Loading Mouse GIF
Loading...

Strain Name:
C57BL/6J-MtgxR2018Btlr/Mmmh
Stock Number:
040027-MU
Citation ID:
RRID:MMRRC_040027-MU
Other Names:
R2018 (G1), C57BL/6J-MtgxR2018Btlr
Major Collection:

Strain Information

Itga6
Name: integrin alpha 6
Synonyms: Cd49f, 5033401O05Rik
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 16403
HGNC: HGNC:6142
Homologene: 20091
Upp1
Name: uridine phosphorylase 1
Synonyms: UdRPase, UPase, Up
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 22271
Homologene: 2524
Orc1
Name: origin recognition complex, subunit 1
Synonyms: MmORC1, Orc1l
Type: Gene
Species: Mouse
Chromosome: 4
NCBI: 18392
HGNC: HGNC:8487
Homologene: 31221
Fgd4
Name: FYVE, RhoGEF and PH domain containing 4
Synonyms: Frabin-gamma, Frabin-beta, Frabin-alpha, Frabin, 9330209B17Rik, ZFYVE6
Type: Gene
Species: Mouse
Chromosome: 16
NCBI: 224014
Homologene: 26727
Trim13
Name: tripartite motif-containing 13
Synonyms: 3110001L12Rik, LEU5, Rfp2, RNF77
Type: Gene
Species: Mouse
Chromosome: 14
NCBI: 66597
VEGA: 14
HGNC: HGNC:9976
Homologene: 4234
Ano1
Name: anoctamin 1, calcium activated chloride channel
Synonyms: Tmem16a
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 101772
Homologene: 75079
Genetic Alterations
ENU-induced transitions at the following base pair locations (GRCm38):
  • A to T, chromosome 1 at 71,649,335 bp
  • G to A, chromosome 1 at 74,140,947 bp
  • A to G, chromosome 1 at 75,430,790 bp
  • A to G, chromosome 1 at 81,191,872 bp
  • T to C, chromosome 1 at 86,546,716 bp
  • G to A, chromosome 1 at 135,750,628 bp
  • T to C, chromosome 1 at 153,242,632 bp
  • A to T, chromosome 1 at 191,049,280 bp
  • AGCGGCGGCGGCGGCGGCGGCGGC to AGCGGCGGCGGCGGCGGCGGC, chromosome 2 at 18,047,641 bp
  • A to C, chromosome 2 at 35,013,528 bp
  • T to A, chromosome 2 at 60,229,040 bp
  • A to T, chromosome 2 at 62,234,381 bp
  • A to G, chromosome 2 at 71,818,484 bp
  • C to G, chromosome 2 at 76,755,332 bp
  • C to A, chromosome 2 at 76,826,074 bp
  • A to T, chromosome 2 at 86,008,223 bp
  • G to T, chromosome 2 at 88,988,145 bp
  • A to G, chromosome 2 at 89,575,393 bp
  • G to T, chromosome 2 at 112,781,065 bp
  • T to C, chromosome 2 at 120,343,227 bp
  • G to T, chromosome 3 at 81,962,794 bp
  • A to G, chromosome 3 at 95,681,102 bp
  • T to C, chromosome 3 at 154,621,683 bp
  • C to T, chromosome 4 at 100,407,841 bp
  • T to A, chromosome 4 at 108,023,373 bp
  • T to C, chromosome 4 at 108,590,700 bp
  • A to T, chromosome 4 at 115,327,505 bp
  • A to G, chromosome 4 at 129,222,355 bp
  • C to T, chromosome 4 at 133,256,160 bp
  • A to T, chromosome 4 at 133,681,834 bp
  • A to G, chromosome 4 at 134,213,877 bp
  • C to A, chromosome 4 at 138,221,632 bp
  • A to G, chromosome 4 at 140,544,384 bp
  • T to C, chromosome 5 at 30,014,947 bp
  • A to G, chromosome 5 at 86,128,894 bp
  • A to G, chromosome 5 at 86,339,554 bp
  • G to A, chromosome 5 at 114,634,605 bp
  • T to C, chromosome 5 at 122,800,524 bp
  • A to G, chromosome 6 at 18,434,518 bp
  • T to C, chromosome 6 at 40,997,966 bp
  • G to T, chromosome 6 at 147,061,484 bp
  • A to G, chromosome 7 at 5,359,574 bp
