Strain Name:
Stock Number:
Citation ID:
Other Names:
R2016 (G1), C57BL/6J-MtgxR2016Btlr
Major Collection:

Strain Information

Name: angiopoietin 2
Synonyms: Ang2, Ang-2
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 8
NCBI: 11601
Homologene: 22401
Name: EYA transcriptional coactivator and phosphatase 1
Synonyms: bor
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 1
NCBI: 14048
Homologene: 74943
Name: RAS, guanyl releasing protein 2
Synonyms: CalDAG-GEFI, Caldaggef1
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 19
NCBI: 19395
Homologene: 4250
Name: epidermal growth factor-containing fibulin-like extracellular matrix protein 1
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 11
NCBI: 216616
Homologene: 3028
Name: Bloom syndrome, RecQ like helicase
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 7
NCBI: 12144
Homologene: 47902
Name: CBFA2/RUNX1 translocation partner 2
Synonyms: MTGR1, C330013D05Rik, Cbfa2t2h
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 2
NCBI: 12396
Homologene: 3733
Name: guanine nucleotide binding protein-like 3 (nucleolar)
Synonyms: nucleostemin, NS
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 14
NCBI: 30877
VEGA: 14
Homologene: 56670
Name: intersectin 1 (SH3 domain protein 1A)
Synonyms: EHSH1, Sh3p17, Ese1, Eh domain, SH3 domain regulator of endocytosis 1, Intersectin-L
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 16
NCBI: 16443
Homologene: 2277
Name: UDP-GlcNAc:betaGal beta-1,3-N-acetylglucosaminyltransferase 2
Synonyms: B3Galt6, B3gnt1
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 11
NCBI: 53625
Homologene: 4797
Name: low density lipoprotein receptor-related protein 5
Synonyms: LRP7, LR3
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 19
NCBI: 16973
Homologene: 1746
Name: DDB1 and CUL4 associated factor 1
Synonyms: B930007L02Rik, Vprbp
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 9
NCBI: 321006
Homologene: 8805
Name: PDS5 cohesin associated factor A
Synonyms: E230024D05Rik, 9030416H16Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 5
NCBI: 71521
Homologene: 22877
Name: A kinase (PRKA) anchor protein 13
Synonyms: AKAP-Lbc, PROTO-LBC, PROTO-LB, Ht31, 5730522G15Rik, 1700026G02Rik, 5830460E08Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 7
NCBI: 75547
Homologene: 4903
Name: spalt like transcription factor 1
Synonyms: Msal-3
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 8
NCBI: 58198
Homologene: 2230
Name: spermatogenesis associated 5
Synonyms: 2510048F20Rik, Spaf, C78064
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 3
NCBI: 57815
Homologene: 56920
Name: phospholipase C, gamma 1
Synonyms: Plcg-1, Plc-1, Plc-gamma1, Cded
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 2
NCBI: 18803
Homologene: 1997
Name: methyltransferase like 25
Synonyms: BC067068
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 10
NCBI: 216292
Homologene: 32774
Name: polo like kinase 1
Synonyms: STPK13, Plk
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 7
NCBI: 18817
Homologene: 3690
Name: doublecortin-like kinase 2
Synonyms: 6330415M09Rik, Click-II, Dcamkl2
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 3
NCBI: 70762
Homologene: 69431
Name: coiled-coil and C2 domain containing 2A
Synonyms: 5730509K17Rik, b2b1035Clo
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 5
NCBI: 231214
Homologene: 18159
Name: tripartite motif-containing 66
Synonyms: D7H11orf29, Tif1d
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 7
NCBI: 330627
Homologene: 28044
Name: transcription activation suppressor family member 2
Synonyms: BC016423, Fam208b
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 13
NCBI: 105203
VEGA: 13
Homologene: 26435
Name: protein tyrosine phosphatase, receptor type, J
Synonyms: Byp, DEP-1, Scc-1, Scc1, CD148, RPTPJ
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 2
NCBI: 19271
Homologene: 2130
Name: adrenergic receptor, alpha 2c
Synonyms: alpha2-C4, subtype alpha2-C4, [a]2C, alpha2C, Adra-2c
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 5
NCBI: 11553
Homologene: 20170
Name: basal cell adhesion molecule
Synonyms: B-CAM, 1200005K12Rik, Lu
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 7
NCBI: 57278
Homologene: 21149
Name: endoplasmic reticulum aminopeptidase 1
Synonyms: PILSAP, ERAAP, Arts1
