Strain Name:
C57BL/6J-MtgxR2018Btlr/Mmmh
Stock Number:
040027-MU
Citation ID:
RRID:MMRRC_040027-MU
Other Names:
R2018 (G1), C57BL/6J-MtgxR2018Btlr
Major Collection:

Gene Information

Fn1
Name: fibronectin 1
Synonyms: Fn-1, Fn
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 1
Alteration at locus: Chemically Induced
NCBI: 14268
HGNC: HGNC:3778
Homologene: 1533
Itga6
Name: integrin alpha 6
Synonyms: Cd49f, 5033401O05Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 2
Alteration at locus: Chemically Induced
NCBI: 16403
HGNC: HGNC:6142
Homologene: 20091
Upp1
Name: uridine phosphorylase 1
Synonyms: UdRPase, UPase, Up
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 11
Alteration at locus: Chemically Induced
NCBI: 22271
Homologene: 2524
Orc1
Name: origin recognition complex, subunit 1
Synonyms: MmORC1, Orc1l
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 4
Alteration at locus: Chemically Induced
NCBI: 18392
HGNC: HGNC:8487
Homologene: 31221
Fgd4
Name: FYVE, RhoGEF and PH domain containing 4
Synonyms: Frabin-alpha, ZFYVE6, Frabin-gamma, Frabin-beta, 9330209B17Rik, Frabin
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 16
Alteration at locus: Chemically Induced
NCBI: 224014
Homologene: 26727
Trim13
Name: tripartite motif-containing 13
Synonyms: LEU5, RNF77, Rfp2, 3110001L12Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 14
Alteration at locus: Chemically Induced
NCBI: 66597
VEGA: 14
HGNC: HGNC:9976
Homologene: 4234
Ano1
Name: anoctamin 1, calcium activated chloride channel
Synonyms: Tmem16a
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 7
Alteration at locus: Chemically Induced
NCBI: 101772
Homologene: 75079
Setd3
Name: SET domain containing 3
Synonyms: D12Ertd771e, 2610305M23Rik, 2610102I01Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 12
Alteration at locus: Chemically Induced
NCBI: 52690
Homologene: 41748
Arid1a
Name: AT rich interactive domain 1A (SWI-like)
Synonyms: Osa1, Smarcf1, 1110030E03Rik, BAF250a
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 4
Alteration at locus: Chemically Induced
NCBI: 93760
Homologene: 21216
Anapc5
Name: anaphase-promoting complex subunit 5
Synonyms: 2510006G12Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 5
Alteration at locus: Chemically Induced
NCBI: 59008
Homologene: 41118
Tnks
Name: tankyrase, TRF1-interacting ankyrin-related ADP-ribose polymerase
Synonyms: 4930554K12Rik, D130072O21Rik, mTNKS1, TANK1, tankyrase 1
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 8
Alteration at locus: Chemically Induced
NCBI: 21951
Homologene: 18405
Ppm1b
Name: protein phosphatase 1B, magnesium dependent, beta isoform
Synonyms: PP2CB
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 17
Alteration at locus: Chemically Induced
NCBI: 19043
VEGA: 17
HGNC: HGNC:9276
Homologene: 2027
Fancl
Name: Fanconi anemia, complementation group L
Synonyms: B230118H11Rik, gcd, Pog, 2010322C19Rik, Phf9
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 11
Alteration at locus: Chemically Induced
NCBI: 67030
Homologene: 9987
Heatr1
Name: HEAT repeat containing 1
Synonyms: B130016L12Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 13
Alteration at locus: Chemically Induced
NCBI: 217995
VEGA: 13
Homologene: 34562
C77080
Name: expressed sequence C77080
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 4
Alteration at locus: Chemically Induced
NCBI: 97130
Homologene: 45837
Fam172a
Name: family with sequence similarity 172, member A
Synonyms: pEN87, 2610318O14Rik, 53-E6, 9430037D06Rik, 1110033M05Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 13
Alteration at locus: Chemically Induced
NCBI: 68675
VEGA: 13
Homologene: 12933
Vps39
Name: VPS39 HOPS complex subunit
Synonyms: Vam6, Vam6P, A230065P22Rik, mVam6
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 2
Alteration at locus: Chemically Induced
NCBI: 269338
Homologene: 41025
Mrps35
Name: mitochondrial ribosomal protein S35
Synonyms: MDSO23, MRPS28, MRP-S28
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 6
Alteration at locus: Chemically Induced
NCBI: 232536
Homologene: 11048
Sgk1
Name: serum/glucocorticoid regulated kinase 1
Synonyms: Sgk, Sgk1
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 10
Alteration at locus: Chemically Induced
NCBI: 20393
Homologene: 48364
Ryr2
Name: ryanodine receptor 2, cardiac
Synonyms: 9330127I20Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 13
Alteration at locus: Chemically Induced
NCBI: 20191
VEGA: 13
Homologene: 37423
Slc18a2
Name: solute carrier family 18 (vesicular monoamine), member 2
Synonyms: 1110037L13Rik, Vmat2
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 19
