Strain Name:
C57BL/6J-MtgxR2016Btlr/Mmmh
Stock Number:
040025-MU
Citation ID:
RRID:MMRRC_040025-MU
Other Names:
R2016 (G1), C57BL/6J-MtgxR2016Btlr
Major Collection:

Gene Information

Angpt2
Name: angiopoietin 2
Synonyms: Ang-2, Ang2
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 8
Alteration at locus: Chemically Induced
NCBI: 11601
HGNC: HGNC:485
Homologene: 22401
Eya1
Name: EYA transcriptional coactivator and phosphatase 1
Synonyms: bor
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 1
Alteration at locus: Chemically Induced
NCBI: 14048
HGNC: HGNC:3519
Homologene: 74943
Rasgrp2
Name: RAS, guanyl releasing protein 2
Synonyms: CalDAG-GEFI, Caldaggef1
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 19
Alteration at locus: Chemically Induced
NCBI: 19395
HGNC: HGNC:9879
Homologene: 4250
Efemp1
Name: epidermal growth factor-containing fibulin-like extracellular matrix protein 1
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 11
Alteration at locus: Chemically Induced
NCBI: 216616
HGNC: HGNC:3218
Homologene: 3028
Blm
Name: Bloom syndrome, RecQ like helicase
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 7
Alteration at locus: Chemically Induced
NCBI: 12144
HGNC: HGNC:1058
Homologene: 47902
Cbfa2t2
Name: CBFA2/RUNX1 translocation partner 2
Synonyms: C330013D05Rik, Cbfa2t2h, MTGR1
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 2
Alteration at locus: Chemically Induced
NCBI: 12396
HGNC: HGNC:1536
Homologene: 3733
Gnl3
Name: guanine nucleotide binding protein-like 3 (nucleolar)
Synonyms: nucleostemin, NS
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 14
Alteration at locus: Chemically Induced
NCBI: 30877
VEGA: 14
Homologene: 56670
Itsn1
Name: intersectin 1 (SH3 domain protein 1A)
Synonyms: Eh domain, SH3 domain regulator of endocytosis 1, Intersectin-L, Ese1, Sh3p17, EHSH1
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 16
Alteration at locus: Chemically Induced
NCBI: 16443
HGNC: HGNC:6183
Homologene: 2277
B3gnt2
Name: UDP-GlcNAc:betaGal beta-1,3-N-acetylglucosaminyltransferase 2
Synonyms: B3gnt1, B3Galt6
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 11
Alteration at locus: Chemically Induced
NCBI: 53625
Homologene: 4797
Lrp5
Name: low density lipoprotein receptor-related protein 5
Synonyms: LRP7, LR3
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 19
Alteration at locus: Chemically Induced
NCBI: 16973
HGNC: HGNC:6697
Homologene: 1746
Dcaf1
Name: DDB1 and CUL4 associated factor 1
Synonyms: B930007L02Rik, Vprbp
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 9
Alteration at locus: Chemically Induced
NCBI: 321006
Homologene: 8805
Pds5a
Name: PDS5 cohesin associated factor A
Synonyms: 9030416H16Rik, E230024D05Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 5
Alteration at locus: Chemically Induced
NCBI: 71521
Homologene: 22877
Akap13
Name: A kinase (PRKA) anchor protein 13
Synonyms: 1700026G02Rik, 5830460E08Rik, 5730522G15Rik, AKAP-Lbc, PROTO-LBC, PROTO-LB, Ht31
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 7
Alteration at locus: Chemically Induced
NCBI: 75547
HGNC: HGNC:371
Homologene: 4903
Sall1
Name: spalt like transcription factor 1
Synonyms: Msal-3
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 8
Alteration at locus: Chemically Induced
NCBI: 58198
Homologene: 2230
Spata5
Name: spermatogenesis associated 5
Synonyms: C78064, Spaf, 2510048F20Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 3
Alteration at locus: Chemically Induced
NCBI: 57815
Homologene: 56920
Plcg1
Name: phospholipase C, gamma 1
Synonyms: Plc-gamma1, Cded, Plc-1, Plcg-1
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 2
Alteration at locus: Chemically Induced
NCBI: 18803
HGNC: HGNC:9065
Homologene: 1997
Mettl25
Name: methyltransferase like 25
