Loading Mouse GIF
Loading...

Strain Name:
C57BL/6J-MtgxR1944Btlr/Mmmh
Stock Number:
039962-MU
Citation ID:
RRID:MMRRC_039962-MU
Other Names:
R1944 (G1), C57BL/6J-MtgxR1944Btlr
Major Collection:

Strain Information

Itga6
Name: integrin alpha 6
Synonyms: Cd49f, 5033401O05Rik
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 16403
HGNC: HGNC:6142
Homologene: 20091
Limch1
Name: LIM and calponin homology domains 1
Synonyms: 3732412D22Rik
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 77569
Homologene: 18953
Rgs7
Name: regulator of G protein signaling 7
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 24012
Homologene: 2193
Macf1
Name: microtubule-actin crosslinking factor 1
Synonyms: Acf7, Aclp7, trabeculin alpha
Type: Gene
Species: Mouse
Chromosome: 4
NCBI: 11426
Homologene: 136191
Ints6
Name: integrator complex subunit 6
Synonyms: Notch2l, 2900075H24Rik, DICE1, Ddx26
Type: Gene
Species: Mouse
Chromosome: 14
NCBI: 18130
VEGA: 14
Homologene: 8121
Dock5
Name: dedicator of cytokinesis 5
Synonyms: lr2, 1110060D06Rik, rlc
Type: Gene
Species: Mouse
Chromosome: 14
NCBI: 68813
VEGA: 14
Homologene: 57016
Genetic Alterations
ENU-induced transitions at the following base pair locations (GRCm38):
  • G to A, chromosome 1 at 44,061,849 bp
  • T to C, chromosome 1 at 127,823,122 bp
  • T to C, chromosome 1 at 151,696,228 bp
  • T to C, chromosome 1 at 171,461,891 bp
  • A to T, chromosome 1 at 175,153,203 bp
  • T to A, chromosome 2 at 11,783,632 bp
  • T to A, chromosome 2 at 13,278,538 bp
  • A to G, chromosome 2 at 44,752,186 bp
  • A to T, chromosome 2 at 52,228,850 bp
  • T to A, chromosome 2 at 61,812,256 bp
  • A to T, chromosome 2 at 70,973,279 bp
  • T to C, chromosome 2 at 71,845,961 bp
  • A to T, chromosome 2 at 74,706,712 bp
  • C to T, chromosome 2 at 119,334,169 bp
  • A to T, chromosome 2 at 122,346,520 bp
  • A to G, chromosome 2 at 130,029,969 bp
  • A to G, chromosome 2 at 180,177,419 bp
  • C to T, chromosome 3 at 107,331,552 bp
  • T to A, chromosome 3 at 130,418,829 bp
  • T to C, chromosome 4 at 88,423,066 bp
  • A to G, chromosome 4 at 107,306,780 bp
  • T to C, chromosome 4 at 123,370,666 bp
  • A to G, chromosome 4 at 126,353,727 bp
  • T to C, chromosome 4 at 147,865,965 bp
  • A to G, chromosome 4 at 151,056,160 bp
  • C to G, chromosome 4 at 154,256,066 bp
  • A to T, chromosome 5 at 8,930,796 bp
  • T to A, chromosome 5 at 35,097,630 bp
  • A to G, chromosome 5 at 36,602,814 bp
  • A to G, chromosome 5 at 36,816,180 bp
  • G to A, chromosome 5 at 66,999,099 bp
  • G to A, chromosome 5 at 88,526,234 bp
  • A to G, chromosome 5 at 127,783,764 bp
  • G to A, chromosome 5 at 145,132,916 bp
  • G to A, chromosome 6 at 17,097,593 bp
  • T to C, chromosome 6 at 23,599,480 bp
  • T to C, chromosome 6 at 34,872,812 bp
  • G to C, chromosome 6 at 63,909,061 bp
  • T to A, chromosome 6 at 84,195,331 bp
  • A to G, chromosome 6 at 98,248,190 bp
  • A to G, chromosome 6 at 118,606,266 bp
  • T to C, chromosome 6 at 130,018,945 bp
  • T to C, chromosome 6 at 141,839,550 bp
  • G to A, chromosome 7 at 12,903,840 bp
  • G to T, chromosome 7 at 27,227,659 bp
  • A to T, chromosome 7 at 34,118,938 bp
  • G to T, chromosome 7 at 44,304,674 bp
  • A to G, chromosome 7 at 84,343,751 bp
  • T to C, chromosome 7 at 101,579,946 bp
  • A to G, chromosome 7 at 127,260,514 bp
  • A to T, chromosome 8 at 65,001,312 bp
  • A to G, chromosome 8 at 85,010,761 bp
  • A to G, chromosome 8 at 85,517,996 bp
  • G to A, chromosome 8 at 95,007,300 bp