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 13
NCBI: 80898
VEGA: 13
Homologene: 56754
Name: apolipoprotein B
Synonyms: apob-100, apob-48
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 12
NCBI: 238055
Homologene: 328
Name: brevican
Synonyms: Cspg7
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 3
NCBI: 12032
Homologene: 7244
Name: phenylalanine hydroxylase
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 10
NCBI: 18478
Homologene: 234
Name: ER membrane protein complex subunit 10
Synonyms: 5430410O10Rik, 2310044H10Rik, Mirta22
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 7
NCBI: 69683
Homologene: 18036
Name: kinesin family member 13A
Synonyms: N-3 kinesin, 4930505I07Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 13
NCBI: 16553
VEGA: 13
Homologene: 22589
Name: midnolin
Synonyms: 3000003C15Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 10
NCBI: 59090
Homologene: 32510
Name: elongation factor like GTPase 1
Synonyms: 4932434J20Rik, 6030468D11Rik, D7Ertd791e, Eftud1
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 7
NCBI: 101592
Homologene: 11599
Name: notchless homolog 1
Synonyms: notchless, Nle, l11Jus4, l11Jus1
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 11
NCBI: 217011
Homologene: 5494
Name: myotubularin related protein 9
Synonyms: mMTMH3, LIP-STYX, MTMR8, 9430075G12Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 14
NCBI: 210376
VEGA: 14
Homologene: 9148
Name: zinc finger, CCHC domain containing 2
Synonyms: 9930114B20Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 1
NCBI: 227449
Homologene: 9808
Name: kelch-like 20
Synonyms: D930050H05Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 1
NCBI: 226541
Homologene: 8699
Name: protease, serine 35
Synonyms: 6030424L22Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 9
NCBI: 244954
Homologene: 17734
Name: nuclear receptor subfamily 4, group A, member 3
Synonyms: TEC, NOR-1, Nor1, MINOR
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 4
NCBI: 18124
Homologene: 5074
Name: ATPase, class I, type 8B, member 1
Synonyms: FIC1, Ic
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 18
NCBI: 54670
VEGA: 18
Homologene: 21151
Name: discoidin domain receptor family, member 2
Synonyms: Ntrkr3
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 1
NCBI: 18214
Homologene: 68505
Name: phosphatidylinositol transfer protein, membrane-associated 1
Synonyms: DRES9, RdgB
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 19
NCBI: 18739
Homologene: 3608
Name: ATP-binding cassette, sub-family A (ABC1), member 13
Synonyms: A930002G16Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 11
NCBI: 268379
Homologene: 27991
Name: dynein, axonemal, heavy chain 2
Synonyms: D330014H01Rik, 2900022L05Rik, Dnhd3, Dnahc2
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 11
NCBI: 327954
Homologene: 72110
Name: solute carrier family 5 (iodide transporter), member 8
Synonyms: SMCT
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 10
NCBI: 216225
VEGA: 10
Homologene: 64832
Name: cytochrome P450, family 2, subfamily c, polypeptide 70
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 19
NCBI: 226105
Homologene: 120027
Name: fibrous sheath-interacting protein 2
Synonyms: OTTMUSG00000013335
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 2
NCBI: 241516
Homologene: 110349
Name: sodium leak channel, non-selective
Synonyms: A530023G15Rik, Vgcnl1
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 14
NCBI: 338370
VEGA: 14
Homologene: 21832
Name: zinc finger protein 282
Synonyms: HUB1
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 6
NCBI: 101095
Homologene: 2647
Name: phospholipase C, beta 1
Synonyms: 3110043I21Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 2
NCBI: 18795
Homologene: 22876
Name: PWWP domain containing 2B
Synonyms: D930023J19Rik, D7Ertd517e, Pwwp2
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 7
NCBI: 101631
Homologene: 19056
Name: von Willebrand factor C and EGF domains
Synonyms: 1300015B04Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 19
NCBI: 71768
VEGA: 19
Homologene: 17651
Name: 1-aminocyclopropane-1-carboxylate synthase (non-functional)
Synonyms: 2610203E10Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 2
NCBI: 329470
Homologene: 75335
Name: protein kinase C, gamma
