Strain Name:
C57BL/6J-MtgxR1944Btlr/Mmmh
Stock Number:
039962-MU
Citation ID:
RRID:MMRRC_039962-MU
Other Names:
R1944 (G1), C57BL/6J-MtgxR1944Btlr
Major Collection:

Gene Information

Itga6
Name: integrin alpha 6
Synonyms: Cd49f, 5033401O05Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 2
Alteration at locus: Chemically Induced
NCBI: 16403
HGNC: HGNC:6142
Homologene: 20091
Limch1
Name: LIM and calponin homology domains 1
Synonyms: 3732412D22Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 5
Alteration at locus: Chemically Induced
NCBI: 77569
Homologene: 18953
Dysf
Name: dysferlin
Synonyms: 2310004N10Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 6
Alteration at locus: Chemically Induced
NCBI: 26903
HGNC: HGNC:3097
Homologene: 20748
Rgs7
Name: regulator of G protein signaling 7
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 1
Alteration at locus: Chemically Induced
NCBI: 24012
Homologene: 2193
Macf1
Name: microtubule-actin crosslinking factor 1
Synonyms: Aclp7, Acf7, trabeculin alpha
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 4
Alteration at locus: Chemically Induced
NCBI: 11426
Homologene: 136191
Ints6
Name: integrator complex subunit 6
Synonyms: Notch2l, DICE1, 2900075H24Rik, Ddx26
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 14
Alteration at locus: Chemically Induced
NCBI: 18130
VEGA: 14
Homologene: 8121
Dock5
Name: dedicator of cytokinesis 5
Synonyms: rlc, 1110060D06Rik, lr2
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 14
Alteration at locus: Chemically Induced
NCBI: 68813
VEGA: 14
Homologene: 57016
Adgrg1
Name: adhesion G protein-coupled receptor G1
Synonyms: Cyt28, Gpr56
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 8
Alteration at locus: Chemically Induced
NCBI: 14766
HGNC: HGNC:4512
Homologene: 4156
Vps13c
Name: vacuolar protein sorting 13C
Synonyms: C230055H22Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 9
Alteration at locus: Chemically Induced
NCBI: 320528
VEGA: 9
Homologene: 41188
Mycbp2
Name: MYC binding protein 2, E3 ubiquitin protein ligase
Synonyms: Phr1, C130061D10Rik, Pam
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 14
Alteration at locus: Chemically Induced
NCBI: 105689
Homologene: 9005
Ago3
Name: argonaute RISC catalytic subunit 3
Synonyms: eIF2C3, C130014L07Rik, argonaute 3
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 4
Alteration at locus: Chemically Induced
NCBI: 214150
Homologene: 49799
Ddx46
Name: DEAD (Asp-Glu-Ala-Asp) box polypeptide 46
Synonyms: 8430438J23Rik, 2200005K02Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 13
Alteration at locus: Chemically Induced
NCBI: 212880
VEGA: 13
Homologene: 5430
Slc30a6
Name: solute carrier family 30 (zinc transporter), member 6
Synonyms: ZnT6, ZnT-6
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 17
Alteration at locus: Chemically Induced
NCBI: 210148
VEGA: 17
Homologene: 32380
Usp22
Name: ubiquitin specific peptidase 22
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 11
Alteration at locus: Chemically Induced
NCBI: 216825
Homologene: 52664
Ep300
Name: E1A binding protein p300
Synonyms: KAT3B, p300
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 15
Alteration at locus: Chemically Induced
NCBI: 328572
HGNC: HGNC:3373
Homologene: 1094
Ttc37
Name: tetratricopeptide repeat domain 37
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 13
Alteration at locus: Chemically Induced
NCBI: 218343
VEGA: 13
Homologene: 40966
Bdp1
Name: B double prime 1, subunit of RNA polymerase III transcription initiation factor IIIB
Synonyms: B130055N23Rik, TFIIIB90, TAF3B1, Tfnr, G630013P12Rik, TFIIIB150, TFC5
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 13
Alteration at locus: Chemically Induced
NCBI: 544971
Homologene: 34582
Wtip
Name: WT1-interacting protein
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 7
Alteration at locus: Chemically Induced
NCBI: 101543
Homologene: 64353
Tbr1
Name: T-box brain gene 1
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 2
Alteration at locus: Chemically Induced
NCBI: 21375
Homologene: 4807
Erap1
Name: endoplasmic reticulum aminopeptidase 1
Synonyms: Arts1, PILSAP, ERAAP
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 13
Alteration at locus: Chemically Induced
NCBI: 80898
VEGA: 13
Homologene: 56754
Krt33a
Name: keratin 33A
Synonyms: 2310015J09Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 11
Alteration at locus: Chemically Induced
NCBI: 71888
Homologene: 74433
Lama5
Name: laminin, alpha 5
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 2
Alteration at locus: Chemically Induced
NCBI: 16776
HGNC: HGNC:6485
