Loading Mouse GIF
Loading...

Strain Name:
C57BL/6J-MtgxR1939Btlr/Mmmh
Stock Number:
039957-MU
Citation ID:
RRID:MMRRC_039957-MU
Other Names:
R1939 (G1), C57BL/6J-MtgxR1939Btlr
Major Collection:

Strain Information

Pip5k1a
Name: phosphatidylinositol-4-phosphate 5-kinase, type 1 alpha
Synonyms: Pipk5a
Type: Gene
Species: Mouse
Chromosome: 3
NCBI: 18720
HGNC: HGNC:8994
Homologene: 93492
Trim32
Name: tripartite motif-containing 32
Synonyms: 3f3, 1810045E12Rik, Zfp117, BBS11
Type: Gene
Species: Mouse
Chromosome: 4
NCBI: 69807
Homologene: 36327
Itga8
Name: integrin alpha 8
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 241226
HGNC: HGNC:6144
Homologene: 37396
Acvr1c
Name: activin A receptor, type IC
Synonyms: ALK7, Alk-7
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 269275
Homologene: 26724
Lgals8
Name: lectin, galactose binding, soluble 8
Synonyms: Lgals-8, 1200015E08Rik, D13Ertd524e
Type: Gene
Species: Mouse
Chromosome: 13
NCBI: 56048
HGNC: HGNC:6569
Homologene: 31386
Atf2
Name: activating transcription factor 2
Synonyms: mXBP, CRE-BP, Creb2, D130078H02Rik, ATF-2
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 11909
HGNC: HGNC:784
Homologene: 31061
Arfgef2
Name: ARF guanine nucleotide exchange factor 2
Synonyms: BIG2, E230011G24Rik
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 99371
Homologene: 111880
Genetic Alterations
ENU-induced transitions at the following base pair locations (GRCm38):
  • T to C, chromosome 1 at 32,545,546 bp
  • A to C, chromosome 1 at 53,196,976 bp
  • A to G, chromosome 1 at 99,967,348 bp
  • T to A, chromosome 1 at 105,741,375 bp
  • A to T, chromosome 1 at 135,465,898 bp
  • G to T, chromosome 1 at 173,215,932 bp
  • T to G, chromosome 2 at 12,300,846 bp
  • T to A, chromosome 2 at 35,940,753 bp
  • A to G, chromosome 2 at 40,697,589 bp
  • A to T, chromosome 2 at 58,283,505 bp
  • T to C, chromosome 2 at 68,588,984 bp
  • A to G, chromosome 2 at 73,624,901 bp
  • G to A, chromosome 2 at 73,846,219 bp
  • T to A, chromosome 2 at 127,435,959 bp
  • C to G, chromosome 2 at 137,083,473 bp
  • A to G, chromosome 2 at 152,508,303 bp
  • T to C, chromosome 2 at 161,927,640 bp
  • C to T, chromosome 2 at 162,934,483 bp
  • T to A, chromosome 2 at 166,873,628 bp
  • T to C, chromosome 2 at 180,190,921 bp
  • T to C, chromosome 3 at 37,405,230 bp
  • T to C, chromosome 3 at 64,398,555 bp
  • A to T, chromosome 3 at 95,060,469 bp
  • A to G, chromosome 3 at 107,301,001 bp
  • T to C, chromosome 3 at 133,488,638 bp
  • A to G, chromosome 4 at 45,802,755 bp
  • G to A, chromosome 4 at 65,614,066 bp
  • A to G, chromosome 4 at 148,444,011 bp
  • G to A, chromosome 4 at 154,865,682 bp
  • A to T, chromosome 5 at 8,330,015 bp
  • A to G, chromosome 5 at 34,551,619 bp
  • T to C, chromosome 5 at 109,191,986 bp
  • A to C, chromosome 6 at 85,817,819 bp
  • T to C, chromosome 6 at 121,886,541 bp
  • T to A, chromosome 6 at 134,427,290 bp
  • T to A, chromosome 6 at 142,133,230 bp
  • T to A, chromosome 7 at 19,514,501 bp
  • T to A, chromosome 7 at 23,754,107 bp
  • C to A, chromosome 7 at 42,613,681 bp
  • A to T, chromosome 7 at 48,168,938 bp
  • T to C, chromosome 7 at 100,480,664 bp
  • A to G, chromosome 7 at 108,095,141 bp
  • A to G, chromosome 8 at 70,836,003 bp
  • G to T, chromosome 8 at 84,910,895 bp
