Strain Name:
C57BL/6J-MtgxR1939Btlr/Mmmh
Stock Number:
039957-MU
Citation ID:
RRID:MMRRC_039957-MU
Other Names:
R1939 (G1), C57BL/6J-MtgxR1939Btlr
Major Collection:

Strain Information

Pip5k1a
Name: phosphatidylinositol-4-phosphate 5-kinase, type 1 alpha
Synonyms: Pipk5a
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 3
NCBI: 18720
HGNC: HGNC:8994
Homologene: 93492
Trim32
Name: tripartite motif-containing 32
Synonyms: 3f3, 1810045E12Rik, Zfp117, BBS11
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 4
NCBI: 69807
Homologene: 36327
Itga8
Name: integrin alpha 8
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 2
NCBI: 241226
HGNC: HGNC:6144
Homologene: 37396
Acvr1c
Name: activin A receptor, type IC
Synonyms: ALK7, Alk-7
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 2
NCBI: 269275
Homologene: 26724
Lgals8
Name: lectin, galactose binding, soluble 8
Synonyms: Lgals-8, 1200015E08Rik, D13Ertd524e
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 13
NCBI: 56048
HGNC: HGNC:6569
Homologene: 31386
Atf2
Name: activating transcription factor 2
Synonyms: mXBP, CRE-BP, Creb2, D130078H02Rik, ATF-2
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 2
NCBI: 11909
HGNC: HGNC:784
Homologene: 31061
Arfgef2
Name: ADP-ribosylation factor guanine nucleotide-exchange factor 2 (brefeldin A-inhibited)
Synonyms: BIG2, E230011G24Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 2
NCBI: 99371
Homologene: 111880
Slc4a7
Name: solute carrier family 4, sodium bicarbonate cotransporter, member 7
Synonyms: E430014N10Rik, NBC3, NBCn1
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 14
NCBI: 218756
VEGA: 14
Homologene: 2680
Prkdc
Name: protein kinase, DNA activated, catalytic polypeptide
Synonyms: DNA-PKcs, slip, DNAPDcs, XRCC7, DNA-PK, DOXNPH, dxnph
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 16
NCBI: 19090
HGNC: HGNC:9413
Homologene: 5037
Birc6
Name: baculoviral IAP repeat-containing 6
Synonyms: apollon, Bruce, A430032G04Rik, D630005A10Rik, A430040A19Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 17
NCBI: 12211
Homologene: 7248
Osbpl8
Name: oxysterol binding protein-like 8
Synonyms: ORP-8, D330025H14Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 10
NCBI: 237542
VEGA: 10
Homologene: 68813
Relch
Name: RAB11 binding and LisH domain, coiled-coil and HEAT repeat containing
Synonyms: 2310035C23Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 1
NCBI: 227446
Homologene: 10834
Coro7
Name: coronin 7
Synonyms: 0610011B16Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 16
NCBI: 78885
Homologene: 11573
Fer
Name: fer (fms/fps related) protein kinase
Synonyms: Fert, C330004K01Rik, Fert2
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 17
NCBI: 14158
VEGA: 17
HGNC: HGNC:3655
Homologene: 74300
Tet2
Name: tet methylcytosine dioxygenase 2
Synonyms: E130014J05Rik, Ayu17-449
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 3
NCBI: 214133
Homologene: 49498
Lonp2
Name: lon peptidase 2, peroxisomal
Synonyms: 1300002A08Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 8
NCBI: 66887
Homologene: 12050
Wipf2
Name: WAS/WASL interacting protein family, member 2
Synonyms: 1110014J05Rik, 5730509C05Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 11
NCBI: 68524
Homologene: 15777
Osr1
Name: odd-skipped related transcription factor 1
Synonyms: Odd1
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 12
NCBI: 23967
VEGA: 12
HGNC: HGNC:8111
Homologene: 8035
Mcpt1
Name: mast cell protease 1
Synonyms: Mcp-1
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 14
NCBI: 17224
VEGA: 14
Homologene: 137209
Lama5
Name: laminin, alpha 5
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 2