Homologene: 4060
Ndel1
Name: nudE neurodevelopment protein 1 like 1
Synonyms: mNudel, 2600006O07Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 11
Alteration at locus: Chemically Induced
NCBI: 83431
Homologene: 32567
Atp2b1
Name: ATPase, Ca++ transporting, plasma membrane 1
Synonyms: E130111D10Rik, 2810442I22Rik, PMCA1
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 10
Alteration at locus: Chemically Induced
NCBI: 67972
VEGA: 10
HGNC: HGNC:814
Homologene: 55597
Ern1
Name: endoplasmic reticulum (ER) to nucleus signalling 1
Synonyms: Ire1p, Ire1a, 9030414B18Rik, Ire1alpha
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 11
Alteration at locus: Chemically Induced
NCBI: 78943
HGNC: HGNC:3449
Homologene: 55580
Rbm15
Name: RNA binding motif protein 15
Synonyms: C230088J01Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 3
Alteration at locus: Chemically Induced
NCBI: 229700
Homologene: 23383
D5Ertd579e
Name: DNA segment, Chr 5, ERATO Doi 579, expressed
Synonyms: 9030221A05Rik, A930018H20Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 5
Alteration at locus: Chemically Induced
NCBI: 320661
Homologene: 19716
Anxa6
Name: annexin A6
Synonyms: AnxVI, Cabm, Camb, Anx6, Annexin VI
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 11
Alteration at locus: Chemically Induced
NCBI: 11749
HGNC: HGNC:544
Homologene: 55558
Tes
Name: testis derived transcript
Synonyms: D6Ertd352e, testin2, Tes1, Tes2, testin
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 6
Alteration at locus: Chemically Induced
NCBI: 21753
Homologene: 41051
Dync2h1
Name: dynein cytoplasmic 2 heavy chain 1
Synonyms: 4432416O06Rik, DHC2, b2b414Clo, Dnchc2, m407Asp, m152Asp, D030010H02Rik, D330044F14Rik, DHC1b
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 9
Alteration at locus: Chemically Induced
NCBI: 110350
HGNC: HGNC:2962
Homologene: 14468
Vamp3
Name: vesicle-associated membrane protein 3
Synonyms: D130027G05Rik, cellubrevin, VAMP-3, ceb
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 4
Alteration at locus: Chemically Induced
NCBI: 22319
Homologene: 3511
F11r
Name: F11 receptor
Synonyms: Jcam1, BV11 antigen, ESTM33, JAM-1, JAM-A, Ly106
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 1
Alteration at locus: Chemically Induced
NCBI: 16456
Homologene: 14255
Nono
Name: non-POU-domain-containing, octamer binding protein
Synonyms: P54NRB
Type: Gene
Species: Mus musculus (mouse)
Chromosome: X
Alteration at locus: Chemically Induced
NCBI: 53610
HGNC: HGNC:7871
Homologene: 7212
Heatr6
Name: HEAT repeat containing 6
Synonyms: 2700008B19Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 11
Alteration at locus: Chemically Induced
NCBI: 217026
Homologene: 11116
Atrip
Name: ATR interacting protein
Synonyms: 6620401K05Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 9
Alteration at locus: Chemically Induced
NCBI: 235610
Homologene: 15601
Mettl8
Name: methyltransferase like 8
Synonyms: TIP
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 2
Alteration at locus: Chemically Induced
NCBI: 228019
Homologene: 11706
Itpkc
Name: inositol 1,4,5-trisphosphate 3-kinase C
Synonyms: 9130023N17Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 7
Alteration at locus: Chemically Induced
NCBI: 233011
Homologene: 11868
Zscan22
Name: zinc finger and SCAN domain containing 22
Synonyms: D530006B18Rik, Hkr2
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 7
Alteration at locus: Chemically Induced
NCBI: 232878
HGNC: HGNC:4929
Homologene: 68122
Zfhx2
Name: zinc finger homeobox 2
Synonyms: zfh-5
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 14
Alteration at locus: Chemically Induced
NCBI: 239102
Homologene: 52657
Nr2e1
Name: nuclear receptor subfamily 2, group E, member 1
Synonyms: Nr2e1, Tlx, tailless, Mtll
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 10
Alteration at locus: Chemically Induced
NCBI: 21907
HGNC: HGNC:7973
Homologene: 37750
Nfkb2
Name: nuclear factor of kappa light polypeptide gene enhancer in B cells 2, p49/p100
Synonyms: NF kappaB2, p52
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 19
Alteration at locus: Chemically Induced
NCBI: 18034
VEGA: 19
HGNC: HGNC:7795
Homologene: 1873
Tgm3
Name: transglutaminase 3, E polypeptide
Synonyms: TG E, we
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 2
Alteration at locus: Chemically Induced
NCBI: 21818
Homologene: 20690
Myo15
Name: myosin XV
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 11
Alteration at locus: Chemically Induced
NCBI: 17910
HGNC: HGNC:7594
Homologene: 56504
Cubn
Name: cubilin (intrinsic factor-cobalamin receptor)
Synonyms: D2Wsu88e