Alteration at locus: Chemically Induced
NCBI: 214084
VEGA: 19
Homologene: 2298
Zbtb20
Name: zinc finger and BTB domain containing 20
Synonyms: A930017C21Rik, D16Wsu73e, 1300017A20Rik, HOF, 7330412A13Rik, Zfp288
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 16
Alteration at locus: Chemically Induced
NCBI: 56490
Homologene: 9226
Dmbt1
Name: deleted in malignant brain tumors 1
Synonyms: gp300, Crpd, hensin, ebnerin, CRP-[a], vomeroglandin, CRP-[b], MUCLIN
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 7
Alteration at locus: Chemically Induced
NCBI: 12945
HGNC: HGNC:2926
Homologene: 68990
Lgals3
Name: lectin, galactose binding, soluble 3
Synonyms: Mac-2, L-34, galectin-3, gal3
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 14
Alteration at locus: Chemically Induced
NCBI: 16854
HGNC: HGNC:6563
Homologene: 37608
Uba6
Name: ubiquitin-like modifier activating enzyme 6
Synonyms: 5730469D23Rik, Ube1l2
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 5
Alteration at locus: Chemically Induced
NCBI: 231380
Homologene: 10080
Lamc1
Name: laminin, gamma 1
Synonyms: laminin B2, Lamb2
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 1
Alteration at locus: Chemically Induced
NCBI: 226519
HGNC: HGNC:6492
Homologene: 1724
Zfp871
Name: zinc finger protein 871
Synonyms: 9030612M13Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 17
Alteration at locus: Chemically Induced
NCBI: 208292
Homologene: 138401
Ror1
Name: receptor tyrosine kinase-like orphan receptor 1
Synonyms: Ntrkr1, 2810404D04Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 4
Alteration at locus: Chemically Induced
NCBI: 26563
Homologene: 3675
Pdgfrb
Name: platelet derived growth factor receptor, beta polypeptide
Synonyms: Pdgfr, CD140b
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 18
Alteration at locus: Chemically Induced
NCBI: 18596
HGNC: HGNC:8804
Homologene: 1960
Trpv4
Name: transient receptor potential cation channel, subfamily V, member 4
Synonyms: VRL-2, Trp12, VROAC, OTRPC4, VR-OAC, 0610033B08Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 5
Alteration at locus: Chemically Induced
NCBI: 63873
Homologene: 11003
Magel2
Name: melanoma antigen, family L, 2
Synonyms: Mage-l2, NDNL1, nM15, ns7
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 7
Alteration at locus: Chemically Induced
NCBI: 27385
HGNC: HGNC:6814
Homologene: 8460
Adgrg5
Name: adhesion G protein-coupled receptor G5
Synonyms: PGR27, Gpr114, LOC382045
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 8
Alteration at locus: Chemically Induced
NCBI: 382045
Homologene: 17828
Csrp1
Name: cysteine and glycine-rich protein 1
Synonyms: CRP1
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 1
Alteration at locus: Chemically Induced
NCBI: 13007
HGNC: HGNC:2469
Homologene: 37874
Npat
Name: nuclear protein in the AT region
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 9
Alteration at locus: Chemically Induced
NCBI: 244879
HGNC: HGNC:7896
Homologene: 1888
Hp1bp3
Name: heterochromatin protein 1, binding protein 3
Synonyms: Hp1bp74
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 4
Alteration at locus: Chemically Induced
NCBI: 15441
Homologene: 7774
Rnf219
Name: ring finger protein 219
Synonyms: 2610206B13Rik, 2810449K13Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 14
Alteration at locus: Chemically Induced
NCBI: 72486
VEGA: 14
Homologene: 11578
Csnk1g2
Name: casein kinase 1, gamma 2
Synonyms: 2810429I12Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 10
Alteration at locus: Chemically Induced
NCBI: 103236
VEGA: 10
HGNC: HGNC:2455
Homologene: 100845
Saal1
Name: serum amyloid A-like 1
Synonyms: 5031425D22Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 7
Alteration at locus: Chemically Induced
NCBI: 78935
Homologene: 34706
March7
Name: membrane-associated ring finger (C3HC4) 7
Synonyms: Axot, Gtrgeo17
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 2
Alteration at locus: Chemically Induced
NCBI: 57438
Homologene: 10753
Crtc1
Name: CREB regulated transcription coactivator 1
Synonyms: TORC1, Mect1
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 8
Alteration at locus: Chemically Induced
NCBI: 382056
Homologene: 41607
Rfx7
Name: regulatory factor X, 7
Synonyms: D130086K05Rik, 2510005N23Rik, Rfxdc2, 9930116O05Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 9
Alteration at locus: Chemically Induced
NCBI: 319758
Homologene: 11275
Piezo1
Name: piezo-type mechanosensitive ion channel component 1
Synonyms: Piezo1, Fam38a
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 8
Alteration at locus: Chemically Induced
NCBI: 234839
Homologene: 124356