Synonyms: PKCgamma, Pkcc, Prkcc
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 7
NCBI: 18752
Homologene: 20602
Name: solute carrier family 25, member 30
Synonyms: 4933433D23Rik, KMCP1
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 14
NCBI: 67554
VEGA: 14
Homologene: 57046
Name: myosin, heavy polypeptide 3, skeletal muscle, embryonic
Synonyms: MyHC-emb, Myhs-e, Myhse
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 11
NCBI: 17883
Homologene: 20553
Name: zinc finger protein 352
Synonyms: 2czf48
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 4
NCBI: 236537
Homologene: 45160
Name: tubulin tyrosine ligase-like family, member 9
Synonyms: 4930509O20Rik, 1700016F23Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 2
NCBI: 74711
Homologene: 41769
Name: solute carrier family 5, member 4a
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 10
NCBI: 64452
VEGA: 10
Name: colony stimulating factor 2 receptor, alpha, low-affinity (granulocyte-macrophage)
Synonyms: CD116, Csfgmra, GM-CSF-Ra, GM-CSFRalpha
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 19
NCBI: 12982
VEGA: 19
Homologene: 48406
Name: ATP-binding cassette, sub-family A (ABC1), member 8a
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 11
NCBI: 217258
Homologene: 131160
Name: MAM domain containing 2
Synonyms: 1200015L10Rik, mamcan
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 19
NCBI: 71738
VEGA: 19
Homologene: 17722
Name: transmembrane protein 229A
Synonyms: 6332401O19Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 6
NCBI: 319832
Homologene: 85312
Name: collagen, type IV, alpha 2
Synonyms: Col4a-2
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 8
NCBI: 12827
Homologene: 1390
Name: kynureninase
Synonyms: 4432411A05Rik, L-kynurenine hydrolase
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 2
NCBI: 70789
Homologene: 2925
Name: guanylate binding protein 7
Synonyms: 9830147J24Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 3
NCBI: 229900
Homologene: 138296
Name: nicotinamide riboside kinase 1
Synonyms: D630020N23Rik, BC016495
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 19
NCBI: 225994
Homologene: 6787
Name: aarF domain containing kinase 1
Synonyms: 2610005A10Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 12
NCBI: 72113
VEGA: 12
Homologene: 6493
Name: phospholipase C-like 2
Synonyms: Plce2, PRIP-2
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 17
NCBI: 224860
VEGA: 17
Homologene: 9052
Name: filamin C, gamma
Synonyms: Fln2, 1110055E19Rik, actin binding protein 280
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 6
NCBI: 68794
Homologene: 37481
Name: desmoglein 1 alpha
Synonyms: Dsg1
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 18
NCBI: 13510
Homologene: 1463
Name: myosin, light polypeptide kinase
Synonyms: telokin, Mlck, MLCK210, MLCK108, 9530072E15Rik, A930019C19Rik, nmMlck
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 16
NCBI: 107589
Homologene: 14202
Name: cytochrome P450, family 46, subfamily a, polypeptide 1
Synonyms: cholestrol 24-hydroxylase, Cyp46
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 12
NCBI: 13116
VEGA: 12
Homologene: 134501
Name: hyaluronan synthase 1
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 17
NCBI: 15116
VEGA: 17
Homologene: 1165
Name: golgi associated RAB2 interactor family member 5B
Synonyms: 4930401F20Rik, Fam71e2
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 7
NCBI: 243822
Homologene: 89225
Name: signal transducer and activator of transcription 6
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 10
NCBI: 20852
Homologene: 2373
Name: mitogen-activated protein kinase 8 interacting protein 1
Synonyms: JIP-1, MAPK8IP1, IB1, Prkm8ip, mjip-2a, Skip, Jip1
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 2
NCBI: 19099
Homologene: 31314
Name: adhesion G protein-coupled receptor G6
Synonyms: LOC215798, 1190004A11Rik, DREG, Gpr126
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 10
NCBI: 215798
Homologene: 10724
Name: family with sequence similarity 234, member A
Synonyms: Itfg3
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 17
NCBI: 106581
Homologene: 12932
Name: ring finger protein 180
Synonyms: 3110001E11Rik, Rines
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 13
NCBI: 71816
VEGA: 13
Homologene: 18677