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 2
Alteration at locus: Chemically Induced
NCBI: 65969
HGNC: HGNC:2548
Homologene: 37434
Cacna1c
Name: calcium channel, voltage-dependent, L type, alpha 1C subunit
Synonyms: (alpha)1 subunit, L-type Cav1.2, Cav1.2, Cchl1a1, D930026N18Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 6
Alteration at locus: Chemically Induced
NCBI: 12288
HGNC: HGNC:1390
Homologene: 55484
Bbs4
Name: Bardet-Biedl syndrome 4 (human)
Synonyms: D9Ertd464e
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 9
Alteration at locus: Chemically Induced
NCBI: 102774
VEGA: 9
HGNC: HGNC:969
Homologene: 13197
Abcb4
Name: ATP-binding cassette, sub-family B (MDR/TAP), member 4
Synonyms: mdr-2, Mdr2, Pgy2, Pgy-2
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 5
Alteration at locus: Chemically Induced
NCBI: 18670
HGNC: HGNC:45
Homologene: 136368
Syne2
Name: spectrin repeat containing, nuclear envelope 2
Synonyms: D12Ertd777e, Nesp2g, nesprin-2, syne-2, dice, Cpfl8, 6820443O06Rik, diminished cone electroretinogram
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 12
Alteration at locus: Chemically Induced
NCBI: 319565
Homologene: 56700
Ptprq
Name: protein tyrosine phosphatase, receptor type, Q
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 10
Alteration at locus: Chemically Induced
NCBI: 237523
HGNC: HGNC:9679
Homologene: 83557
Col7a1
Name: collagen, type VII, alpha 1
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 9
Alteration at locus: Chemically Induced
NCBI: 12836
HGNC: HGNC:2214
Homologene: 73
Nav3
Name: neuron navigator 3
Synonyms: 9630020C08Rik, Pomfil1p, 4732483H20Rik, unc53H3, steerin 3, POMFIL1
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 10
Alteration at locus: Chemically Induced
NCBI: 260315
Homologene: 56688
Glp2r
Name: glucagon-like peptide 2 receptor
Synonyms: GLP-2, 9530092J08Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 11
Alteration at locus: Chemically Induced
NCBI: 93896
HGNC: HGNC:4325
Homologene: 3132
Neb
Name: nebulin
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 2
Alteration at locus: Chemically Induced
NCBI: 17996
HGNC: HGNC:7720
Homologene: 136285
Cfap58
Name: cilia and flagella associated protein 58
Synonyms: Ccdc147, LOC381229
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 19
Alteration at locus: Chemically Induced
NCBI: 381229
VEGA: 19
Homologene: 77312
Adgrv1
Name: adhesion G protein-coupled receptor V1
Synonyms: VLGR1, Mgr1, Mass1, Gpr98
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 13
Alteration at locus: Chemically Induced
NCBI: 110789
Homologene: 19815
Carmil3
Name: capping protein regulator and myosin 1 linker 3
Synonyms: Lrrc16b
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 14
Alteration at locus: Chemically Induced
NCBI: 268747
VEGA: 14
Homologene: 74564
Arnt2
Name: aryl hydrocarbon receptor nuclear translocator 2
Synonyms: bHLHe1
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 7
Alteration at locus: Chemically Induced
NCBI: 11864
Homologene: 7230
Lrpap1
Name: low density lipoprotein receptor-related protein associated protein 1
Synonyms: RAP
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 5
Alteration at locus: Chemically Induced
NCBI: 16976
HGNC: HGNC:6701
Homologene: 37612
Obscn
Name: obscurin, cytoskeletal calmodulin and titin-interacting RhoGEF
Synonyms: LOC380698, OTTMUSG00000005786
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 11
Alteration at locus: Chemically Induced
NCBI: 380698
Homologene: 70869
Klc4
Name: kinesin light chain 4
Synonyms: 1200014P03Rik, Knsl8
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 17
Alteration at locus: Chemically Induced
NCBI: 74764
VEGA: 17
Homologene: 12584
Clec11a
Name: C-type lectin domain family 11, member a
Synonyms: Clecsf3, Scgf
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 7
Alteration at locus: Chemically Induced
NCBI: 20256
Homologene: 2236
Col6a6
Name: collagen, type VI, alpha 6
Synonyms: E330026B02Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 9
Alteration at locus: Chemically Induced
NCBI: 245026
Homologene: 18260
Gm8251
Name: predicted gene 8251
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 1
Alteration at locus: Chemically Induced
NCBI: 102636082
VEGA: 1
Homologene: 141149
Adamts16
Name: a disintegrin-like and metallopeptidase (reprolysin type) with thrombospondin type 1 motif, 16
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 13
Alteration at locus: Chemically Induced
NCBI: 271127
Homologene: 15146
Duox1
Name: dual oxidase 1
Synonyms: THOX1, 9930101G15Rik, NOXEF1, LNOX1