NCBI: 16776
HGNC: HGNC:6485
Homologene: 4060
Tdp2
Name: tyrosyl-DNA phosphodiesterase 2
Synonyms: D13Ertd656e, Ttrap
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 13
NCBI: 56196
Homologene: 9591
Ace2
Name: angiotensin I converting enzyme (peptidyl-dipeptidase A) 2
Synonyms: 2010305L05Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: X
NCBI: 70008
Homologene: 41448
Dync2h1
Name: dynein cytoplasmic 2 heavy chain 1
Synonyms: DHC1b, DHC2, 4432416O06Rik, D330044F14Rik, D030010H02Rik, Dnchc2, b2b414Clo, m407Asp, m152Asp
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 9
NCBI: 110350
HGNC: HGNC:2962
Homologene: 14468
Pms1
Name: PMS1 homolog 1, mismatch repair system component
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 1
NCBI: 227099
HGNC: HGNC:9121
Homologene: 449
Srsf6
Name: serine and arginine-rich splicing factor 6
Synonyms: 1210001E11Rik, Sfrs6
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 2
NCBI: 67996
Homologene: 110783
2700049A03Rik
Name: RIKEN cDNA 2700049A03 gene
Synonyms: talpid3, Ta3
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 12
NCBI: 76967
Homologene: 8839
Tecpr2
Name: tectonin beta-propeller repeat containing 2
Synonyms: 4930573I19Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 12
NCBI: 104859
VEGA: 12
Homologene: 8897
Nav1
Name: neuron navigator 1
Synonyms: POMFIL3, 9930003A20Rik, C230080M11Rik, unc53H1, steerin-1
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 1
NCBI: 215690
Homologene: 10719
Atad2b
Name: ATPase family, AAA domain containing 2B
Synonyms: 1110014E10Rik, D530031C13Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 12
NCBI: 320817
VEGA: 12
Homologene: 86351
Pla2g15
Name: phospholipase A2, group XV
Synonyms: LLPL, C87498, Lpla2, Lypla3
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 8
NCBI: 192654
Homologene: 8200
Ucp3
Name: uncoupling protein 3 (mitochondrial, proton carrier)
Synonyms: UCP-3, Slc25a9
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 7
NCBI: 22229
Homologene: 2517
Cngb1
Name: cyclic nucleotide gated channel beta 1
Synonyms: Cngb1, Cngb1b, BC016201
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 8
NCBI: 333329
HGNC: HGNC:2151
Homologene: 136420
Jag1
Name: jagged 1
Synonyms: Serrate-1, Htu, Headturner, ABE2, Ozz, Gsfabe2
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 2
NCBI: 16449
HGNC: HGNC:6188
Homologene: 180
Slc16a4
Name: solute carrier family 16 (monocarboxylic acid transporters), member 4
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 3
NCBI: 229699
Homologene: 74529
Fgf10
Name: fibroblast growth factor 10
Synonyms: FGF-10, AEY17, Gsfaey17
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 13
NCBI: 14165
HGNC: HGNC:3666
Homologene: 3284
Arrdc2
Name: arrestin domain containing 2
Synonyms: 4632416I05Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 8
NCBI: 70807
Homologene: 79540
Chn1
Name: chimerin 1
Synonyms: 1700112L09Rik, 0710001E19Rik, ARHGAP2, 2900046J01Rik, 0610007I19Rik, alpha2 chimaerin, alpha1 chimaerin
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 2
NCBI: 108699
HGNC: HGNC:1943
Homologene: 31056
Slco1a6
Name: solute carrier organic anion transporter family, member 1a6
Synonyms: organic anion-transporting polypeptide, Oatp-5, 4930422F19Rik, Slc21a13
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 6
NCBI: 28254
Homologene: 23416
Pdzd8
Name: PDZ domain containing 8
Synonyms: A630041P07Rik, Pdzk8
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 19
NCBI: 107368
VEGA: 19
Homologene: 14879
9930021J03Rik
Name: RIKEN cDNA 9930021J03 gene
Synonyms: Gm9832
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 19