Synonyms: BC067068
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 10
Alteration at locus: Chemically Induced
NCBI: 216292
Homologene: 32774
Plk1
Name: polo like kinase 1
Synonyms: Plk, STPK13
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 7
Alteration at locus: Chemically Induced
NCBI: 18817
HGNC: HGNC:9077
Homologene: 3690
Dclk2
Name: doublecortin-like kinase 2
Synonyms: Dcamkl2, Click-II, 6330415M09Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 3
Alteration at locus: Chemically Induced
NCBI: 70762
Homologene: 69431
Cc2d2a
Name: coiled-coil and C2 domain containing 2A
Synonyms: b2b1035Clo, 5730509K17Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 5
Alteration at locus: Chemically Induced
NCBI: 231214
Homologene: 18159
Trim66
Name: tripartite motif-containing 66
Synonyms: D7H11orf29, Tif1d
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 7
Alteration at locus: Chemically Induced
NCBI: 330627
Homologene: 28044
Tasor2
Name: transcription activation suppressor family member 2
Synonyms: BC016423, Fam208b
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 13
Alteration at locus: Chemically Induced
NCBI: 105203
VEGA: 13
Homologene: 26435
Ptprj
Name: protein tyrosine phosphatase, receptor type, J
Synonyms: Byp, CD148, DEP-1, RPTPJ, Scc-1, Scc1
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 2
Alteration at locus: Chemically Induced
NCBI: 19271
HGNC: HGNC:9673
Homologene: 2130
Adra2c
Name: adrenergic receptor, alpha 2c
Synonyms: alpha2-C4, subtype alpha2-C4, alpha2C, [a]2C, Adra-2c
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 5
Alteration at locus: Chemically Induced
NCBI: 11553
HGNC: HGNC:283
Homologene: 20170
Bcam
Name: basal cell adhesion molecule
Synonyms: 1200005K12Rik, Lu, B-CAM
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 7
Alteration at locus: Chemically Induced
NCBI: 57278
HGNC: HGNC:6722
Homologene: 21149
Erap1
Name: endoplasmic reticulum aminopeptidase 1
Synonyms: Arts1, PILSAP, ERAAP
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 13
Alteration at locus: Chemically Induced
NCBI: 80898
VEGA: 13
Homologene: 56754
Apob
Name: apolipoprotein B
Synonyms: apob-48, apob-100
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 12
Alteration at locus: Chemically Induced
NCBI: 238055
HGNC: HGNC:603
Homologene: 328
Bcan
Name: brevican
Synonyms: Cspg7
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 3
Alteration at locus: Chemically Induced
NCBI: 12032
Homologene: 7244
Pah
Name: phenylalanine hydroxylase
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 10
Alteration at locus: Chemically Induced
NCBI: 18478
HGNC: HGNC:8582
Homologene: 234
Emc10
Name: ER membrane protein complex subunit 10
Synonyms: Mirta22, 5430410O10Rik, 2310044H10Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 7
Alteration at locus: Chemically Induced
NCBI: 69683
Homologene: 18036
Kif13a
Name: kinesin family member 13A
Synonyms: 4930505I07Rik, N-3 kinesin
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 13
Alteration at locus: Chemically Induced
NCBI: 16553
VEGA: 13
Homologene: 22589
Midn
Name: midnolin
Synonyms: 3000003C15Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 10
Alteration at locus: Chemically Induced
NCBI: 59090
Homologene: 32510
Efl1
Name: elongation factor like GTPase 1
Synonyms: Eftud1, 4932434J20Rik, 6030468D11Rik, D7Ertd791e
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 7
Alteration at locus: Chemically Induced
NCBI: 101592
Homologene: 11599
Nle1
Name: notchless homolog 1
Synonyms: l11Jus1, Nle, notchless, l11Jus4
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 11
Alteration at locus: Chemically Induced
NCBI: 217011
Homologene: 5494
Mtmr9
Name: myotubularin related protein 9
Synonyms: MTMR8, 9430075G12Rik, LIP-STYX, mMTMH3