Podn
Name: podocan
Synonyms: SLRR5A
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 4
Alteration at locus: Chemically Induced
NCBI: 242608
Homologene: 17803
Tdo2
Name: tryptophan 2,3-dioxygenase
Synonyms: chky, TO, TDO
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 3
Alteration at locus: Chemically Induced
NCBI: 56720
Homologene: 4132
Vmn1r206
Name: vomeronasal 1 receptor 206
Synonyms: V1rh7
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 13
Alteration at locus: Chemically Induced
NCBI: 171250
Homologene: 110880
Tatdn3
Name: TatD DNase domain containing 3
Synonyms: 1500010M24Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 1
Alteration at locus: Chemically Induced
NCBI: 68972
Homologene: 45949
Tarbp1
Name: TAR RNA binding protein 1
Synonyms: Gm17296
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 8
Alteration at locus: Chemically Induced
NCBI: 212728
Homologene: 38082
Ttn
Name: titin
Synonyms: shru, connectin, mdm, 2310057K23Rik, D330041I19Rik, 1100001C23Rik, D830007G01Rik, 2310036G12Rik, L56, 2310074I15Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 2
Alteration at locus: Chemically Induced
NCBI: 22138
Homologene: 130650
Syne2
Name: spectrin repeat containing, nuclear envelope 2
Synonyms: D12Ertd777e, Nesp2g, nesprin-2, syne-2, dice, Cpfl8, 6820443O06Rik, diminished cone electroretinogram
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 12
Alteration at locus: Chemically Induced
NCBI: 319565
Homologene: 56700
Nyap2
Name: neuronal tyrosine-phophorylated phosphoinositide 3-kinase adaptor 2
Synonyms: 9430031J16Rik, Jr6
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 1
Alteration at locus: Chemically Induced
NCBI: 241134
Homologene: 18239
Gm872
Name: predicted gene 872
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 10
Alteration at locus: Chemically Induced
2610028H24Rik
Name: RIKEN cDNA 2610028H24 gene
Synonyms: ORF67
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 10
Alteration at locus: Chemically Induced
NCBI: 76964
HGNC: HGNC:1300
Homologene: 50540
Fbxo30
Name: F-box protein 30
Synonyms: 1700026A16Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 10
Alteration at locus: Chemically Induced
NCBI: 71865
Homologene: 12959
Ryr3
Name: ryanodine receptor 3
Synonyms: calcium release channel isoform 3
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 2
Alteration at locus: Chemically Induced
NCBI: 20192
Homologene: 68151
Hc
Name: hemolytic complement
Synonyms: C5, C5a, Hfib2, He
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 2
Alteration at locus: Chemically Induced
NCBI: 15139
HGNC: HGNC:1331
Homologene: 20412
Tmem132e
Name: transmembrane protein 132E
Synonyms: LOC270893
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 11
Alteration at locus: Chemically Induced
NCBI: 270893
Homologene: 41524
Acss3
Name: acyl-CoA synthetase short-chain family member 3
Synonyms: LOC380660, 8430416H19Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 10
Alteration at locus: Chemically Induced
NCBI: 380660
Homologene: 11587
Peg12
Name: paternally expressed 12
Synonyms: Frat3
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 7
Alteration at locus: Chemically Induced
NCBI: 27412
Krt4
Name: keratin 4
Synonyms: Krt-2.4, K4, Krt2-4
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 15
Alteration at locus: Chemically Induced
NCBI: 16682
VEGA: 15
HGNC: HGNC:6441
Homologene: 20523
Olfr1245
Name: olfactory receptor 1245
Synonyms: MOR231-12, GA_x6K02T2Q125-51020951-51020028
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 2
Alteration at locus: Chemically Induced
NCBI: 258784
Homologene: 121560
Olfr1214
Name: olfactory receptor 1214
Synonyms: MOR233-8, GA_x6K02T2Q125-50468705-50467770
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 2
Alteration at locus: Chemically Induced
NCBI: 258899
Homologene: 73984
Adamts16
Name: a disintegrin-like and metallopeptidase (reprolysin type) with thrombospondin type 1 motif, 16
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 13
Alteration at locus: Chemically Induced
NCBI: 271127
Homologene: 15146
Gsdmc2
Name: gasdermin C2
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 15
Alteration at locus: Chemically Induced
NCBI: 331063
HGNC: HGNC:7151
Homologene: 69487
Cryz
Name: crystallin, zeta
Synonyms: Sez9, quinone reductase, SEZ9
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 3
Alteration at locus: Chemically Induced
NCBI: 12972
HGNC: HGNC:2419
Homologene: 133907
Tnxb
Name: tenascin XB
Synonyms: Tnx, TN-MHC
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 17
Alteration at locus: Chemically Induced
NCBI: 81877
Homologene: 49589