Name: potassium voltage-gated channel, subfamily H (eag-related), member 8
Synonyms: Kv12.1, ELK1, C130090D05Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 17
NCBI: 211468
Homologene: 14332
Name: elastin microfibril interfacer 3
Synonyms: Emilin5, 1110013O17Rik, EMILIN-T
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 2
NCBI: 280635
Homologene: 18817
Name: ligand dependent nuclear receptor interacting factor 1
Synonyms: 2010012G17Rik, 4933421E11Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 3
NCBI: 321000
Homologene: 10160
Name: transmembrane protein 132B
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 5
NCBI: 208151
Homologene: 28135
Name: dihydropyrimidinase-like 5
Synonyms: Crmp5, CRMP-5, CRAM
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 5
NCBI: 65254
Homologene: 41347
Name: vomeronasal 2, receptor 69
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 7
NCBI: 330581
Homologene: 115466
Name: prolactin family 7, subfamily d, member 1
Synonyms: PRP, PLF-RP, Plfr
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 13
NCBI: 18814
Homologene: 7894
Name: sema domain, transmembrane domain (TM), and cytoplasmic domain, (semaphorin) 6C
Synonyms: Sema Y, Semay
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 3
NCBI: 20360
Homologene: 7931
Name: tetratricopeptide repeat domain 30A1
Synonyms: 4930506L13Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 2
NCBI: 78802
Homologene: 136638
Name: olfactory receptor family 4 subfamily L member 15
Synonyms: GA_x6K02T2PMLR-5645801-5644872, MOR247-2, Olfr724
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 14
NCBI: 258485
Homologene: 71986
Name: EP300 interacting inhibitor of differentiation 1
Synonyms: 2610002K20Rik, EID-1, ORF12, Cri1
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 2
NCBI: 58521
Homologene: 49376
Name: olfactory receptor family 8 subfamily B member 1
Synonyms: GA_x6K02T2PVTD-32194085-32195020, MOR167-2, Olfr906
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 9
NCBI: 258799
Homologene: 132439
Name: predicted gene 10608
Synonyms: EG546165
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 9
NCBI: 546165
Name: solute carrier family 17 (sodium phosphate), member 1
Synonyms: Npt1, NAPI-1
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 13
NCBI: 20504
Homologene: 48324
Name: olfactory receptor family 10 subfamily D member 4
Synonyms: GA_x6K02T2PVTD-33365879-33366814, MOR224-7P, MOR224-13, Olfr963
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 9
NCBI: 258087
Homologene: 105216
Name: olfactory receptor family 5 subfamily W member 1B
Synonyms: GA_x6K02T2Q125-49151278-49150337, MOR176-2, Olfr1133
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 2
NCBI: 258348
Name: trace amine-associated receptor 7D
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 10
NCBI: 435206
Homologene: 115653
Name: cytochrome P450, family 4, subfamily f, polypeptide 15
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 17
NCBI: 106648
Homologene: 80199
Name: olfactory receptor family 4 subfamily G member 7
Synonyms: GA_x6K02T2Q125-72530279-72531217, MOR245-9, Olfr1288
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 2
NCBI: 258395
Homologene: 88360
Name: RIKEN cDNA 1700025C18 gene
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 2
NCBI: 72211
Genetic Alterations
ENU-induced transitions at the following base pair locations (GRCm38):
  • T to A, chromosome 1 at 14,283,301 bp
  • T to A, chromosome 1 at 106,004,121 bp
  • A to T, chromosome 1 at 161,103,038 bp
  • T to C, chromosome 1 at 169,984,968 bp
  • G to T, chromosome 2 at 43,604,277 bp
  • A to G, chromosome 2 at 75,981,457 bp
  • A to G, chromosome 2 at 82,982,732 bp
  • C to T, chromosome 2 at 87,646,052 bp
  • C to T, chromosome 2 at 90,464,614 bp
  • A to G, chromosome 2 at 92,391,034 bp
  • G to A, chromosome 2 at 93,837,996 bp
  • G to T, chromosome 2 at 111,479,187 bp
  • A to G, chromosome 2 at 125,673,201 bp
  • T to A, chromosome 2 at 135,362,420 bp
  • A to T, chromosome 2 at 153,002,294 bp
  • T to C, chromosome 2 at 154,517,807 bp
  • T to C, chromosome 2 at 160,752,449 bp
  • G to A, chromosome 2 at 160,909,610 bp
  • T to C, chromosome 2 at 165,079,026 bp
  • T to C, chromosome 3 at 37,578,762 bp
  • A to T, chromosome 3 at 86,806,114 bp