NCBI: 240613
Homologene: 19046
Lrp1b
Name: low density lipoprotein-related protein 1B
Synonyms: 9630004P12Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 2
NCBI: 94217
HGNC: HGNC:6693
Homologene: 56810
Nat8f5
Name: N-acetyltransferase 8 (GCN5-related) family member 5
Synonyms: 1810018F03Rik, Cml5
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 6
NCBI: 69049
Homologene: 87019
Pcdhga11
Name: protocadherin gamma subfamily A, 11
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 18
NCBI: 93723
HGNC: HGNC:8698
Homologene: 110934
Ptprt
Name: protein tyrosine phosphatase receptor type T
Synonyms: RPTPrho
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 2
NCBI: 19281
HGNC: HGNC:9682
Homologene: 56924
Gpat2
Name: glycerol-3-phosphate acyltransferase 2, mitochondrial
Synonyms: Gpat2, A530057A03Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 2
NCBI: 215456
Homologene: 19037
Defb26
Name: defensin beta 26
Synonyms: EG654457
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 2
NCBI: 654457
Homologene: 86850
Rp1l1
Name: retinitis pigmentosa 1 homolog like 1
Synonyms: Dcdc4, Rp1hl1
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 14
NCBI: 271209
VEGA: 14
Homologene: 105870
Myo15b
Name: myosin XVB
Synonyms: LOC217328, LOC380737, E330039G21Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 11
NCBI: 217328
Mug1
Name: murinoglobulin 1
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 6
NCBI: 17836
Homologene: 136663
Semp2l1
Name: SUMO/sentrin specific peptidase 2-like 1
Synonyms: Gm5415
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 1
NCBI: 408191
Homologene: 130042
Fam83b
Name: family with sequence similarity 83, member B
Synonyms: C530008M07Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 9
NCBI: 208994
Homologene: 19478
Vmn2r13
Name: vomeronasal 2, receptor 13
Synonyms: Gm4867
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 5
NCBI: 231589
Homologene: 129606
Pkd1l2
Name: polycystic kidney disease 1 like 2
Synonyms: 1700126L06Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 8
NCBI: 76645
Homologene: 124481
Engase
Name: endo-beta-N-acetylglucosaminidase
Synonyms: D230014K01Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 11
NCBI: 217364
Homologene: 13666
Adam22
Name: a disintegrin and metallopeptidase domain 22
Synonyms: MDC2, 2900022I03Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 5
NCBI: 11496
HGNC: HGNC:201
Homologene: 37898
Rmc1
Name: regulator of MON1-CCZ1
Synonyms: 3110002H16Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 18
NCBI: 76482
Homologene: 8341
Cntnap5b
Name: contactin associated protein-like 5B
Synonyms: Caspr5-2, C230078M14Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 1
NCBI: 241175
Homologene: 104295
4933409G03Rik
Name: RIKEN cDNA 4933409G03 gene
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 2
NCBI: 227998
Zfp976
Name: zinc finger protein 976
Synonyms: 9830147E19Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 7
NCBI: 208111
Homologene: 134004
Dnase2a
Name: deoxyribonuclease II alpha
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 8
NCBI: 13423
HGNC: HGNC:2960
Homologene: 68179
St3gal6
Name: ST3 beta-galactoside alpha-2,3-sialyltransferase 6
Synonyms: ST3Gal VI, 1700023B24Rik, Siat10
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 16
NCBI: 54613
Homologene: 4448
Or10j3b
Name: olfactory receptor family 10 subfamily J member 3B
Synonyms: GA_x6K02T2R7CC-630397-629456, MOR267-2, Olfr1404
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 1
NCBI: 258881
Homologene: 133587
Tsnaxip1
Name: translin-associated factor X (Tsnax) interacting protein 1