Gm7247
Name: predicted gene 7247
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 14
Alteration at locus: Chemically Induced
NCBI: 638695
Phf8-ps
Name: PHD finger protein 8, pseudogene
Synonyms: 4921501E09Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 17
Alteration at locus: Chemically Induced
NCBI: 74042
VEGA: 17
Homologene: 66275
Arhgef10l
Name: Rho guanine nucleotide exchange factor (GEF) 10-like
Synonyms: 2810441C07Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 4
Alteration at locus: Chemically Induced
NCBI: 72754
Homologene: 10017
Vmn2r93
Name: vomeronasal 2, receptor 93
Synonyms: EG627132
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 17
Alteration at locus: Chemically Induced
NCBI: 627132
Homologene: 129750
Myom2
Name: myomesin 2
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 8
Alteration at locus: Chemically Induced
NCBI: 17930
HGNC: HGNC:7614
Homologene: 2953
Myocd
Name: myocardin
Synonyms: Srfcp
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 11
Alteration at locus: Chemically Induced
NCBI: 214384
Homologene: 17043
Slc4a10
Name: solute carrier family 4, sodium bicarbonate cotransporter-like, member 10
Synonyms: NCBE
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 2
Alteration at locus: Chemically Induced
NCBI: 94229
Homologene: 23340
Tmem30a
Name: transmembrane protein 30A
Synonyms: D9Wsu20e, Cdc50a, 2010200I23Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 9
Alteration at locus: Chemically Induced
NCBI: 69981
Homologene: 110703
Rufy4
Name: RUN and FYVE domain containing 4
Synonyms: F930048N03Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 1
Alteration at locus: Chemically Induced
NCBI: 435626
Homologene: 52359
Vmn2r79
Name: vomeronasal 2, receptor 79
Synonyms: EG621430
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 7
Alteration at locus: Chemically Induced
NCBI: 621430
Homologene: 115466
Serpina3n
Name: serine (or cysteine) peptidase inhibitor, clade A, member 3N
Synonyms: alpha-1 antiproteinase, Spi2.2, Spi2/eb.4, antitrypsin, Spi2-2
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 12
Alteration at locus: Chemically Induced
NCBI: 20716
HGNC: HGNC:16
Homologene: 111129
Adamtsl4
Name: ADAMTS-like 4
Synonyms: Tsrc1
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 3
Alteration at locus: Chemically Induced
NCBI: 229595
Homologene: 23141
Cyp4a12a
Name: cytochrome P450, family 4, subfamily a, polypeptide 12a
Synonyms: Cyp4a12
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 4
Alteration at locus: Chemically Induced
NCBI: 277753
Homologene: 134044
Abca14
Name: ATP-binding cassette, sub-family A (ABC1), member 14
Synonyms: 1700110B15Rik, 4930539G24Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 7
Alteration at locus: Chemically Induced
NCBI: 67928
Homologene: 86128
Speg
Name: SPEG complex locus
Synonyms: Apeg1, SPEGalpha, SPEG, BPEG, SPEGbeta, D1Bwg1450e
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 1
Alteration at locus: Chemically Induced
NCBI: 11790
Homologene: 55619
Spire2
Name: spire type actin nucleation factor 2
Synonyms: Spir-2
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 8
Alteration at locus: Chemically Induced
NCBI: 234857
Homologene: 72212
Krt24
Name: keratin 24
Synonyms: 2310075C18Rik, 2310058N18Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 11
Alteration at locus: Chemically Induced
NCBI: 75706
Homologene: 10379
Ces2h
Name: carboxylesterase 2H
Synonyms: Gm5744
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 8
Alteration at locus: Chemically Induced
NCBI: 436059
HGNC: HGNC:1864
Homologene: 128645
Cttnbp2
Name: cortactin binding protein 2
Synonyms: ORF4, 3010022N24Rik, Cortbp2, 9130022E09Rik, 4732477G22Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 6
Alteration at locus: Chemically Induced
NCBI: 30785
Homologene: 14125
Tbpl1
Name: TATA box binding protein-like 1
Synonyms: TRF2, TRP, Tlp, TLF
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 10
Alteration at locus: Chemically Induced
NCBI: 237336
Homologene: 3577
Krt40
Name: keratin 40
Synonyms: Ka36
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 11
Alteration at locus: Chemically Induced
NCBI: 406221
Homologene: 46321
Gramd1a
Name: GRAM domain containing 1A
Synonyms: 1300003M23Rik, D7Bwg0611e
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 7
Alteration at locus: Chemically Induced
NCBI: 52857
Homologene: 10843
Arhgef40
Name: Rho guanine nucleotide exchange factor (GEF) 40
Synonyms: E130112L23Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 14
Alteration at locus: Chemically Induced
NCBI: 268739
Homologene: 19560
Olfr1032