  • A to G, chromosome 3 at 87,996,113 bp
  • A to G, chromosome 3 at 95,171,234 bp
  • G to T, chromosome 3 at 106,732,206 bp
  • A to G, chromosome 3 at 142,543,907 bp
  • G to A, chromosome 4 at 48,083,252 bp
  • A to G, chromosome 4 at 90,225,171 bp
  • G to A, chromosome 5 at 30,791,597 bp
  • T to C, chromosome 5 at 35,280,312 bp
  • C to T, chromosome 5 at 43,714,611 bp
  • T to A, chromosome 5 at 65,648,007 bp
  • A to G, chromosome 5 at 125,623,016 bp
  • T to C, chromosome 6 at 24,955,062 bp
  • G to A, chromosome 6 at 29,443,797 bp
  • T to A, chromosome 6 at 47,897,787 bp
  • A to T, chromosome 7 at 3,323,550 bp
  • A to T, chromosome 7 at 4,759,398 bp
  • G to A, chromosome 7 at 19,760,349 bp
  • G to A, chromosome 7 at 44,493,192 bp
  • C to T, chromosome 7 at 75,704,531 bp
  • T to C, chromosome 7 at 80,505,926 bp
  • A to C, chromosome 7 at 82,753,709 bp
  • A to T, chromosome 7 at 85,407,285 bp
  • A to G, chromosome 7 at 109,472,232 bp
  • A to G, chromosome 7 at 122,162,440 bp
  • A to T, chromosome 7 at 139,256,151 bp
  • T to C, chromosome 8 at 11,445,086 bp
  • T to C, chromosome 8 at 18,705,731 bp
  • A to G, chromosome 8 at 89,028,409 bp
  • A to T, chromosome 9 at 38,488,013 bp
  • A to G, chromosome 9 at 39,669,555 bp
  • A to G, chromosome 9 at 86,755,512 bp
  • T to A, chromosome 9 at 106,839,088 bp
  • A to G, chromosome 10 at 14,422,662 bp
  • T to A, chromosome 10 at 24,027,744 bp
  • T to G, chromosome 10 at 76,153,580 bp
  • G to T, chromosome 10 at 80,150,115 bp
  • T to A, chromosome 10 at 87,570,351 bp
  • C to T, chromosome 10 at 88,901,376 bp
  • T to A, chromosome 10 at 105,797,306 bp
  • T to C, chromosome 10 at 127,650,796 bp
  • A to T, chromosome 11 at 9,290,619 bp
  • T to C, chromosome 11 at 22,836,621 bp
  • G to T, chromosome 11 at 28,921,613 bp
  • C to A, chromosome 11 at 67,093,598 bp
  • T to A, chromosome 11 at 69,437,070 bp
  • G to T, chromosome 11 at 82,905,547 bp
  • A to G, chromosome 11 at 110,070,387 bp
  • G to A, chromosome 12 at 8,007,751 bp
  • T to A, chromosome 12 at 88,461,092 bp
  • A to G, chromosome 12 at 108,343,000 bp
  • A to T, chromosome 13 at 3,576,770 bp
  • A to G, chromosome 13 at 23,878,539 bp
  • G to A, chromosome 13 at 27,710,173 bp
  • T to C, chromosome 13 at 46,810,799 bp
  • T to C, chromosome 13 at 74,664,151 bp
  • A to T, chromosome 13 at 105,252,353 bp
  • A to G, chromosome 14 at 31,016,369 bp
  • A to G, chromosome 14 at 49,960,502 bp
  • T to C, chromosome 14 at 63,540,264 bp
  • A to G, chromosome 14 at 75,774,983 bp
  • T to C, chromosome 14 at 123,594,581 bp
  • G to A, chromosome 16 at 34,996,817 bp
  • T to C, chromosome 16 at 91,905,501 bp
  • A to T, chromosome 17 at 17,848,270 bp
  • A to G, chromosome 17 at 26,218,316 bp
  • A to T, chromosome 17 at 32,702,159 bp
  • G to A, chromosome 17 at 50,606,694 bp
  • GAGACCAACGAGCAGCTGATGCTTCAGA to GAGA, chromosome 17 at 52,725,906 bp
  • T to C, chromosome 18 at 20,331,445 bp
  • T to C, chromosome 18 at 64,540,334 bp
  • T to C, chromosome 19 at 3,610,056 bp
  • T to C, chromosome 19 at 4,111,873 bp
  • T to C, chromosome 19 at 6,413,165 bp
  • T to A, chromosome 19 at 10,641,615 bp
  • T to C, chromosome 19 at 18,645,151 bp
  • T to C, chromosome 19 at 23,334,029 bp
  • T to A, chromosome 19 at 40,164,412 bp
  • T to G, chromosome 19 at 61,226,893 bp
Genotype Determination
G1 male heterozygous mice are viable and fertile. The G1 mice were not characterized prior to archiving.
Strain Development
C57BL/6J mice were injected with ENU, resulting in G0 mice that were bred back to C57BL/6J. Sperm was archived from G1 male mice that produced viable G2 mice.
Suggested Control Mice
Wild-type littermates or C57BL/6J mice
MMRRC Genetic QC Summary
The MMRRC Centers have developed a genetic QC pipeline using MiniMUGA array genotyping to provide additional information on strain backgrounds for MMRRC congenic and inbred strains. For more information on when data may be available, or to request genotyping for a strain of interest, please contact Older strains may not have this information.
Bruce Beutler, M.D., University of Texas Southwestern Medical Center.
Primary Reference
MUTAGENETIX record for R2016 (G1). B. Beutler and colleagues, Center for the Genetics of Host Defense, UT Southwestern, Dallas, TX.