  • A to G, chromosome 8 at 105,707,576 bp
  • C to A, chromosome 8 at 111,689,519 bp
  • A to T, chromosome 9 at 7,001,377 bp
  • G to T, chromosome 9 at 57,765,186 bp
  • T to G, chromosome 9 at 59,330,415 bp
  • A to T, chromosome 9 at 67,886,276 bp
  • G to A, chromosome 9 at 105,709,384 bp
  • G to A, chromosome 9 at 108,960,010 bp
  • T to A, chromosome 9 at 109,071,867 bp
  • A to T, chromosome 10 at 13,239,979 bp
  • T to C, chromosome 10 at 42,572,778 bp
  • T to G, chromosome 10 at 79,293,737 bp
  • A to T, chromosome 10 at 99,022,931 bp
  • A to T, chromosome 10 at 107,582,388 bp
  • T to C, chromosome 10 at 109,716,530 bp
  • T to A, chromosome 11 at 6,214,588 bp
  • T to C, chromosome 11 at 9,038,296 bp
  • A to G, chromosome 11 at 54,323,370 bp
  • A to G, chromosome 11 at 54,987,045 bp
  • T to C, chromosome 11 at 59,090,791 bp
  • T to C, chromosome 11 at 60,502,083 bp
  • T to C, chromosome 11 at 61,154,517 bp
  • A to T, chromosome 11 at 67,746,792 bp
  • A to T, chromosome 11 at 68,829,920 bp
  • A to T, chromosome 11 at 70,688,977 bp
  • A to G, chromosome 11 at 74,630,009 bp
  • G to T, chromosome 11 at 83,769,220 bp
  • T to A, chromosome 11 at 87,484,687 bp
  • T to C, chromosome 11 at 97,711,155 bp
  • A to C, chromosome 11 at 99,519,823 bp
  • T to C, chromosome 11 at 100,012,709 bp
  • T to A, chromosome 11 at 100,084,844 bp
  • A to G, chromosome 11 at 106,421,950 bp
  • GTACATACATACATACATACATACATACA to GTACATACATACATACATACATACATACATACA, chromosome 12 at 40,185,261 bp
  • T to C, chromosome 12 at 76,074,544 bp
  • A to T, chromosome 12 at 102,401,924 bp
  • A to T, chromosome 13 at 21,703,117 bp
  • T to C, chromosome 13 at 55,676,120 bp
  • C to T, chromosome 13 at 70,791,886 bp
  • A to G, chromosome 13 at 74,646,639 bp
  • T to A, chromosome 13 at 76,123,554 bp
  • A to T, chromosome 13 at 81,510,911 bp
  • A to T, chromosome 13 at 100,074,381 bp
  • G to T, chromosome 14 at 55,074,732 bp
  • G to T, chromosome 14 at 55,496,317 bp
  • T to C, chromosome 14 at 55,498,630 bp
  • T to C, chromosome 14 at 62,693,640 bp
  • A to T, chromosome 14 at 67,757,135 bp
  • T to A, chromosome 14 at 103,229,404 bp
  • A to G, chromosome 15 at 76,694,294 bp
  • T to C, chromosome 15 at 81,611,537 bp
  • A to G, chromosome 15 at 91,856,646 bp
  • G to A, chromosome 15 at 101,548,535 bp
  • T to A, chromosome 16 at 20,719,046 bp
  • T to A, chromosome 16 at 23,927,566 bp
  • A to G, chromosome 17 at 18,940,238 bp
  • A to C, chromosome 17 at 21,261,523 bp
  • A to G, chromosome 17 at 24,500,771 bp
  • A to G, chromosome 17 at 35,909,340 bp
  • A to G, chromosome 17 at 36,058,005 bp
  • T to C, chromosome 17 at 46,636,627 bp
  • T to G, chromosome 17 at 74,408,863 bp
  • T to A, chromosome 18 at 6,332,669 bp
  • C to A, chromosome 18 at 62,179,413 bp
  • T to C, chromosome 19 at 5,426,229 bp
  • C to T, chromosome 19 at 11,649,595 bp
  • T to A, chromosome 19 at 38,157,519 bp
  • T to C, chromosome 19 at 44,235,780 bp
  • T to A, chromosome 19 at 46,308,052 bp
  • T to C, chromosome 19 at 48,029,224 bp
  • T to C, chromosome X at 101,441,823 bp
  • T to A, chromosome X at 160,127,358 bp
Genotype Determination
Phenotype
G1 male heterozygous mice are viable and fertile. The G1 mice were not characterized prior to archiving.
Strain GQC Summary
Gene Specific Genotyping:

To request gene-specific and other genotyping services for a strain, please contact the distribution MMRRC Center for more information.