Name: olfactory receptor 1032
Synonyms: GA_x6K02T2Q125-47485813-47486745, MOR199-1
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 2
Alteration at locus: Chemically Induced
NCBI: 258572
Homologene: 17299
Akt1
Name: thymoma viral proto-oncogene 1
Synonyms: PKBalpha, PKB/Akt, Akt, PKB
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 12
Alteration at locus: Chemically Induced
NCBI: 11651
HGNC: HGNC:391
Homologene: 3785
Raet1d
Name: retinoic acid early transcript delta
Synonyms: RAE-1delta
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 10
Alteration at locus: Chemically Induced
NCBI: 56554
Homologene: 134115
Sytl1
Name: synaptotagmin-like 1
Synonyms: Slp1, PSGL-1
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 4
Alteration at locus: Chemically Induced
NCBI: 269589
Homologene: 12853
Nosip
Name: nitric oxide synthase interacting protein
Synonyms: 2310061K06Rik, CGI-25
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 7
Alteration at locus: Chemically Induced
NCBI: 66394
Homologene: 9315
Lamp3
Name: lysosomal-associated membrane protein 3
Synonyms: DC-LAMP, 1200002D17Rik, Cd208, TSC403
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 16
Alteration at locus: Chemically Induced
NCBI: 239739
VEGA: 16
Homologene: 8670
Vmn2r96
Name: vomeronasal 2, receptor 96
Synonyms: EG433070
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 17
Alteration at locus: Chemically Induced
NCBI: 433070
Skida1
Name: SKI/DACH domain containing 1
Synonyms: 5730507N06Rik, 2810030E01Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 2
Alteration at locus: Chemically Induced
NCBI: 72668
Homologene: 66327
Tob2
Name: transducer of ERBB2, 2
Synonyms: 4930545K18Rik, 2900090N22Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 15
Alteration at locus: Chemically Induced
NCBI: 57259
VEGA: 15
Homologene: 9447
Amer2
Name: APC membrane recruitment 2
Synonyms: Amer2, 2600011E07Rik, Fam123a
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 14
Alteration at locus: Chemically Induced
NCBI: 72125
VEGA: 14
Homologene: 45141
Abi3bp
Name: ABI gene family, member 3 (NESH) binding protein
Synonyms: TARSH, eratin, D930038M13Rik, 5033411B22Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 16
Alteration at locus: Chemically Induced
NCBI: 320712
VEGA: 16
Homologene: 134172
Pom121l2
Name: POM121 membrane glycoprotein-like 2 (rat)
Synonyms: LOC195236
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 13
Alteration at locus: Chemically Induced
NCBI: 195236
Homologene: 123536
Olfr122
Name: olfactory receptor 122
Synonyms: GA_x6K02T2PSCP-2230932-2231897, MOR263-10
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 17
Alteration at locus: Chemically Induced
NCBI: 258285
Homologene: 122777
Tmprss11d
Name: transmembrane protease, serine 11d
Synonyms: AsP
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 5
Alteration at locus: Chemically Induced
NCBI: 231382
Homologene: 74519
Dpf3
Name: D4, zinc and double PHD fingers, family 3
Synonyms: cer-d4, 2810403B03Rik, CERD4
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 12
Alteration at locus: Chemically Induced
NCBI: 70127
Homologene: 129842
Togaram1
Name: TOG array regulator of axonemal microtubules 1
Synonyms: A430041B07Rik, Fam179b
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 12
Alteration at locus: Chemically Induced
NCBI: 328108
VEGA: 12
Homologene: 15025
Olfr972
Name: olfactory receptor 972
Synonyms: MOR171-17, GA_x6K02T2PVTD-33572803-33573747
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 9
Alteration at locus: Chemically Induced
NCBI: 258603
VEGA: 9
Homologene: 121532
Adam3
Name: a disintegrin and metallopeptidase domain 3 (cyritestin)
Synonyms: Cyrn1, tMDC, Taz83, ADAM3, Taz83
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 8
Alteration at locus: Chemically Induced
NCBI: 11497
HGNC: HGNC:209
Homologene: 69052
Cyth4
Name: cytohesin 4
Synonyms: 2510004M07Rik, Pscd4, 5830469K17Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 15
Alteration at locus: Chemically Induced
NCBI: 72318
VEGA: 15
HGNC: HGNC:9505
Homologene: 22750
Mtmr6
Name: myotubularin related protein 6
Synonyms: 4022440C11Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 14
Alteration at locus: Chemically Induced
NCBI: 219135
VEGA: 14
HGNC: HGNC:7453
Homologene: 55842
4930447A16Rik
Name: RIKEN cDNA 4930447A16 gene
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 15
Alteration at locus: Chemically Induced
NCBI: 74892
Telo2
Name: telomere maintenance 2
Synonyms: 1200003M09Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 17
Alteration at locus: Chemically Induced
NCBI: 71718
Homologene: 41107
Olfr65