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 14
Alteration at locus: Chemically Induced
NCBI: 210376
VEGA: 14
Homologene: 9148
Zcchc2
Name: zinc finger, CCHC domain containing 2
Synonyms: 9930114B20Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 1
Alteration at locus: Chemically Induced
NCBI: 227449
Homologene: 9808
Klhl20
Name: kelch-like 20
Synonyms: D930050H05Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 1
Alteration at locus: Chemically Induced
NCBI: 226541
Homologene: 8699
Prss35
Name: protease, serine 35
Synonyms: 6030424L22Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 9
Alteration at locus: Chemically Induced
NCBI: 244954
Homologene: 17734
Nr4a3
Name: nuclear receptor subfamily 4, group A, member 3
Synonyms: Nor1, MINOR, NOR-1, TEC
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 4
Alteration at locus: Chemically Induced
NCBI: 18124
HGNC: HGNC:7982
Homologene: 5074
Atp8b1
Name: ATPase, class I, type 8B, member 1
Synonyms: Ic, FIC1
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 18
Alteration at locus: Chemically Induced
NCBI: 54670
VEGA: 18
HGNC: HGNC:3706
Homologene: 21151
Ddr2
Name: discoidin domain receptor family, member 2
Synonyms: Ntrkr3
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 1
Alteration at locus: Chemically Induced
NCBI: 18214
HGNC: HGNC:2731
Homologene: 68505
Pitpnm1
Name: phosphatidylinositol transfer protein, membrane-associated 1
Synonyms: RdgB, DRES9
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 19
Alteration at locus: Chemically Induced
NCBI: 18739
HGNC: HGNC:9003
Homologene: 3608
Abca13
Name: ATP-binding cassette, sub-family A (ABC1), member 13
Synonyms: A930002G16Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 11
Alteration at locus: Chemically Induced
NCBI: 268379
Homologene: 27991
Dnah2
Name: dynein, axonemal, heavy chain 2
Synonyms: 2900022L05Rik, Dnahc2, D330014H01Rik, Dnhd3
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 11
Alteration at locus: Chemically Induced
NCBI: 327954
HGNC: HGNC:2948
Homologene: 72110
Slc5a8
Name: solute carrier family 5 (iodide transporter), member 8
Synonyms: SMCT
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 10
Alteration at locus: Chemically Induced
NCBI: 216225
VEGA: 10
Homologene: 64832
Cyp2c70
Name: cytochrome P450, family 2, subfamily c, polypeptide 70
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 19
Alteration at locus: Chemically Induced
NCBI: 226105
Homologene: 120027
Fsip2
Name: fibrous sheath-interacting protein 2
Synonyms: OTTMUSG00000013335
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 2
Alteration at locus: Chemically Induced
NCBI: 241516
Homologene: 110349
Nalcn
Name: sodium leak channel, non-selective
Synonyms: A530023G15Rik, Vgcnl1
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 14
Alteration at locus: Chemically Induced
NCBI: 338370
VEGA: 14
Homologene: 21832
Zfp282
Name: zinc finger protein 282
Synonyms: HUB1
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 6
Alteration at locus: Chemically Induced
NCBI: 101095
Homologene: 2647
Plcb1
Name: phospholipase C, beta 1
Synonyms: 3110043I21Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 2
Alteration at locus: Chemically Induced
NCBI: 18795
Homologene: 22876
Pwwp2b
Name: PWWP domain containing 2B
Synonyms: D7Ertd517e, D930023J19Rik, Pwwp2
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 7
Alteration at locus: Chemically Induced
NCBI: 101631
Homologene: 19056
Vwce
Name: von Willebrand factor C and EGF domains
Synonyms: 1300015B04Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 19
Alteration at locus: Chemically Induced
NCBI: 71768
VEGA: 19
Homologene: 17651
Accs
Name: 1-aminocyclopropane-1-carboxylate synthase (non-functional)
Synonyms: 2610203E10Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 2