Synonyms: TXI1, 1700016K08Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 8
NCBI: 72236
Homologene: 10194
Atp8b3
Name: ATPase, class I, type 8B, member 3
Synonyms: SAPLT, 1700042F02Rik, 1700056N23Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 10
NCBI: 67331
VEGA: 10
Homologene: 19034
Adarb2
Name: adenosine deaminase, RNA-specific, B2
Synonyms: RED2, Adar3
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 13
NCBI: 94191
HGNC: HGNC:227
Homologene: 10276
Or8b35
Name: olfactory receptor family 8 subfamily B member 35
Synonyms: GA_x6K02T2PVTD-31676771-31677700, MOR162-7, Olfr881
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 9
NCBI: 258413
Homologene: 74013
Vmn2r4
Name: vomeronasal 2, receptor 4
Synonyms: EG637053
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 3
NCBI: 637053
Homologene: 129754
Prkd1
Name: protein kinase D1
Synonyms: Pkcm, PKD1, Prkcm
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 12
NCBI: 18760
VEGA: 12
HGNC: HGNC:9407
Homologene: 55680
Ttll11
Name: tubulin tyrosine ligase-like family, member 11
Synonyms: 4932702F08Rik, D2Ertd624e, 4933424A20Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 2
NCBI: 74410
Homologene: 77534
Or5p58
Name: olfactory receptor family 5 subfamily P member 58
Synonyms: GA_x6K02T2PBJ9-10424354-10423383, MOR204-14, Olfr482
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 7
NCBI: 258728
Homologene: 133604
Hcfc2
Name: host cell factor C2
Synonyms: 1700129L13Rik, fkls
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 10
NCBI: 67933
Homologene: 8337
Zmym5
Name: zinc finger, MYM-type 5
Synonyms: 9830124H08Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 14
NCBI: 219105
Homologene: 16997
Or8c15
Name: olfactory receptor family 8 subfamily C member 15
Synonyms: GA_x6K02T2PVTD-31889215-31890153, MOR170-11, Olfr893
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 9
NCBI: 258333
Homologene: 133626
Rps6ka4
Name: ribosomal protein S6 kinase, polypeptide 4
Synonyms: MSK2, 1110069D02Rik, 90kDa
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 19
NCBI: 56613
VEGA: 19
Homologene: 69288
Vmn1r174
Name: vomeronasal 1 receptor 174
Synonyms: V1rd22
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 7
NCBI: 404291
Homologene: 79577
Mrgprb5
Name: MAS-related GPR, member B5
Synonyms: MrgB5
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 7
NCBI: 404239
Homologene: 115575
Aldh1b1
Name: aldehyde dehydrogenase 1 family, member B1
Synonyms: 2700007F14Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 4
NCBI: 72535
HGNC: HGNC:407
Homologene: 115470
Acot3
Name: acyl-CoA thioesterase 3
Synonyms: PTE-Ia, Pte2a
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 12
NCBI: 171281
Homologene: 134585
Rap1b
Name: RAS related protein 1b
Synonyms: 2810443E11Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 10
NCBI: 215449
VEGA: 10
HGNC: HGNC:9857
Homologene: 68719
Trappc6a
Name: trafficking protein particle complex 6A
Synonyms: 4930519D19Rik, 1810073E21Rik, TRS33
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 7
NCBI: 67091
Homologene: 69370
Sh3bp2
Name: SH3-domain binding protein 2
Synonyms: 3BP2
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 5
NCBI: 24055
Homologene: 2276
Col23a1
Name: collagen, type XXIII, alpha 1
Synonyms: 2810458L13Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 11
NCBI: 237759
Homologene: 72101
Purb
Name: purine rich element binding protein B
Synonyms: Cager-2, 2310015K15Rik, D11Bwg0414e
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 11
NCBI: 19291
HGNC: HGNC:9702
Homologene: 69087
Or6c217
Name: olfactory receptor family 6 subfamily C member 217