Background Genetic Quality:

The MMRRC has developed a Genetic Quality Control pipeline using the MiniMUGA array to provide additional information to identify and validate genetic backgrounds of MMRRC strains. For more information on whether genetic background data is available, please contact MMRRC_GeneticQC@med.unc.edu. Note: that MiniMUGA genetic background data is not available on all strains, but can be ordered if desired.

Suggested Control Mice
Littermates of all relevant genotypes.
Submitter
Bruce Beutler, M.D., University of Texas Southwestern Medical Center.
Primary Reference
MUTAGENETIX record for R1944 (G1). B. Beutler and colleagues, Center for the Genetics of Host Defense, UT Southwestern, Dallas, TX.
Strain Development
C57BL/6J mice were injected with ENU, resulting in G0 mice that were bred back to C57BL/6J. Sperm was archived from G1 male mice that produced viable G2 mice.


Disclaimer: If MMRRC Strain Genetic Quality Control (GQC; based on MiniMUGA genotyping and analysis) has been completed for this strain, the information might differ from the genetic background information provided by the submitter. MiniMUGA genetic analysis is done on a strain’s tissue samples taken when archived by or ordered from the assigned MMRRC Center.

Colony and Husbandry Information

Colony Surveillance Program and Current Health Reports

Mice recovered from a cryo-archive will have health surveillance performed on recipient females. Health reports will be provided prior to shipment. If you require additional health status information, please email mmrrc@missouri.edu.
Coat Color
Black
MMRRC Breeding System
Random intra-strain mating
Breeding Scheme(s)
When maintaining a live colony, heterozygous mice may be bred together, bred with wild-type siblings, or bred with C57BL/6J inbred mice.
Overall Breeding Performance
Undetermined; during development, mating was done with heterozygous males; viability, fertility and other breeding statistics for heterozygous females and homozygotes are unverified, but presumably would be similar to the C57BL/6J background strain
Average litter size
Undetermined
Recommended wean age
3 weeks

Order Information

Limited quantities of breeder mice (recovered litter) are available from a cryoarchive; recovered litter usually available to ship in 3 to 4 months.

Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

Distribution of this strain requires submission of the MMRRC Conditions of Use (COU). A link to the COU web form will be provided via email after an order has been placed; the form should be completed then or the email forwarded to your institutional official for completion.

The submitter or their institution limits the distribution to non-profit institutions only.

Additional charges may apply for any special requests. Shipping costs are in addition to the basic distribution/resuscitation fees. Information on shipping costs and any additional charges will be provided by the supplying MMRRC facility.

Click button to Request this one strain. (Use the MMRRC Catalog Search to request more than one strain.)
MMRRC Item # Description Distribution Fee / Unit (US $)
*Shipping & Handling not included*
Units Notes
039962-MU-RESUS Litter recovered from cryo-archive $5,475.00 / Non-Profit Litter Recovered litter4; additional fees for any special requests.
Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

Some MMRRC strains were submitted by the submitter as cryopreserved germplasm, and because these strains were not cryopreserved by the MMRRC, we have not assessed the quality, nor genotype, of this material. Our expertise in reviving mice from various qualities of frozen sperm and embryos, using methods like IVF and ICSI, gives us confidence in successful recoveries in most cases. However, due to the uncertain quality of these samples, we'll limit revival attempts to two per order. Additional attempts are available for a fee, on top of standard charges, if requested. It's important to note that some strains may lack the expected mutation, so we can't assure successful order fulfillment until we attempt to revive the strain.

1 The distribution fee covers the expense of rederiving mice from a live mouse; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

2 An aliquot contains a sufficient number of embryos (in one or more vials or straws and based on the transfer success rate of the MMRRC facility) to transfer into one to three recipients. The MMRRC makes no guarantee concerning embryo transfer success experienced in the recipient investigator's laboratory. Neither gender nor genotype ratios are guaranteed.

3 An aliquot is one straw or vial with sufficient sperm to recover at least one litter of mice, as per provided protocols, when performed at the MMRRC facility. The MMRRC makes no guarantee concerning the success of these procedures when performed outside the MMRRC facilities.

4 The distribution fee covers the expense of resuscitating mice from the cryo-archive; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

To request material from the MMRRC: Please fill out our on-line request form (accessible from the catalog search results page, or click the Request this Strain button in the fees section). If you have questions or need assistance completing this form, you may call Customer Service at (800) 910-2291 (in USA or Canada) or (530) 757-5710 (international calls). Before you call, please have with you: the MMRRC item number, quantity needed, Bill-to and Ship-to contact information.