Alteration at locus: Chemically Induced
NCBI: 329470
Homologene: 75335
Prkcg
Name: protein kinase C, gamma
Synonyms: Pkcc, PKCgamma, Prkcc
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 7
Alteration at locus: Chemically Induced
NCBI: 18752
HGNC: HGNC:9402
Homologene: 20602
Slc25a30
Name: solute carrier family 25, member 30
Synonyms: 4933433D23Rik, KMCP1
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 14
Alteration at locus: Chemically Induced
NCBI: 67554
VEGA: 14
Homologene: 57046
Myh3
Name: myosin, heavy polypeptide 3, skeletal muscle, embryonic
Synonyms: Myhse, Myhs-e, MyHC-emb
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 11
Alteration at locus: Chemically Induced
NCBI: 17883
HGNC: HGNC:7573
Homologene: 20553
Zfp352
Name: zinc finger protein 352
Synonyms: 2czf48
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 4
Alteration at locus: Chemically Induced
NCBI: 236537
Homologene: 45160
Ttll9
Name: tubulin tyrosine ligase-like family, member 9
Synonyms: 1700016F23Rik, 4930509O20Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 2
Alteration at locus: Chemically Induced
NCBI: 74711
Homologene: 41769
Slc5a4a
Name: solute carrier family 5, member 4a
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 10
Alteration at locus: Chemically Induced
NCBI: 64452
VEGA: 10
Csf2ra
Name: colony stimulating factor 2 receptor, alpha, low-affinity (granulocyte-macrophage)
Synonyms: Csfgmra, GM-CSF-Ra, GM-CSFRalpha, CD116
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 19
Alteration at locus: Chemically Induced
NCBI: 12982
VEGA: 19
HGNC: HGNC:2435
Homologene: 48406
Abca8a
Name: ATP-binding cassette, sub-family A (ABC1), member 8a
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 11
Alteration at locus: Chemically Induced
NCBI: 217258
HGNC: HGNC:38
Homologene: 131160
Mamdc2
Name: MAM domain containing 2
Synonyms: mamcan, 1200015L10Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 19
Alteration at locus: Chemically Induced
NCBI: 71738
VEGA: 19
Homologene: 17722
Tmem229a
Name: transmembrane protein 229A
Synonyms: 6332401O19Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 6
Alteration at locus: Chemically Induced
NCBI: 319832
Homologene: 85312
Col4a2
Name: collagen, type IV, alpha 2
Synonyms: Col4a-2
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 8
Alteration at locus: Chemically Induced
NCBI: 12827
HGNC: HGNC:2203
Homologene: 1390
Kynu
Name: kynureninase
Synonyms: 4432411A05Rik, L-kynurenine hydrolase
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 2
Alteration at locus: Chemically Induced
NCBI: 70789
HGNC: HGNC:6469
Homologene: 2925
Gbp7
Name: guanylate binding protein 7
Synonyms: 9830147J24Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 3
Alteration at locus: Chemically Induced
NCBI: 229900
Homologene: 138296
Nmrk1
Name: nicotinamide riboside kinase 1
Synonyms: BC016495, D630020N23Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 19
Alteration at locus: Chemically Induced
NCBI: 225994
Homologene: 6787
Adck1
Name: aarF domain containing kinase 1
Synonyms: 2610005A10Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 12
Alteration at locus: Chemically Induced
NCBI: 72113
VEGA: 12
Homologene: 6493
Plcl2
Name: phospholipase C-like 2
Synonyms: Plce2, PRIP-2
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 17
Alteration at locus: Chemically Induced
NCBI: 224860
VEGA: 17
HGNC: HGNC:9064
Homologene: 9052
Flnc
Name: filamin C, gamma
Synonyms: actin binding protein 280, Fln2, 1110055E19Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 6
Alteration at locus: Chemically Induced
NCBI: 68794
HGNC: HGNC:3756
Homologene: 37481
Dsg1a
Name: desmoglein 1 alpha
Synonyms: Dsg1
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 18