  • C to T, chromosome 8 at 86,631,634 bp
  • C to A, chromosome 8 at 95,299,692 bp
  • A to G, chromosome 8 at 105,840,038 bp
  • A to G, chromosome 8 at 106,163,295 bp
  • G to T, chromosome 8 at 117,046,182 bp
  • A to G, chromosome 9 at 7,139,159 bp
  • A to G, chromosome 9 at 37,993,089 bp
  • T to A, chromosome 9 at 38,209,429 bp
  • A to T, chromosome 9 at 76,493,080 bp
  • CAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGA to CAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGA, chromosome 9 at 119,160,716 bp
  • A to T, chromosome 10 at 80,525,386 bp
  • G to T, chromosome 10 at 82,702,450 bp
  • A to T, chromosome 10 at 111,289,811 bp
  • A to T, chromosome 10 at 117,818,586 bp
  • A to C, chromosome 10 at 129,902,101 bp
  • T to C, chromosome 11 at 6,474,943 bp
  • A to G, chromosome 11 at 51,551,989 bp
  • T to A, chromosome 11 at 83,440,304 bp
  • C to T, chromosome 11 at 98,892,410 bp
  • A to G, chromosome 11 at 115,887,703 bp
  • T to A, chromosome 11 at 118,479,186 bp
  • T to C, chromosome 12 at 5,017,973 bp
  • T to G, chromosome 12 at 9,579,687 bp
  • T to C, chromosome 12 at 50,394,994 bp
  • A to G, chromosome 12 at 71,160,412 bp
  • A to G, chromosome 12 at 84,058,551 bp
  • T to A, chromosome 12 at 110,933,169 bp
  • T to C, chromosome 13 at 8,203,322 bp
  • T to G, chromosome 13 at 12,459,188 bp
  • A to G, chromosome 13 at 23,875,881 bp
  • A to G, chromosome 13 at 24,841,277 bp
  • T to C, chromosome 13 at 50,644,736 bp
  • A to G, chromosome 13 at 118,789,152 bp
  • C to T, chromosome 14 at 14,748,581 bp
  • A to T, chromosome 14 at 56,019,089 bp
  • A to G, chromosome 14 at 56,799,120 bp
  • A to G, chromosome 14 at 64,029,593 bp
  • A to T, chromosome 15 at 88,915,486 bp
  • T to C, chromosome 16 at 4,628,732 bp
  • T to C, chromosome 16 at 15,835,913 bp
  • A to T, chromosome 16 at 58,473,561 bp
  • T to C, chromosome 17 at 56,015,920 bp
  • T to C, chromosome 17 at 63,973,128 bp
  • G to A, chromosome 17 at 64,519,878 bp
  • T to C, chromosome 17 at 74,670,337 bp
  • T to C, chromosome 18 at 12,180,505 bp
  • A to G, chromosome 18 at 37,821,950 bp
  • T to A, chromosome 19 at 6,839,466 bp
  • A to G, chromosome 19 at 29,753,677 bp
  • T to C, chromosome 19 at 30,003,889 bp
  • T to C, chromosome 19 at 59,305,151 bp
  • A to T, chromosome X at 164,156,528 bp
Genotype Determination
Phenotype
G1 male heterozygous mice are viable and fertile. The G1 mice were not characterized prior to archiving.
Strain GQC Summary
The MMRRC Centers have developed a Strain GQC pipeline using MiniMUGA array genotyping to provide additional information on strain backgrounds for MMRRC strains. For more information on whether data may be available, or to request genotyping for a strain of interest, please contact MMRRC_GeneticQC@med.unc.edu. Older strains may not have this information available.
Suggested Control Mice
Littermates of all relevant genotypes.
Donor
Bruce Beutler, M.D., University of Texas Southwestern Medical Center.
Primary Reference
MUTAGENETIX record for R1939 (G1). B. Beutler and colleagues, Center for the Genetics of Host Defense, UT Southwestern, Dallas, TX.
Strain Development
C57BL/6J mice were injected with ENU, resulting in G0 mice that were bred back to C57BL/6J. Sperm was archived from G1 male mice that produced viable G2 mice.