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 2
Alteration at locus: Chemically Induced
NCBI: 99439
HGNC: HGNC:3062
Homologene: 68136
Trim60
Name: tripartite motif-containing 60
Synonyms: Rnf33, 2czf45
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 8
Alteration at locus: Chemically Induced
NCBI: 234329
Homologene: 51876
Scd3
Name: stearoyl-coenzyme A desaturase 3
Synonyms: 4930513N16Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 19
Alteration at locus: Chemically Induced
NCBI: 30049
VEGA: 19
Homologene: 137370
Ppp1r16a
Name: protein phosphatase 1, regulatory subunit 16A
Synonyms: R75527, 2900084E10Rik, Mypt3
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 15
Alteration at locus: Chemically Induced
NCBI: 73062
Homologene: 13161
Caskin1
Name: CASK interacting protein 1
Synonyms: 3300002N10Rik, C630036E02Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 17
Alteration at locus: Chemically Induced
NCBI: 268932
VEGA: 17
Homologene: 25873
Slco1a4
Name: solute carrier organic anion transporter family, member 1a4
Synonyms: Oatp1a4, Oatp2, Slc21a5
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 6
Alteration at locus: Chemically Induced
NCBI: 28250
Homologene: 130782
Clk3
Name: CDC-like kinase 3
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 9
Alteration at locus: Chemically Induced
NCBI: 102414
VEGA: 9
HGNC: HGNC:2071
Homologene: 101534
Ctrb1
Name: chymotrypsinogen B1
Synonyms: 2200008D09Rik, Prt-2
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 8
Alteration at locus: Chemically Induced
NCBI: 66473
Homologene: 88564
Hoxd8
Name: homeobox D8
Synonyms: 4921540P06Rik, Hox-4.3, Hox-5.4
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 2
Alteration at locus: Chemically Induced
NCBI: 15437
HGNC: HGNC:5139
Homologene: 10473
Smgc
Name: submandibular gland protein C
Synonyms: Sfc21, DXImx49e, 2310010P21Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 15
Alteration at locus: Chemically Induced
NCBI: 223809
Adrb2
Name: adrenergic receptor, beta 2
Synonyms: beta 2-adrenoceptor, beta 2-AR, Gpcr7, Adrb-2, Badm
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 18
Alteration at locus: Chemically Induced
NCBI: 11555
VEGA: 18
HGNC: HGNC:286
Homologene: 30948
Tmem132d
Name: transmembrane protein 132D
Synonyms: C630028F04Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 5
Alteration at locus: Chemically Induced
NCBI: 243274
Homologene: 71684
Pde6c
Name: phosphodiesterase 6C, cGMP specific, cone, alpha prime
Synonyms: cpfl1
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 19
Alteration at locus: Chemically Induced
NCBI: 110855
VEGA: 19
HGNC: HGNC:8787
Homologene: 4521
Megf6
Name: multiple EGF-like-domains 6
Synonyms: 2600001P17Rik, Egfl3
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 4
Alteration at locus: Chemically Induced
NCBI: 230971
HGNC: HGNC:3232
Homologene: 45412
Gtdc1
Name: glycosyltransferase-like domain containing 1
Synonyms: E330008O22Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 2
Alteration at locus: Chemically Induced
NCBI: 227835
Homologene: 32590
Map3k19
Name: mitogen-activated protein kinase kinase kinase 19
Synonyms: Ysk4
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 1
Alteration at locus: Chemically Induced
NCBI: 22625
Homologene: 19318
Grid2
Name: glutamate receptor, ionotropic, delta 2
Synonyms: GluRdelta2, B230104L07Rik, tpr
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 6
Alteration at locus: Chemically Induced
NCBI: 14804
HGNC: HGNC:4576
Homologene: 74399
Npc1l1
Name: NPC1 like intracellular cholesterol transporter 1
Synonyms: Niemann-Pick disease, type C1, 9130221N23Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 11
Alteration at locus: Chemically Induced
NCBI: 237636
HGNC: HGNC:7898
Homologene: 56585
Vmn1r235
Name: vomeronasal 1 receptor 235
Synonyms: V1rf2
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 17
Alteration at locus: Chemically Induced
NCBI: 171233
Homologene: 74360
Tex14
Name: testis expressed gene 14
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 11
Alteration at locus: Chemically Induced
NCBI: 83560
Homologene: 12838
Cadps2
Name: Ca2+-dependent activator protein for secretion 2
Synonyms: A230044C21Rik, cpd2, Caps2
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 6
Alteration at locus: Chemically Induced
NCBI: 320405
Homologene: 23060
Miip
Name: migration and invasion inhibitory protein
Synonyms: D4Wsu114e
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 4
Alteration at locus: Chemically Induced
NCBI: 28010
Homologene: 15879
Lgmn
Name: legumain
Synonyms: preprolegumain, AEP, Prsc1
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 12