Alteration at locus: Chemically Induced
NCBI: 13510
HGNC: HGNC:3048
Homologene: 1463
Mylk
Name: myosin, light polypeptide kinase
Synonyms: MLCK108, A930019C19Rik, Mlck, nmMlck, telokin, MLCK210, 9530072E15Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 16
Alteration at locus: Chemically Induced
NCBI: 107589
HGNC: HGNC:7590
Homologene: 14202
Cyp46a1
Name: cytochrome P450, family 46, subfamily a, polypeptide 1
Synonyms: cholestrol 24-hydroxylase, Cyp46
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 12
Alteration at locus: Chemically Induced
NCBI: 13116
VEGA: 12
HGNC: HGNC:2641
Homologene: 134501
Has1
Name: hyaluronan synthase 1
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 17
Alteration at locus: Chemically Induced
NCBI: 15116
VEGA: 17
HGNC: HGNC:4818
Homologene: 1165
Fam71e2
Name: family with sequence similarity 71, member E2
Synonyms: 4930401F20Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 7
Alteration at locus: Chemically Induced
NCBI: 243822
Homologene: 89225
Stat6
Name: signal transducer and activator of transcription 6
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 10
Alteration at locus: Chemically Induced
NCBI: 20852
Homologene: 2373
Mapk8ip1
Name: mitogen-activated protein kinase 8 interacting protein 1
Synonyms: Skip, IB1, mjip-2a, Prkm8ip, MAPK8IP1, Jip1, JIP-1
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 2
Alteration at locus: Chemically Induced
NCBI: 19099
HGNC: HGNC:6882
Homologene: 31314
Adgrg6
Name: adhesion G protein-coupled receptor G6
Synonyms: LOC215798, Gpr126, DREG, 1190004A11Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 10
Alteration at locus: Chemically Induced
NCBI: 215798
Homologene: 10724
Fam234a
Name: family with sequence similarity 234, member A
Synonyms: Itfg3
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 17
Alteration at locus: Chemically Induced
NCBI: 106581
Homologene: 12932
Rnf180
Name: ring finger protein 180
Synonyms: Rines, 3110001E11Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 13
Alteration at locus: Chemically Induced
NCBI: 71816
VEGA: 13
Homologene: 18677
Kcnh8
Name: potassium voltage-gated channel, subfamily H (eag-related), member 8
Synonyms: C130090D05Rik, Kv12.1, ELK1
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 17
Alteration at locus: Chemically Induced
NCBI: 211468
Homologene: 14332
Emilin3
Name: elastin microfibril interfacer 3
Synonyms: EMILIN-T, Emilin5, 1110013O17Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 2
Alteration at locus: Chemically Induced
NCBI: 280635
Homologene: 18817
Lrif1
Name: ligand dependent nuclear receptor interacting factor 1
Synonyms: 2010012G17Rik, 4933421E11Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 3
Alteration at locus: Chemically Induced
NCBI: 321000
Homologene: 10160
Tmem132b
Name: transmembrane protein 132B
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 5
Alteration at locus: Chemically Induced
NCBI: 208151
Homologene: 28135
Dpysl5
Name: dihydropyrimidinase-like 5
Synonyms: CRAM, CRMP-5, Crmp5
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 5
Alteration at locus: Chemically Induced
NCBI: 65254
Homologene: 41347
Vmn2r69
Name: vomeronasal 2, receptor 69
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 7
Alteration at locus: Chemically Induced
NCBI: 330581
Homologene: 115466
Prl7d1
Name: prolactin family 7, subfamily d, member 1
Synonyms: Plfr, PRP, PLF-RP
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 13
Alteration at locus: Chemically Induced
NCBI: 18814
Homologene: 7894
Sema6c
Name: sema domain, transmembrane domain (TM), and cytoplasmic domain, (semaphorin) 6C
Synonyms: Semay, Sema Y
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 3
Alteration at locus: Chemically Induced
NCBI: 20360
Homologene: 7931
Ttc30a1