Name: olfactory receptor 65
Synonyms: 5'[b]3, MOR1-2, GA_x6K02T2PBJ9-6634906-6633983
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 7
Alteration at locus: Chemically Induced
NCBI: 18365
Homologene: 66459
Gm5065
Name: predicted gene 5065
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 7
Alteration at locus: Chemically Induced
NCBI: 272350
Terb1
Name: telomere repeat binding bouquet formation protein 1
Synonyms: Ccdc79, 4930532D21Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 8
Alteration at locus: Chemically Induced
NCBI: 320022
Homologene: 18330
Catsper4
Name: cation channel, sperm associated 4
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 4
Alteration at locus: Chemically Induced
NCBI: 329954
Homologene: 18638
Pde6d
Name: phosphodiesterase 6D, cGMP-specific, rod, delta
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 1
Alteration at locus: Chemically Induced
NCBI: 18582
HGNC: HGNC:8788
Homologene: 1954
Dnajc22
Name: DnaJ heat shock protein family (Hsp40) member C22
Synonyms: 2810451A06Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 15
Alteration at locus: Chemically Induced
NCBI: 72778
Homologene: 11777
Ddah2
Name: dimethylarginine dimethylaminohydrolase 2
Synonyms: Clone 7u, NG30, Ddah, G6a
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 17
Alteration at locus: Chemically Induced
NCBI: 51793
HGNC: HGNC:2716
Homologene: 8510
Gm2663
Name: predicted gene 2663
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 6
Alteration at locus: Chemically Induced
NCBI: 100040208
Homologene: 117995
Il6
Name: interleukin 6
Synonyms: Il-6
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 5
Alteration at locus: Chemically Induced
NCBI: 16193
HGNC: HGNC:6018
Homologene: 502
Hipk4
Name: homeodomain interacting protein kinase 4
Synonyms: LOC233020
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 7
Alteration at locus: Chemically Induced
NCBI: 233020
Homologene: 16970
Rpl3l
Name: ribosomal protein L3-like
Synonyms: 1110057H16Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 17
Alteration at locus: Chemically Induced
NCBI: 66211
Homologene: 68434
Sap18
Name: Sin3-associated polypeptide 18
Synonyms: Sap18a, D11Ertd539e, Sinbp1, C530046K05Rik, EMegR4
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 14
Alteration at locus: Chemically Induced
NCBI: 20220
Homologene: 4289
Galp
Name: galanin-like peptide
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 7
Alteration at locus: Chemically Induced
NCBI: 232836
Homologene: 11217
Sar1b
Name: secretion associated Ras related GTPase 1B
Synonyms: 2310075M17Rik, 2900019I22Rik, Sara2
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 11
Alteration at locus: Chemically Induced
NCBI: 66397
Homologene: 90905
Mrpl36
Name: mitochondrial ribosomal protein L36
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 13
Alteration at locus: Chemically Induced
NCBI: 94066
VEGA: 13
Homologene: 41872
Rab18
Name: RAB18, member RAS oncogene family
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 18
Alteration at locus: Chemically Induced
NCBI: 19330
VEGA: 18
Homologene: 40765
Genetic Alterations
ENU-induced transitions at the following base pair locations (GRCm38):
  • A to T, chromosome 1 at 71,649,335 bp
  • G to A, chromosome 1 at 74,140,947 bp
  • A to G, chromosome 1 at 75,430,790 bp
  • A to G, chromosome 1 at 81,191,872 bp
  • T to C, chromosome 1 at 86,546,716 bp
  • G to A, chromosome 1 at 135,750,628 bp
  • T to C, chromosome 1 at 153,242,632 bp
  • A to T, chromosome 1 at 191,049,280 bp
  • AGCGGCGGCGGCGGCGGCGGCGGC to AGCGGCGGCGGCGGCGGCGGC, chromosome 2 at 18,047,641 bp
  • A to C, chromosome 2 at 35,013,528 bp
  • T to A, chromosome 2 at 60,229,040 bp
  • A to T, chromosome 2 at 62,234,381 bp
  • A to G, chromosome 2 at 71,818,484 bp
  • C to G, chromosome 2 at 76,755,332 bp
  • C to A, chromosome 2 at 76,826,074 bp
  • A to T, chromosome 2 at 86,008,223 bp
  • G to T, chromosome 2 at 88,988,145 bp
  • A to G, chromosome 2 at 89,575,393 bp
  • G to T, chromosome 2 at 112,781,065 bp
  • T to C, chromosome 2 at 120,343,227 bp
  • G to T, chromosome 3 at 81,962,794 bp
  • A to G, chromosome 3 at 95,681,102 bp
  • T to C, chromosome 3 at 154,621,683 bp
  • C to T, chromosome 4 at 100,407,841 bp
  • T to A, chromosome 4 at 108,023,373 bp
  • T to C, chromosome 4 at 108,590,700 bp
  • A to T, chromosome 4 at 115,327,505 bp
  • A to G, chromosome 4 at 129,222,355 bp
  • C to T, chromosome 4 at 133,256,160 bp
  • A to T, chromosome 4 at 133,681,834 bp
  • A to G, chromosome 4 at 134,213,877 bp
  • C to A, chromosome 4 at 138,221,632 bp
  • A to G, chromosome 4 at 140,544,384 bp