Disclaimer: If MMRRC Strain Genetic Quality Control (GQC; based on MiniMUGA genotyping and analysis) has been completed for this strain, the information might differ from the genetic background information provided by the submitter. MiniMUGA genetic analysis is done on a strain’s tissue samples taken when archived by or ordered from the assigned MMRRC Center.

Colony and Husbandry Information

Colony Surveillance Program and Current Health Reports

Mice recovered from a cryo-archive will have health surveillance performed on recipient females. Health reports will be provided prior to shipment. If you require additional health status information, please email mmrrc@missouri.edu.
Coat Color
Black
MMRRC Breeding System
Random intra-strain mating
Breeding Scheme(s)
When maintaining a live colony, heterozygous mice may be bred together, bred with wild-type siblings, or bred with C57BL/6J inbred mice.
Overall Breeding Performance
Undetermined; during development, mating was done with heterozygous males; viability, fertility and other breeding statistics for heterozygous females and homozygotes are unverified, but presumably would be similar to the C57BL/6J background strain
Average litter size
Undetermined
Recommended wean age
3 weeks

Order Request Information

Limited quantities of breeder mice (recovered litter) are available from a cryoarchive; recovered litter usually available to ship in 3 to 4 months.

Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

Distribution of this strain requires submission of the MMRRC Conditions of Use (COU). A link to the COU web form will be provided via email after an order has been placed; the form should be completed then or the email forwarded to your institutional official for completion.

The donor or their institution limits the distribution to non-profit institutions only.

Additional charges may apply for any special requests. Shipping costs are in addition to the basic distribution/resuscitation fees. Information on shipping costs and any additional charges will be provided by the supplying MMRRC facility.

Click button to Request this one strain. (Use the MMRRC Catalog Search to request more than one strain.)
MMRRC Item # Description Distribution Fee / Unit (US $)
*Shipping & Handling not included*
Units Notes
039957-MU-RESUS Litter recovered from cryo-archive $5,475.00 / Non-Profit Litter Recovered litter4; additional fees for any special requests.
Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

Some MMRRC strains were submitted by the donor as cryopreserved germplasm, and because these strains were not cryopreserved by the MMRRC, we have not assessed the quality, nor genotype, of this material. Our expertise in reviving mice from various qualities of frozen sperm and embryos, using methods like IVF and ICSI, gives us confidence in successful recoveries in most cases. However, due to the uncertain quality of these samples, we'll limit revival attempts to two per order. Additional attempts are available for a fee, on top of standard charges, if requested. It's important to note that some strains may lack the expected mutation, so we can't assure successful order fulfillment until we attempt to revive the strain.

1 The distribution fee covers the expense of rederiving mice from a live mouse; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

2 An aliquot contains a sufficient number of embryos (in one or more vials or straws and based on the transfer success rate of the MMRRC facility) to transfer into one to three recipients. The MMRRC makes no guarantee concerning embryo transfer success experienced in the recipient investigator's laboratory. Neither gender nor genotype ratios are guaranteed.

3 An aliquot is one straw or vial with sufficient sperm to recover at least one litter of mice, as per provided protocols, when performed at the MMRRC facility. The MMRRC makes no guarantee concerning the success of these procedures when performed outside the MMRRC facilities.

4 The distribution fee covers the expense of resuscitating mice from the cryo-archive; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

To request material from the MMRRC: Please fill out our on-line request form (accessible from the catalog search results page, or click the Request this Strain button in the fees section). If you have questions or need assistance completing this form, you may call Customer Service at (800) 910-2291 (in USA or Canada) or (530) 757-5710 (international calls). Before you call, please have with you: the MMRRC item number, quantity needed, Bill-to and Ship-to contact information.