Name: tetratricopeptide repeat domain 30A1
Synonyms: 4930506L13Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 2
Alteration at locus: Chemically Induced
NCBI: 78802
Homologene: 136638
Olfr724
Name: olfactory receptor 724
Synonyms: GA_x6K02T2PMLR-5645801-5644872, MOR247-2
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 14
Alteration at locus: Chemically Induced
NCBI: 258485
Homologene: 71986
Eid1
Name: EP300 interacting inhibitor of differentiation 1
Synonyms: EID-1, 2610002K20Rik, ORF12, Cri1
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 2
Alteration at locus: Chemically Induced
NCBI: 58521
HGNC: HGNC:1191
Homologene: 49376
Olfr906
Name: olfactory receptor 906
Synonyms: MOR167-2, GA_x6K02T2PVTD-32194085-32195020
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 9
Alteration at locus: Chemically Induced
NCBI: 258799
VEGA: 9
Homologene: 132439
Gm10608
Name: predicted gene 10608
Synonyms: EG546165
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 9
Alteration at locus: Chemically Induced
NCBI: 546165
VEGA: 9
Slc17a1
Name: solute carrier family 17 (sodium phosphate), member 1
Synonyms: NAPI-1, Npt1
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 13
Alteration at locus: Chemically Induced
NCBI: 20504
Homologene: 48324
Olfr963
Name: olfactory receptor 963
Synonyms: MOR224-13, MOR224-7P, GA_x6K02T2PVTD-33365879-33366814
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 9
Alteration at locus: Chemically Induced
NCBI: 258087
VEGA: 9
Homologene: 105216
Olfr1133
Name: olfactory receptor 1133
Synonyms: GA_x6K02T2Q125-49151278-49150337, MOR176-2
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 2
Alteration at locus: Chemically Induced
NCBI: 258348
Taar7d
Name: trace amine-associated receptor 7D
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 10
Alteration at locus: Chemically Induced
NCBI: 435206
Homologene: 115653
Cyp4f15
Name: cytochrome P450, family 4, subfamily f, polypeptide 15
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 17
Alteration at locus: Chemically Induced
NCBI: 106648
HGNC: HGNC:2648
Homologene: 80199
Olfr1288
Name: olfactory receptor 1288
Synonyms: MOR245-9, GA_x6K02T2Q125-72530279-72531217
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 2
Alteration at locus: Chemically Induced
NCBI: 258395
Homologene: 88360
1700025C18Rik
Name: RIKEN cDNA 1700025C18 gene
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 2
Alteration at locus: Chemically Induced
NCBI: 72211
Genetic Alterations
ENU-induced transitions at the following base pair locations (GRCm38):
  • T to A, chromosome 1 at 14,283,301 bp
  • T to A, chromosome 1 at 106,004,121 bp
  • A to T, chromosome 1 at 161,103,038 bp
  • T to C, chromosome 1 at 169,984,968 bp
  • G to T, chromosome 2 at 43,604,277 bp
  • A to G, chromosome 2 at 75,981,457 bp
  • A to G, chromosome 2 at 82,982,732 bp
  • C to T, chromosome 2 at 87,646,052 bp
  • C to T, chromosome 2 at 90,464,614 bp
  • A to G, chromosome 2 at 92,391,034 bp
  • G to A, chromosome 2 at 93,837,996 bp
  • G to T, chromosome 2 at 111,479,187 bp
  • A to G, chromosome 2 at 125,673,201 bp
  • T to A, chromosome 2 at 135,362,420 bp
  • A to T, chromosome 2 at 153,002,294 bp
  • T to C, chromosome 2 at 154,517,807 bp
  • T to C, chromosome 2 at 160,752,449 bp
  • G to A, chromosome 2 at 160,909,610 bp
  • T to C, chromosome 2 at 165,079,026 bp
  • T to C, chromosome 3 at 37,578,762 bp
  • A to T, chromosome 3 at 86,806,114 bp
  • A to G, chromosome 3 at 87,996,113 bp
  • A to G, chromosome 3 at 95,171,234 bp
  • G to T, chromosome 3 at 106,732,206 bp
  • A to G, chromosome 3 at 142,543,907 bp
  • G to A, chromosome 4 at 48,083,252 bp
  • A to G, chromosome 4 at 90,225,171 bp
  • G to A, chromosome 5 at 30,791,597 bp
  • T to C, chromosome 5 at 35,280,312 bp