Alteration at locus: Chemically Induced
NCBI: 19141
HGNC: HGNC:9472
Homologene: 38075
Fam129a
Name: family with sequence similarity 129, member A
Synonyms: Niban
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 1
Alteration at locus: Chemically Induced
NCBI: 63913
Homologene: 62170
Krt82
Name: keratin 82
Synonyms: Krt2-20
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 15
Alteration at locus: Chemically Induced
NCBI: 114566
VEGA: 15
HGNC: HGNC:6459
Homologene: 13200
Ankrd16
Name: ankyrin repeat domain 16
Synonyms: D430029B21Rik, 2810455F06Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 2
Alteration at locus: Chemically Induced
NCBI: 320816
Homologene: 19509
Dll4
Name: delta like canonical Notch ligand 4
Synonyms: Delta4
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 2
Alteration at locus: Chemically Induced
NCBI: 54485
HGNC: HGNC:2910
Homologene: 10411
AI837181
Name: expressed sequence AI837181
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 19
Alteration at locus: Chemically Induced
NCBI: 107242
Homologene: 12869
Vmn2r81
Name: vomeronasal 2, receptor 81
Synonyms: V2rf2, pheromone recepter, EC1-VR2
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 10
Alteration at locus: Chemically Induced
NCBI: 216144
Homologene: 83483
Jchain
Name: immunoglobulin joining chain
Synonyms: Jch, 9530090F24Rik, J chain, Igj
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 5
Alteration at locus: Chemically Induced
NCBI: 16069
HGNC: HGNC:5713
Homologene: 16958
Phactr2
Name: phosphatase and actin regulator 2
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 10
Alteration at locus: Chemically Induced
NCBI: 215789
Homologene: 8816
Vmn2r97
Name: vomeronasal 2, receptor 97
Synonyms: EG627367
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 17
Alteration at locus: Chemically Induced
NCBI: 627367
Homologene: 115024
Klra6
Name: killer cell lectin-like receptor, subfamily A, member 6
Synonyms: Ly49f, Ly49F
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 6
Alteration at locus: Chemically Induced
NCBI: 16637
Homologene: 110821
Man2b2
Name: mannosidase 2, alpha B2
Synonyms: 135 kDa alpha-D-mannosidase
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 5
Alteration at locus: Chemically Induced
NCBI: 17160
Homologene: 7411
Inca1
Name: inhibitor of CDK, cyclin A1 interacting protein 1
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 11
Alteration at locus: Chemically Induced
NCBI: 103844
Homologene: 19481
Gm765
Name: predicted gene 765
Synonyms: LOC330390
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 6
Alteration at locus: Chemically Induced
NCBI: 330390
Homologene: 66631
Acsl6
Name: acyl-CoA synthetase long-chain family member 6
Synonyms: A330035H04Rik, Lacsl, Facl6
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 11
Alteration at locus: Chemically Induced
NCBI: 216739
Homologene: 100939
Col25a1
Name: collagen, type XXV, alpha 1
Synonyms: 2700062B08Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 3
Alteration at locus: Chemically Induced
NCBI: 77018
Homologene: 57111
Krt39
Name: keratin 39
Synonyms: 4732494G06Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 11
Alteration at locus: Chemically Induced
NCBI: 237934
Homologene: 19078
Ccdc92b
Name: coiled-coil domain containing 92B
Synonyms: E130309D14Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 11
Alteration at locus: Chemically Induced
NCBI: 432582
Homologene: 134144
Hacd4
Name: 3-hydroxyacyl-CoA dehydratase 4
Synonyms: Ptplad2, 4933428I03Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 4
Alteration at locus: Chemically Induced
NCBI: 66775
Homologene: 12033
Dctpp1
Name: dCTP pyrophosphatase 1
Synonyms: 2410015N17Rik, RS21-C6
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 7
Alteration at locus: Chemically Induced
NCBI: 66422
Homologene: 11329
Atat1
Name: alpha tubulin acetyltransferase 1
Synonyms: 2610110G12Rik, 3110080J08Rik, 2610008K08Rik, 0610011P08Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 17
Alteration at locus: Chemically Induced
NCBI: 73242
Homologene: 15129
Krt32
Name: keratin 32
Synonyms: Krt1-2, mHa2
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 11
Alteration at locus: Chemically Induced
NCBI: 16670
HGNC: HGNC:6449
Homologene: 68246
Polr2h
Name: polymerase (RNA) II (DNA directed) polypeptide H
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 16
Alteration at locus: Chemically Induced
NCBI: 245841
HGNC: HGNC:9195
Homologene: 4540
Oosp2
Name: oocyte secreted protein 2
Synonyms: LOC225922, Plac1l, Tmem122
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 19