  • T to C, chromosome 5 at 30,014,947 bp
  • A to G, chromosome 5 at 86,128,894 bp
  • A to G, chromosome 5 at 86,339,554 bp
  • G to A, chromosome 5 at 114,634,605 bp
  • T to C, chromosome 5 at 122,800,524 bp
  • A to G, chromosome 6 at 18,434,518 bp
  • T to C, chromosome 6 at 40,997,966 bp
  • G to T, chromosome 6 at 147,061,484 bp
  • A to G, chromosome 7 at 5,359,574 bp
  • T to A, chromosome 7 at 6,208,460 bp
  • C to A, chromosome 7 at 27,529,004 bp
  • T to A, chromosome 7 at 31,138,103 bp
  • T to A, chromosome 7 at 45,076,609 bp
  • A to G, chromosome 7 at 46,699,489 bp
  • G to A, chromosome 7 at 62,379,096 bp
  • A to G, chromosome 7 at 62,463,638 bp
  • G to T, chromosome 7 at 87,002,426 bp
  • T to A, chromosome 7 at 103,907,042 bp
  • A to T, chromosome 7 at 120,216,185 bp
  • T to G, chromosome 7 at 131,110,989 bp
  • A to G, chromosome 7 at 144,654,250 bp
  • A to C, chromosome 8 at 15,131,151 bp
  • A to T, chromosome 8 at 24,697,238 bp
  • A to T, chromosome 8 at 34,851,106 bp
  • A to G, chromosome 8 at 70,402,533 bp
  • T to A, chromosome 8 at 94,934,480 bp
  • A to G, chromosome 8 at 104,452,699 bp
  • T to C, chromosome 8 at 105,018,398 bp
  • A to G, chromosome 8 at 122,482,712 bp
  • T to C, chromosome 8 at 123,332,918 bp
  • C to T, chromosome 8 at 126,428,114 bp
  • A to G, chromosome 9 at 39,874,058 bp
  • A to G, chromosome 9 at 53,562,491 bp
  • T to A, chromosome 9 at 72,617,685 bp
  • T to C, chromosome 9 at 79,774,218 bp
  • A to G, chromosome 10 at 11,291,028 bp
  • A to T, chromosome 10 at 21,997,335 bp
  • G to A, chromosome 10 at 22,371,012 bp
  • T to A, chromosome 10 at 22,707,677 bp
  • C to A, chromosome 10 at 76,458,065 bp
  • G to T, chromosome 10 at 80,640,009 bp
  • T to A, chromosome 10 at 93,016,604 bp
  • C to T, chromosome 10 at 106,936,207 bp
  • A to T, chromosome 11 at 9,133,240 bp
  • T to A, chromosome 11 at 26,422,459 bp
  • A to T, chromosome 11 at 51,779,687 bp
  • A to T, chromosome 11 at 65,187,028 bp
  • A to G, chromosome 11 at 82,445,163 bp
  • A to G, chromosome 11 at 99,282,451 bp
  • A to T, chromosome 11 at 99,540,087 bp
  • T to C, chromosome 12 at 65,002,659 bp
  • A to T, chromosome 12 at 76,074,579 bp
  • A to G, chromosome 12 at 83,350,782 bp
  • G to T, chromosome 12 at 104,409,214 bp
  • A to T, chromosome 12 at 108,118,254 bp
  • T to C, chromosome 12 at 112,659,625 bp
  • C to T, chromosome 13 at 11,851,188 bp
  • C to A, chromosome 13 at 12,414,478 bp
  • A to G, chromosome 13 at 21,982,734 bp
  • A to T, chromosome 13 at 22,620,188 bp
  • G to A, chromosome 13 at 70,779,518 bp
  • A to G, chromosome 13 at 73,331,568 bp
  • A to G, chromosome 13 at 77,999,637 bp
  • T to A, chromosome 14 at 47,384,587 bp
  • A to T, chromosome 14 at 51,365,347 bp
  • T to A, chromosome 14 at 52,003,705 bp
  • A to G, chromosome 14 at 57,798,564 bp
  • T to C, chromosome 14 at 60,298,992 bp
  • A to C, chromosome 14 at 60,378,445 bp
  • T to A, chromosome 14 at 61,604,886 bp
  • T to A, chromosome 14 at 104,522,542 bp
  • T to G, chromosome 15 at 37,440,498 bp
  • T to A, chromosome 15 at 63,828,126 bp
  • T to G, chromosome 15 at 78,608,171 bp
  • T to C, chromosome 15 at 81,851,199 bp
  • T to C, chromosome 15 at 99,101,233 bp
  • C to T, chromosome 15 at 101,920,651 bp
  • T to C, chromosome 16 at 16,435,960 bp
  • A to T, chromosome 16 at 19,701,211 bp
  • T to A, chromosome 16 at 43,577,652 bp
  • A to G, chromosome 16 at 56,677,796 bp
  • T to G, chromosome 17 at 18,326,062 bp
  • G to T, chromosome 17 at 18,584,001 bp
  • A to C, chromosome 17 at 24,735,516 bp
  • A to T, chromosome 17 at 25,105,408 bp
  • A to T, chromosome 17 at 32,774,777 bp
  • T to C, chromosome 17 at 33,066,967 bp
  • A to G, chromosome 17 at 34,671,750 bp
  • A to G, chromosome 17 at 35,060,426 bp
  • A to G, chromosome 17 at 37,772,576 bp
  • A to G, chromosome 17 at 84,994,202 bp
  • A to T, chromosome 18 at 6,770,113 bp
  • A to T, chromosome 18 at 61,083,334 bp
  • C to A, chromosome 19 at 59,276,505 bp
Genotype Determination
Phenotype
G1 male heterozygous mice are viable and fertile. The G1 mice were not characterized prior to archiving.
Strain Development
C57BL/6J mice were injected with ENU, resulting in G0 mice that were bred back to C57BL/6J. Sperm was archived from G1 male mice that produced viable G2 mice.
Suggested Control Mice
Wild-type littermates or C57BL/6J mice
Donor
Bruce Beutler, M.D., University of Texas Southwestern Medical Center.
Primary Reference
MUTAGENETIX record for R2018 (G1). B. Beutler and colleagues, Center for the Genetics of Host Defense, UT Southwestern, Dallas, TX.

