because of the unknown quality of these frozen samples, we will restrict recovery efforts to two attempts for each order. Subsequent attempts can be performed on a fee-for-service basis, in addition to the standard fees, upon request.

1 The distribution fee covers the expense of rederiving mice from a live mouse; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

2 An aliquot contains a sufficient number of embryos (in one or more vials or straws and based on the transfer success rate of the MMRRC facility) to transfer into one to three recipients. The MMRRC makes no guarantee concerning embryo transfer success experienced in the recipient investigator's laboratory. Neither gender nor genotype ratios are guaranteed.

3 An aliquot is one straw or vial with sufficient sperm to recover at least one litter of mice, as per provided protocols, when performed at the MMRRC facility. The MMRRC makes no guarantee concerning the success of these procedures when performed outside the MMRRC facilities.

4 The distribution fee covers the expense of resuscitating mice from the cryo-archive; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

To request material from the MMRRC: Please fill out our on-line request form (accessible from the catalog search results page, or click the Request this Strain button in the fees section). If you have questions or need assistance completing this form, you may call Customer Service at (800) 910-2291 (in USA or Canada) or (530) 757-5710 (international calls). Before you call, please have with you: the MMRRC item number, quantity needed, Bill-to and Ship-to contact information.