Alteration at locus: Chemically Induced
NCBI: 225922
Homologene: 52157
Gm11127
Name: predicted gene 11127
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 17
Alteration at locus: Chemically Induced
NCBI: 100529082
HGNC: HGNC:4963
Homologene: 133121
Best2
Name: bestrophin 2
Synonyms: Vmd2l1
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 8
Alteration at locus: Chemically Induced
NCBI: 212989
Homologene: 41187
Gpt2
Name: glutamic pyruvate transaminase (alanine aminotransferase) 2
Synonyms: ALT2, 4631422C05Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 8
Alteration at locus: Chemically Induced
NCBI: 108682
Homologene: 68832
Lsmem1
Name: leucine-rich single-pass membrane protein 1
Synonyms: Gm889, LOC380755
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 12
Alteration at locus: Chemically Induced
NCBI: 380755
VEGA: 12
Homologene: 18800
Enkd1
Name: enkurin domain containing 1
Synonyms: E130303B06Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 8
Alteration at locus: Chemically Induced
NCBI: 102124
Homologene: 12957
Rtp2
Name: receptor transporter protein 2
Synonyms: LOC224055
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 16
Alteration at locus: Chemically Induced
NCBI: 224055
VEGA: 16
Homologene: 19503
Art2b
Name: ADP-ribosyltransferase 2b
Synonyms: Rt6, ART2.2, Rt-6, Rt6-2
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 7
Alteration at locus: Chemically Induced
NCBI: 11872
Homologene: 113756
Tmem140
Name: transmembrane protein 140
Synonyms: 1110007F12Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 6
Alteration at locus: Chemically Induced
NCBI: 68487
Homologene: 10116
Olfr1359
Name: olfactory receptor 1359
Synonyms: GA_x6K02T2QHY8-11534186-11533245, MOR256-60, MOR256-35
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 13
Alteration at locus: Chemically Induced
NCBI: 258067
Homologene: 11056
Pdap1
Name: PDGFA associated protein 1
Synonyms: HASPP28, PAP1
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 5
Alteration at locus: Chemically Induced
NCBI: 231887
Homologene: 8927
Dio1
Name: deiodinase, iodothyronine, type I
Synonyms: D1
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 4
Alteration at locus: Chemically Induced
NCBI: 13370
HGNC: HGNC:2883
Homologene: 620
Sun3
Name: Sad1 and UNC84 domain containing 3
Synonyms: D630047F21Rik, Sunc1
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 11
Alteration at locus: Chemically Induced
NCBI: 194974
Homologene: 51273
Psmb3
Name: proteasome (prosome, macropain) subunit, beta type 3
Synonyms: C10-II
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 11
Alteration at locus: Chemically Induced
NCBI: 26446
HGNC: HGNC:9540
Homologene: 2089
Rpl27-ps3
Name: ribosomal protein L27, pseudogene 3
Synonyms: Gm6199
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 18
Alteration at locus: Chemically Induced
NCBI: 621100
VEGA: 18
Pdha1
Name: pyruvate dehydrogenase E1 alpha 1
Synonyms: Pdha-1
Type: Gene
Species: Mus musculus (mouse)
Chromosome: X
Alteration at locus: Chemically Induced
NCBI: 18597
HGNC: HGNC:8806
Homologene: 121491
Genetic Alterations
ENU-induced transitions at the following base pair locations (GRCm38):
  • G to A, chromosome 1 at 44,061,849 bp
  • T to C, chromosome 1 at 127,823,122 bp
  • T to C, chromosome 1 at 151,696,228 bp
  • T to C, chromosome 1 at 171,461,891 bp
  • A to T, chromosome 1 at 175,153,203 bp
  • T to A, chromosome 2 at 11,783,632 bp
  • T to A, chromosome 2 at 13,278,538 bp
  • A to G, chromosome 2 at 44,752,186 bp
  • A to T, chromosome 2 at 52,228,850 bp
  • T to A, chromosome 2 at 61,812,256 bp
  • A to T, chromosome 2 at 70,973,279 bp
  • T to C, chromosome 2 at 71,845,961 bp
  • A to T, chromosome 2 at 74,706,712 bp
  • C to T, chromosome 2 at 119,334,169 bp
  • A to T, chromosome 2 at 122,346,520 bp
  • A to G, chromosome 2 at 130,029,969 bp
  • A to G, chromosome 2 at 180,177,419 bp
  • C to T, chromosome 3 at 107,331,552 bp
  • T to A, chromosome 3 at 130,418,829 bp
  • T to C, chromosome 4 at 88,423,066 bp
  • A to G, chromosome 4 at 107,306,780 bp
  • T to C, chromosome 4 at 123,370,666 bp
  • A to G, chromosome 4 at 126,353,727 bp
  • T to C, chromosome 4 at 147,865,965 bp
  • A to G, chromosome 4 at 151,056,160 bp
  • C to G, chromosome 4 at 154,256,066 bp
  • A to T, chromosome 5 at 8,930,796 bp
  • T to A, chromosome 5 at 35,097,630 bp
  • A to G, chromosome 5 at 36,602,814 bp
  • A to G, chromosome 5 at 36,816,180 bp
  • G to A, chromosome 5 at 66,999,099 bp
  • G to A, chromosome 5 at 88,526,234 bp
  • A to G, chromosome 5 at 127,783,764 bp
  • G to A, chromosome 5 at 145,132,916 bp