  • C to T, chromosome 5 at 43,714,611 bp
  • T to A, chromosome 5 at 65,648,007 bp
  • A to G, chromosome 5 at 125,623,016 bp
  • T to C, chromosome 6 at 24,955,062 bp
  • G to A, chromosome 6 at 29,443,797 bp
  • T to A, chromosome 6 at 47,897,787 bp
  • A to T, chromosome 7 at 3,323,550 bp
  • A to T, chromosome 7 at 4,759,398 bp
  • G to A, chromosome 7 at 19,760,349 bp
  • G to A, chromosome 7 at 44,493,192 bp
  • C to T, chromosome 7 at 75,704,531 bp
  • T to C, chromosome 7 at 80,505,926 bp
  • A to C, chromosome 7 at 82,753,709 bp
  • A to T, chromosome 7 at 85,407,285 bp
  • A to G, chromosome 7 at 109,472,232 bp
  • A to G, chromosome 7 at 122,162,440 bp
  • A to T, chromosome 7 at 139,256,151 bp
  • T to C, chromosome 8 at 11,445,086 bp
  • T to C, chromosome 8 at 18,705,731 bp
  • A to G, chromosome 8 at 89,028,409 bp
  • A to T, chromosome 9 at 38,488,013 bp
  • A to G, chromosome 9 at 39,669,555 bp
  • A to G, chromosome 9 at 86,755,512 bp
  • T to A, chromosome 9 at 106,839,088 bp
  • CAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGA to CAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGA, chromosome 9 at 119,160,716 bp
  • A to G, chromosome 10 at 14,422,662 bp
  • T to A, chromosome 10 at 24,027,744 bp
  • T to G, chromosome 10 at 76,153,580 bp
  • G to T, chromosome 10 at 80,150,115 bp
  • T to A, chromosome 10 at 87,570,351 bp
  • C to T, chromosome 10 at 88,901,376 bp
  • T to A, chromosome 10 at 105,797,306 bp
  • T to C, chromosome 10 at 127,650,796 bp
  • A to T, chromosome 11 at 9,290,619 bp
  • T to C, chromosome 11 at 22,836,621 bp
  • G to T, chromosome 11 at 28,921,613 bp
  • C to A, chromosome 11 at 67,093,598 bp
  • T to A, chromosome 11 at 69,437,070 bp
  • G to T, chromosome 11 at 82,905,547 bp
  • A to G, chromosome 11 at 110,070,387 bp
  • G to A, chromosome 12 at 8,007,751 bp
  • T to A, chromosome 12 at 88,461,092 bp
  • A to G, chromosome 12 at 108,343,000 bp
  • A to T, chromosome 13 at 3,576,770 bp
  • A to G, chromosome 13 at 23,878,539 bp
  • G to A, chromosome 13 at 27,710,173 bp
  • T to C, chromosome 13 at 46,810,799 bp
  • T to C, chromosome 13 at 74,664,151 bp
  • A to T, chromosome 13 at 105,252,353 bp
  • A to G, chromosome 14 at 31,016,369 bp
  • A to G, chromosome 14 at 49,960,502 bp
  • T to C, chromosome 14 at 63,540,264 bp
  • A to G, chromosome 14 at 75,774,983 bp
  • T to C, chromosome 14 at 123,594,581 bp
  • G to A, chromosome 16 at 34,996,817 bp
  • T to C, chromosome 16 at 91,905,501 bp
  • A to T, chromosome 17 at 17,848,270 bp
  • A to G, chromosome 17 at 26,218,316 bp
  • A to T, chromosome 17 at 32,702,159 bp
  • G to A, chromosome 17 at 50,606,694 bp
  • GAGACCAACGAGCAGCTGATGCTTCAGA to GAGA, chromosome 17 at 52,725,906 bp
  • T to C, chromosome 18 at 20,331,445 bp
  • T to C, chromosome 18 at 64,540,334 bp
  • T to C, chromosome 19 at 3,610,056 bp
  • T to C, chromosome 19 at 4,111,873 bp
  • T to C, chromosome 19 at 6,413,165 bp
  • T to A, chromosome 19 at 10,641,615 bp
  • T to C, chromosome 19 at 18,645,151 bp
  • T to C, chromosome 19 at 23,334,029 bp
  • T to A, chromosome 19 at 40,164,412 bp
  • T to G, chromosome 19 at 61,226,893 bp
Genotype Determination
Phenotype
G1 male heterozygous mice are viable and fertile. The G1 mice were not characterized prior to archiving.
Strain Development
C57BL/6J mice were injected with ENU, resulting in G0 mice that were bred back to C57BL/6J. Sperm was archived from G1 male mice that produced viable G2 mice.
Suggested Control Mice
Wild-type littermates or C57BL/6J mice
Donor
Bruce Beutler, M.D., University of Texas Southwestern Medical Center.
Primary Reference
MUTAGENETIX record for R2016 (G1). B. Beutler and colleagues, Center for the Genetics of Host Defense, UT Southwestern, Dallas, TX.