Synonyms: GA_x6K02T2PULF-11581263-11580331, MOR113-3, Olfr815
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 10
NCBI: 258665
Nudt6
Name: nudix hydrolase 6
Synonyms: nudix (nucleoside diphosphate linked moiety X)-type motif 6
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 3
NCBI: 229228
HGNC: HGNC:8053
Homologene: 31425
Ttll8
Name: tubulin tyrosine ligase-like family, member 8
Synonyms: 1700019P01Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 15
NCBI: 239591
Homologene: 52766
Gm10608
Name: predicted gene 10608
Synonyms: EG546165
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 9
NCBI: 546165
VEGA: 9
Slc17a1
Name: solute carrier family 17 (sodium phosphate), member 1
Synonyms: Npt1, NAPI-1
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 13
NCBI: 20504
Homologene: 48324
Bcl2l14
Name: BCL2-like 14 (apoptosis facilitator)
Synonyms: 4933405K19Rik, 9030625M01Rik, 4930452K23Rik, Bcl-G
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 6
NCBI: 66813
Homologene: 49840
Ttc34
Name: tetratricopeptide repeat domain 34
Synonyms: B230396O12Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 4
NCBI: 242800
Homologene: 130480
Mpnd
Name: MPN domain containing
Synonyms: E130307M08Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 17
NCBI: 68047
Homologene: 12231
AU016765
Name: expressed sequence AU016765
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 17
NCBI: 100043582
Ubiad1
Name: UbiA prenyltransferase domain containing 1
Synonyms: Tere1, 1200002M06Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 4
NCBI: 71707
Homologene: 8336
1700020L24Rik
Name: RIKEN cDNA 1700020L24 gene
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 11
NCBI: 66330
Homologene: 11949
Gm904
Name: predicted gene 904
Synonyms: LOC380845, LOC382165
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 13
NCBI: 380845
Homologene: 134520
Trpd52l3
Name: tumor protein D52-like 3
Synonyms: 4931412G03Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 19
NCBI: 66745
VEGA: 19
Homologene: 12024
Genetic Alterations
ENU-induced transitions at the following base pair locations (GRCm38):
  • T to C, chromosome 1 at 32,545,546 bp
  • A to C, chromosome 1 at 53,196,976 bp
  • A to G, chromosome 1 at 99,967,348 bp
  • T to A, chromosome 1 at 105,741,375 bp
  • A to T, chromosome 1 at 135,465,898 bp
  • G to T, chromosome 1 at 173,215,932 bp
  • T to G, chromosome 2 at 12,300,846 bp
  • T to A, chromosome 2 at 35,940,753 bp
  • A to G, chromosome 2 at 40,697,589 bp
  • A to T, chromosome 2 at 58,283,505 bp
  • T to C, chromosome 2 at 68,588,984 bp
  • A to G, chromosome 2 at 73,624,901 bp
  • G to A, chromosome 2 at 73,846,219 bp
  • T to A, chromosome 2 at 127,435,959 bp
  • C to G, chromosome 2 at 137,083,473 bp
  • A to G, chromosome 2 at 152,508,303 bp
  • T to C, chromosome 2 at 161,927,640 bp
  • C to T, chromosome 2 at 162,934,483 bp
  • T to A, chromosome 2 at 166,873,628 bp
  • T to C, chromosome 2 at 180,190,921 bp
  • T to C, chromosome 3 at 37,405,230 bp
  • T to C, chromosome 3 at 64,398,555 bp
  • A to T, chromosome 3 at 95,060,469 bp
  • A to G, chromosome 3 at 107,301,001 bp
  • T to C, chromosome 3 at 133,488,638 bp
  • A to G, chromosome 4 at 45,802,755 bp
  • G to A, chromosome 4 at 65,614,066 bp
  • A to G, chromosome 4 at 148,444,011 bp
  • G to A, chromosome 4 at 154,865,682 bp
  • A to T, chromosome 5 at 8,330,015 bp
  • A to G, chromosome 5 at 34,551,619 bp
  • T to C, chromosome 5 at 109,191,986 bp
  • A to C, chromosome 6 at 85,817,819 bp
  • T to C, chromosome 6 at 121,886,541 bp
  • T to A, chromosome 6 at 134,427,290 bp
  • T to A, chromosome 6 at 142,133,230 bp
  • T to A, chromosome 7 at 19,514,501 bp