  • G to A, chromosome 6 at 17,097,593 bp
  • T to C, chromosome 6 at 23,599,480 bp
  • T to C, chromosome 6 at 34,872,812 bp
  • G to C, chromosome 6 at 63,909,061 bp
  • T to A, chromosome 6 at 84,195,331 bp
  • A to G, chromosome 6 at 98,248,190 bp
  • A to G, chromosome 6 at 118,606,266 bp
  • T to C, chromosome 6 at 130,018,945 bp
  • T to C, chromosome 6 at 141,839,550 bp
  • G to A, chromosome 7 at 12,903,840 bp
  • G to T, chromosome 7 at 27,227,659 bp
  • A to T, chromosome 7 at 34,118,938 bp
  • G to T, chromosome 7 at 44,304,674 bp
  • A to G, chromosome 7 at 84,343,751 bp
  • T to C, chromosome 7 at 101,579,946 bp
  • A to G, chromosome 7 at 127,260,514 bp
  • A to T, chromosome 8 at 65,001,312 bp
  • A to G, chromosome 8 at 85,010,761 bp
  • A to G, chromosome 8 at 85,517,996 bp
  • G to A, chromosome 8 at 95,007,300 bp
  • A to G, chromosome 8 at 105,707,576 bp
  • C to A, chromosome 8 at 111,689,519 bp
  • A to T, chromosome 9 at 7,001,377 bp
  • G to T, chromosome 9 at 57,765,186 bp
  • T to G, chromosome 9 at 59,330,415 bp
  • A to T, chromosome 9 at 67,886,276 bp
  • G to A, chromosome 9 at 105,709,384 bp
  • G to A, chromosome 9 at 108,960,010 bp
  • T to A, chromosome 9 at 109,071,867 bp
  • A to T, chromosome 10 at 13,239,979 bp
  • T to C, chromosome 10 at 42,572,778 bp
  • T to G, chromosome 10 at 79,293,737 bp
  • A to T, chromosome 10 at 99,022,931 bp
  • A to T, chromosome 10 at 107,582,388 bp
  • T to C, chromosome 10 at 109,716,530 bp
  • T to A, chromosome 11 at 6,214,588 bp
  • T to C, chromosome 11 at 9,038,296 bp
  • A to G, chromosome 11 at 54,323,370 bp
  • A to G, chromosome 11 at 54,987,045 bp
  • T to C, chromosome 11 at 59,090,791 bp
  • T to C, chromosome 11 at 60,502,083 bp
  • T to C, chromosome 11 at 61,154,517 bp
  • A to T, chromosome 11 at 67,746,792 bp
  • A to T, chromosome 11 at 68,829,920 bp
  • A to T, chromosome 11 at 70,688,977 bp
  • A to G, chromosome 11 at 74,630,009 bp
  • G to T, chromosome 11 at 83,769,220 bp
  • T to A, chromosome 11 at 87,484,687 bp
  • T to C, chromosome 11 at 97,711,155 bp
  • A to C, chromosome 11 at 99,519,823 bp
  • T to C, chromosome 11 at 100,012,709 bp
  • T to A, chromosome 11 at 100,084,844 bp
  • A to G, chromosome 11 at 106,421,950 bp
  • GTACATACATACATACATACATACATACA to GTACATACATACATACATACATACATACATACA, chromosome 12 at 40,185,261 bp
  • T to C, chromosome 12 at 76,074,544 bp
  • A to T, chromosome 12 at 102,401,924 bp
  • A to T, chromosome 13 at 21,703,117 bp
  • T to C, chromosome 13 at 55,676,120 bp
  • C to T, chromosome 13 at 70,791,886 bp
  • A to G, chromosome 13 at 74,646,639 bp
  • T to A, chromosome 13 at 76,123,554 bp
  • A to T, chromosome 13 at 81,510,911 bp
  • A to T, chromosome 13 at 100,074,381 bp
  • G to T, chromosome 14 at 55,074,732 bp
  • G to T, chromosome 14 at 55,496,317 bp
  • T to C, chromosome 14 at 55,498,630 bp
  • T to C, chromosome 14 at 62,693,640 bp
  • A to T, chromosome 14 at 67,757,135 bp
  • T to A, chromosome 14 at 103,229,404 bp
  • A to G, chromosome 15 at 76,694,294 bp
  • T to C, chromosome 15 at 81,611,537 bp
  • A to G, chromosome 15 at 91,856,646 bp
  • G to A, chromosome 15 at 101,548,535 bp
  • T to A, chromosome 16 at 20,719,046 bp
  • T to A, chromosome 16 at 23,927,566 bp
  • A to G, chromosome 17 at 18,940,238 bp
  • A to C, chromosome 17 at 21,261,523 bp
  • A to G, chromosome 17 at 24,500,771 bp
  • A to G, chromosome 17 at 35,909,340 bp
  • A to G, chromosome 17 at 36,058,005 bp
  • T to C, chromosome 17 at 46,636,627 bp
  • T to G, chromosome 17 at 74,408,863 bp
  • T to A, chromosome 18 at 6,332,669 bp
  • C to A, chromosome 18 at 62,179,413 bp
  • T to C, chromosome 19 at 5,426,229 bp
  • C to T, chromosome 19 at 11,649,595 bp
  • T to A, chromosome 19 at 38,157,519 bp
  • T to C, chromosome 19 at 44,235,780 bp
  • T to A, chromosome 19 at 46,308,052 bp
  • T to C, chromosome 19 at 48,029,224 bp
  • T to C, chromosome X at 101,441,823 bp
  • T to A, chromosome X at 160,127,358 bp
Genotype Determination
Phenotype
G1 male heterozygous mice are viable and fertile. The G1 mice were not characterized prior to archiving.
Strain Development
C57BL/6J mice were injected with ENU, resulting in G0 mice that were bred back to C57BL/6J. Sperm was archived from G1 male mice that produced viable G2 mice.
Suggested Control Mice
Wild-type littermates or C57BL/6J mice
Donor
Bruce Beutler, M.D., University of Texas Southwestern Medical Center.
Primary Reference
MUTAGENETIX record for R1944 (G1). B. Beutler and colleagues, Center for the Genetics of Host Defense, UT Southwestern, Dallas, TX.