Colony and Husbandry Information

Colony Surveillance Program and Current Health Reports

Mice recovered from a cryo-archive will have health surveillance performed on recipient females. Health reports will be provided prior to shipment. If you require additional health status information, please email mmrrc@missouri.edu .
Coat Color
Black
MMRRC Breeding System
Random intra-strain mating
Breeding Scheme(s)
When maintaining a live colony, heterozygous mice may be bred together, bred with wild-type siblings, or bred with C57BL/6J inbred mice.
Overall Breeding Performance
Undetermined; during development, mating was done with heterozygous males; viability, fertility and other breeding statistics for heterozygous females and homozygotes are unverified, but presumably would be similar to the C57BL/6J background strain
Average litter size
Undetermined
Recommended wean age
3 weeks

Order Request Information

Limited quantities of breeder mice (recovered litter) are available from a cryoarchive; recovered litter usually available to ship in 3 to 4 months.

Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

Distribution of this strain requires submission of the MMRRC Conditions of Use (COU). A link to the COU web form will be provided via email after an order has been placed; the form should be completed then or the email forwarded to your institutional official for completion.

The donor or their institution limits the distribution to non-profit institutions only.

Additional charges may apply for any special requests. Shipping costs are in addition to the basic distribution/resuscitation fees. Information on shipping costs and any additional charges will be provided by the supplying MMRRC facility.

Click button to Request this one strain. (Use the MMRRC Catalog Search to request more than one strain.)
MMRRC Item # Description Distribution Fee / Unit (US $) Units Notes
040025-MU-RESUS Litter recovered from cryo-archive $5,475.00 / Non-Profit Litter Recovered litter1; additional fees for any special requests.
Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

Some MMRRC strains were submitted by the donor as cryopreserved germplasm, and because these strains were not cryopreserved by the MMRRC, we have not assessed the quality of this material. We have extensive experience with recovery of mice from cryopreserved sperm and embryos of varying quality, including using techniques such as IVF and ICSI, and are confident that we will have success in most, if not all, cases. However, because of the unknown quality of these frozen samples, we will restrict recovery efforts to two attempts for each order. Subsequent attempts can be performed on a fee-for-service basis, in addition to the standard fees, upon request.

1 The distribution fee covers the expense of resuscitating mice from the cryo-archive; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

2 An aliquot is one straw or vial with sufficient sperm to recover at least one litter of mice, as per provided protocols, when performed at the MMRRC facility. The MMRRC makes no guarantee concerning the success of these procedures when performed outside the MMRRC facilities.

3 An aliquot contains a sufficient number of embryos (in one or more vials or straws and based on the transfer success rate of the MMRRC facility) to transfer into one to three recipients. The MMRRC makes no guarantee concerning embryo transfer success experienced in the recipient investigator's laboratory. Neither gender nor genotype ratios are guaranteed.

To request material from the MMRRC: Please fill out our on-line request form (accessible from the catalog search results page, or click the Request this Strain button in the fees section). If you have questions or need assistance completing this form, you may call Customer Service at (800) 910-2291 (in USA or Canada) or (530) 757-5710 (international calls). Before you call, please have with you: the MMRRC item number, quantity needed, Bill-to and Ship-to contact information.