  • T to A, chromosome 7 at 23,754,107 bp
  • C to A, chromosome 7 at 42,613,681 bp
  • A to T, chromosome 7 at 48,168,938 bp
  • T to C, chromosome 7 at 100,480,664 bp
  • A to G, chromosome 7 at 108,095,141 bp
  • A to G, chromosome 8 at 70,836,003 bp
  • G to T, chromosome 8 at 84,910,895 bp
  • C to T, chromosome 8 at 86,631,634 bp
  • C to A, chromosome 8 at 95,299,692 bp
  • A to G, chromosome 8 at 105,840,038 bp
  • A to G, chromosome 8 at 106,163,295 bp
  • G to T, chromosome 8 at 117,046,182 bp
  • A to G, chromosome 9 at 7,139,159 bp
  • A to G, chromosome 9 at 37,993,089 bp
  • T to A, chromosome 9 at 38,209,429 bp
  • A to T, chromosome 9 at 76,493,080 bp
  • CAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGA to CAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGA, chromosome 9 at 119,160,716 bp
  • A to T, chromosome 10 at 80,525,386 bp
  • G to T, chromosome 10 at 82,702,450 bp
  • A to T, chromosome 10 at 111,289,811 bp
  • A to T, chromosome 10 at 117,818,586 bp
  • A to C, chromosome 10 at 129,902,101 bp
  • T to C, chromosome 11 at 6,474,943 bp
  • A to G, chromosome 11 at 51,551,989 bp
  • T to A, chromosome 11 at 83,440,304 bp
  • C to T, chromosome 11 at 98,892,410 bp
  • A to G, chromosome 11 at 115,887,703 bp
  • T to A, chromosome 11 at 118,479,186 bp
  • T to C, chromosome 12 at 5,017,973 bp
  • T to G, chromosome 12 at 9,579,687 bp
  • T to C, chromosome 12 at 50,394,994 bp
  • A to G, chromosome 12 at 71,160,412 bp
  • A to G, chromosome 12 at 84,058,551 bp
  • T to A, chromosome 12 at 110,933,169 bp
  • T to C, chromosome 13 at 8,203,322 bp
  • T to G, chromosome 13 at 12,459,188 bp
  • A to G, chromosome 13 at 23,875,881 bp
  • A to G, chromosome 13 at 24,841,277 bp
  • T to C, chromosome 13 at 50,644,736 bp
  • A to G, chromosome 13 at 118,789,152 bp
  • C to T, chromosome 14 at 14,748,581 bp
  • A to T, chromosome 14 at 56,019,089 bp
  • A to G, chromosome 14 at 56,799,120 bp
  • A to G, chromosome 14 at 64,029,593 bp
  • A to T, chromosome 15 at 88,915,486 bp
  • T to C, chromosome 16 at 4,628,732 bp
  • T to C, chromosome 16 at 15,835,913 bp
  • A to T, chromosome 16 at 58,473,561 bp
  • T to C, chromosome 17 at 56,015,920 bp
  • T to C, chromosome 17 at 63,973,128 bp
  • G to A, chromosome 17 at 64,519,878 bp
  • T to C, chromosome 17 at 74,670,337 bp
  • T to C, chromosome 18 at 12,180,505 bp
  • A to G, chromosome 18 at 37,821,950 bp
  • T to A, chromosome 19 at 6,839,466 bp
  • A to G, chromosome 19 at 29,753,677 bp
  • T to C, chromosome 19 at 30,003,889 bp
  • T to C, chromosome 19 at 59,305,151 bp
  • A to T, chromosome X at 164,156,528 bp
Genotype Determination
Phenotype
G1 male heterozygous mice are viable and fertile. The G1 mice were not characterized prior to archiving.
Strain Development
C57BL/6J mice were injected with ENU, resulting in G0 mice that were bred back to C57BL/6J. Sperm was archived from G1 male mice that produced viable G2 mice.
Suggested Control Mice
Wild-type littermates or C57BL/6J mice
MMRRC Genetic QC Summary
The MMRRC Centers have developed a genetic QC pipeline using MiniMUGA array genotyping to provide additional information on strain backgrounds for MMRRC congenic and inbred strains. For more information on when data may be available, or to request genotyping for a strain of interest, please contact mmrrc@missouri.edu. Older strains may not have this information.
Donor
Bruce Beutler, M.D., University of Texas Southwestern Medical Center.
Primary Reference
MUTAGENETIX record for R1939 (G1). B. Beutler and colleagues, Center for the Genetics of Host Defense, UT Southwestern, Dallas, TX.