Colony and Husbandry Information

Colony Surveillance Program and Current Health Reports

Mice recovered from a cryo-archive will have health surveillance performed on recipient females. Health reports will be provided prior to shipment. If you require additional health status information, please email .
Coat Color
MMRRC Breeding System
Random intra-strain mating
Breeding Scheme(s)
When maintaining a live colony, heterozygous mice may be bred together, bred with wild-type siblings, or bred with C57BL/6J inbred mice.
Overall Breeding Performance
Undetermined; during development, mating was done with heterozygous males; viability, fertility and other breeding statistics for heterozygous females and homozygotes are unverified, but presumably would be similar to the C57BL/6J background strain
Average litter size
Recommended wean age
3 weeks

Order Request Information

Limited quantities of breeder mice (recovered litter) are available from a cryoarchive; recovered litter usually available to ship in 3 to 4 months.

Cryopreserved material may be available upon request, please inquire to for more information.

Distribution of this strain requires submission of the MMRRC Conditions of Use (COU). A link to the COU web form will be provided via email after an order has been placed; the form should be completed then or the email forwarded to your institutional official for completion.

The donor or their institution limits the distribution to non-profit institutions only.

Additional charges may apply for any special requests. Shipping costs are in addition to the basic distribution/resuscitation fees. Information on shipping costs and any additional charges will be provided by the supplying MMRRC facility.

Click button to Request this one strain. (Use the MMRRC Catalog Search to request more than one strain.)
MMRRC Item # Description Distribution Fee / Unit (US $)
*Shipping & Handling not included*
Units Notes
040025-MU-RESUS Litter recovered from cryo-archive $5,475.00 / Non-Profit Litter Recovered litter4; additional fees for any special requests.
Cryopreserved material may be available upon request, please inquire to for more information.

Some MMRRC strains were submitted by the donor as cryopreserved germplasm, and because these strains were not cryopreserved by the MMRRC, we have not assessed the quality of this material. We have extensive experience with recovery of mice from cryopreserved sperm and embryos of varying quality, including using techniques such as IVF and ICSI, and are confident that we will have success in most, if not all, cases. However, because of the unknown quality of these frozen samples, we will restrict recovery efforts to two attempts for each order. Subsequent attempts can be performed on a fee-for-service basis, in addition to the standard fees, upon request.

1 The distribution fee covers the expense of rederiving mice from a live mouse; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

2 An aliquot contains a sufficient number of embryos (in one or more vials or straws and based on the transfer success rate of the MMRRC facility) to transfer into one to three recipients. The MMRRC makes no guarantee concerning embryo transfer success experienced in the recipient investigator's laboratory. Neither gender nor genotype ratios are guaranteed.

3 An aliquot is one straw or vial with sufficient sperm to recover at least one litter of mice, as per provided protocols, when performed at the MMRRC facility. The MMRRC makes no guarantee concerning the success of these procedures when performed outside the MMRRC facilities.

4 The distribution fee covers the expense of resuscitating mice from the cryo-archive; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

To request material from the MMRRC: Please fill out our on-line request form (accessible from the catalog search results page, or click the Request this Strain button in the fees section). If you have questions or need assistance completing this form, you may call Customer Service at (800) 910-2291 (in USA or Canada) or (530) 757-5710 (international calls). Before you call, please have with you: the MMRRC item number, quantity needed, Bill-to and Ship-to contact information.