Colony and Husbandry Information

Colony Surveillance Program and Current Health Reports

Mice recovered from a cryo-archive will have health surveillance performed on recipient females. Health reports will be provided prior to shipment. If you require additional health status information, please email mmrrc@missouri.edu .
Coat Color
Black
MMRRC Breeding System
Random intra-strain mating
Breeding Scheme(s)
When maintaining a live colony, heterozygous mice may be bred together, bred with wild-type siblings, or bred with C57BL/6J inbred mice.
Overall Breeding Performance
Undetermined; during development, mating was done with heterozygous males; viability, fertility and other breeding statistics for heterozygous females and homozygotes are unverified, but presumably would be similar to the C57BL/6J background strain
Average litter size
Undetermined
Recommended wean age
3 weeks

Order Request Information

Limited quantities of breeder mice (recovered litter) are available from a cryoarchive; recovered litter usually available to ship in 3 to 4 months.

Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

Distribution of this strain requires submission of the MMRRC Conditions of Use (COU). A link to the COU web form will be provided via email after an order has been placed; the form should be completed then or the email forwarded to your institutional official for completion.

The donor or their institution limits the distribution to non-profit institutions only.

Additional charges may apply for any special requests. Shipping costs are in addition to the basic distribution/resuscitation fees. Information on shipping costs and any additional charges will be provided by the supplying MMRRC facility.

Click button to Request this one strain. (Use the MMRRC Catalog Search to request more than one strain.)
MMRRC Item # Description Distribution Fee / Unit (US $) Units Notes
040027-MU-RESUS Litter recovered from cryo-archive $5,475.00 / Non-Profit Litter Recovered litter1; additional fees for any special requests.
Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

Some MMRRC strains were submitted by the donor as cryopreserved germplasm, and because these strains were not cryopreserved by the MMRRC, we have not assessed the quality of this material. We have extensive experience with recovery of mice from cryopreserved sperm and embryos of varying quality, including using techniques such as IVF and ICSI, and are confident that we will have success in most, if not all, cases. However, because of the unknown quality of these frozen samples, we will restrict recovery efforts to two attempts for each order. Subsequent attempts can be performed on a fee-for-service basis, in addition to the standard fees, upon request.

1 The distribution fee covers the expense of resuscitating mice from the cryo-archive; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

2 An aliquot is one straw or vial with sufficient sperm to recover at least one litter of mice, as per provided protocols, when performed at the MMRRC facility. The MMRRC makes no guarantee concerning the success of these procedures when performed outside the MMRRC facilities.

3 An aliquot contains a sufficient number of embryos (in one or more vials or straws and based on the transfer success rate of the MMRRC facility) to transfer into one to three recipients. The MMRRC makes no guarantee concerning embryo transfer success experienced in the recipient investigator's laboratory. Neither gender nor genotype ratios are guaranteed.

To request material from the MMRRC: Please fill out our on-line request form (accessible from the catalog search results page, or click the Request this Strain button in the fees section). If you have questions or need assistance completing this form, you may call Customer Service at (800) 910-2291 (in USA or Canada) or (530) 757-5710 (international calls). Before you call, please have with you: the MMRRC item number, quantity needed, Bill-to and Ship-to contact information.