Colony and Husbandry Information

Colony Surveillance Program and Current Health Reports

Mice recovered from a cryo-archive will have health surveillance performed on recipient females. Health reports will be provided prior to shipment. If you require additional health status information, please email mmrrc@missouri.edu .
Coat Color
Black
MMRRC Breeding System
Random intra-strain mating
Breeding Scheme(s)
When maintaining a live colony, heterozygous mice may be bred together, bred with wild-type siblings, or bred with C57BL/6J inbred mice.
Overall Breeding Performance
Undetermined; during development, mating was done with heterozygous males; viability, fertility and other breeding statistics for heterozygous females and homozygotes are unverified, but presumably would be similar to the C57BL/6J background strain
Average litter size
Undetermined
Recommended wean age
3 weeks

Order Request Information

Limited quantities of breeder mice (recovered litter) are available from a cryoarchive; recovered litter usually available to ship in 3 to 4 months.

Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

Distribution of this strain requires submission of the MMRRC Conditions of Use (COU). A link to the COU web form will be provided via email after an order has been placed; the form should be completed then or the email forwarded to your institutional official for completion.

The donor or their institution limits the distribution to non-profit institutions only.

Additional charges may apply for any special requests. Shipping costs are in addition to the basic distribution/resuscitation fees. Information on shipping costs and any additional charges will be provided by the supplying MMRRC facility.

Click button to Request this one strain. (Use the MMRRC Catalog Search to request more than one strain.)
MMRRC Item # Description Distribution Fee / Unit (US $)
*Shipping & Handling not included*
Units Notes
039957-MU-RESUS Litter recovered from cryo-archive $5,475.00 / Non-Profit Litter Recovered litter4; additional fees for any special requests.
Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

Some MMRRC strains were submitted by the donor as cryopreserved germplasm, and because these strains were not cryopreserved by the MMRRC, we have not assessed the quality of this material. We have extensive experience with recovery of mice from cryopreserved sperm and embryos of varying quality, including using techniques such as IVF and ICSI, and are confident that we will have success in most, if not all, cases. However, because of the unknown quality of these frozen samples, we will restrict recovery efforts to two attempts for each order. Subsequent attempts can be performed on a fee-for-service basis, in addition to the standard fees, upon request.

1 The distribution fee covers the expense of rederiving mice from a live mouse; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

2 An aliquot contains a sufficient number of embryos (in one or more vials or straws and based on the transfer success rate of the MMRRC facility) to transfer into one to three recipients. The MMRRC makes no guarantee concerning embryo transfer success experienced in the recipient investigator's laboratory. Neither gender nor genotype ratios are guaranteed.

3 An aliquot is one straw or vial with sufficient sperm to recover at least one litter of mice, as per provided protocols, when performed at the MMRRC facility. The MMRRC makes no guarantee concerning the success of these procedures when performed outside the MMRRC facilities.

4 The distribution fee covers the expense of resuscitating mice from the cryo-archive; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

To request material from the MMRRC: Please fill out our on-line request form (accessible from the catalog search results page, or click the Request this Strain button in the fees section). If you have questions or need assistance completing this form, you may call Customer Service at (800) 910-2291 (in USA or Canada) or (530) 757-5710 (international calls). Before you call, please have with you: the MMRRC item number, quantity needed, Bill-to and Ship-to contact information.