Colony and Husbandry Information

Colony Surveillance Program and Current Health Reports

Mice recovered from a cryo-archive will have health surveillance performed on recipient females. Health reports will be provided prior to shipment. If you require additional health status information, please email mmrrc@missouri.edu .
Coat Color
Black
MMRRC Breeding System
Random intra-strain mating
Breeding Scheme(s)
When maintaining a live colony, heterozygous mice may be bred together, bred with wild-type siblings, or bred with C57BL/6J inbred mice.
Overall Breeding Performance
Undetermined; during development, mating was done with heterozygous males; viability, fertility and other breeding statistics for heterozygous females and homozygotes are unverified, but presumably would be similar to the C57BL/6J background strain
Average litter size
Undetermined
Recommended wean age
3 weeks

Order Request Information

Limited quantities of breeder mice (recovered litter) are available from a cryoarchive; recovered litter usually available to ship in 3 to 4 months.

Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

Distribution of this strain requires submission of the MMRRC Conditions of Use (COU). A link to the COU web form will be provided via email after an order has been placed; the form should be completed then or the email forwarded to your institutional official for completion.

The donor or their institution limits the distribution to non-profit institutions only.

Additional charges may apply for any special requests. Shipping costs are in addition to the basic distribution/resuscitation fees. Information on shipping costs and any additional charges will be provided by the supplying MMRRC facility.

Click button to Request this one strain. (Use the MMRRC Catalog Search to request more than one strain.)
MMRRC Item # Description Distribution Fee / Unit (US $) Units Notes
039962-MU-RESUS Litter recovered from cryo-archive $5,475.00 / Non-Profit Litter Recovered litter1; additional fees for any special requests.
Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

Some MMRRC strains were submitted by the donor as cryopreserved germplasm, and because these strains were not cryopreserved by the MMRRC, we have not assessed the quality of this material. We have extensive experience with recovery of mice from cryopreserved sperm and embryos of varying quality, including using techniques such as IVF and ICSI, and are confident that we will have success in most, if not all, cases. However, because of the unknown quality of these frozen samples, we will restrict recovery efforts to two attempts for each order. Subsequent attempts can be performed on a fee-for-service basis, in addition to the standard fees, upon request.

1 The distribution fee covers the expense of resuscitating mice from the cryo-archive; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

2 An aliquot is one straw or vial with sufficient sperm to recover at least one litter of mice, as per provided protocols, when performed at the MMRRC facility. The MMRRC makes no guarantee concerning the success of these procedures when performed outside the MMRRC facilities.

3 An aliquot contains a sufficient number of embryos (in one or more vials or straws and based on the transfer success rate of the MMRRC facility) to transfer into one to three recipients. The MMRRC makes no guarantee concerning embryo transfer success experienced in the recipient investigator's laboratory. Neither gender nor genotype ratios are guaranteed.

To request material from the MMRRC: Please fill out our on-line request form (accessible from the catalog search results page, or click the Request this Strain button in the fees section). If you have questions or need assistance completing this form, you may call Customer Service at (800) 910-2291 (in USA or Canada) or (530) 757-5710 (international calls). Before you call, please have with you: the MMRRC item number, quantity needed, Bill-to and Ship-to contact information.