  • T to A, chromosome 7 at 6,208,460 bp
  • C to A, chromosome 7 at 27,529,004 bp
  • T to A, chromosome 7 at 31,138,103 bp
  • T to A, chromosome 7 at 45,076,609 bp
  • A to G, chromosome 7 at 46,699,489 bp
  • G to A, chromosome 7 at 62,379,096 bp
  • A to G, chromosome 7 at 62,463,638 bp
  • G to T, chromosome 7 at 87,002,426 bp
  • T to A, chromosome 7 at 103,907,042 bp
  • A to T, chromosome 7 at 120,216,185 bp
  • T to G, chromosome 7 at 131,110,989 bp
  • A to G, chromosome 7 at 144,654,250 bp
  • A to C, chromosome 8 at 15,131,151 bp
  • A to T, chromosome 8 at 24,697,238 bp
  • A to T, chromosome 8 at 34,851,106 bp
  • A to G, chromosome 8 at 70,402,533 bp
  • T to A, chromosome 8 at 94,934,480 bp
  • A to G, chromosome 8 at 104,452,699 bp
  • T to C, chromosome 8 at 105,018,398 bp
  • A to G, chromosome 8 at 122,482,712 bp
  • T to C, chromosome 8 at 123,332,918 bp
  • C to T, chromosome 8 at 126,428,114 bp
  • A to G, chromosome 9 at 39,874,058 bp
  • A to G, chromosome 9 at 53,562,491 bp
  • T to A, chromosome 9 at 72,617,685 bp
  • T to C, chromosome 9 at 79,774,218 bp
  • A to G, chromosome 10 at 11,291,028 bp
  • A to T, chromosome 10 at 21,997,335 bp
  • G to A, chromosome 10 at 22,371,012 bp
  • T to A, chromosome 10 at 22,707,677 bp
  • C to A, chromosome 10 at 76,458,065 bp
  • G to T, chromosome 10 at 80,640,009 bp
  • T to A, chromosome 10 at 93,016,604 bp
  • C to T, chromosome 10 at 106,936,207 bp
  • A to T, chromosome 11 at 9,133,240 bp
  • T to A, chromosome 11 at 26,422,459 bp
  • A to T, chromosome 11 at 51,779,687 bp
  • A to T, chromosome 11 at 65,187,028 bp
  • A to G, chromosome 11 at 82,445,163 bp
  • A to G, chromosome 11 at 99,282,451 bp
  • A to T, chromosome 11 at 99,540,087 bp
  • T to C, chromosome 12 at 65,002,659 bp
  • A to T, chromosome 12 at 76,074,579 bp
  • A to G, chromosome 12 at 83,350,782 bp
  • G to T, chromosome 12 at 104,409,214 bp
  • A to T, chromosome 12 at 108,118,254 bp
  • T to C, chromosome 12 at 112,659,625 bp
  • C to T, chromosome 13 at 11,851,188 bp
  • C to A, chromosome 13 at 12,414,478 bp
  • A to G, chromosome 13 at 21,982,734 bp
  • A to T, chromosome 13 at 22,620,188 bp
  • G to A, chromosome 13 at 70,779,518 bp
  • A to G, chromosome 13 at 73,331,568 bp
  • A to G, chromosome 13 at 77,999,637 bp
  • T to A, chromosome 14 at 47,384,587 bp
  • A to T, chromosome 14 at 51,365,347 bp
  • T to A, chromosome 14 at 52,003,705 bp
  • A to G, chromosome 14 at 57,798,564 bp
  • T to C, chromosome 14 at 60,298,992 bp
  • A to C, chromosome 14 at 60,378,445 bp
  • T to A, chromosome 14 at 61,604,886 bp
  • T to A, chromosome 14 at 104,522,542 bp
  • T to G, chromosome 15 at 37,440,498 bp
  • T to A, chromosome 15 at 63,828,126 bp
  • T to G, chromosome 15 at 78,608,171 bp
  • T to C, chromosome 15 at 81,851,199 bp
  • T to C, chromosome 15 at 99,101,233 bp
  • C to T, chromosome 15 at 101,920,651 bp
  • T to C, chromosome 16 at 16,435,960 bp
  • A to T, chromosome 16 at 19,701,211 bp
  • T to A, chromosome 16 at 43,577,652 bp
  • A to G, chromosome 16 at 56,677,796 bp
  • T to G, chromosome 17 at 18,326,062 bp
  • G to T, chromosome 17 at 18,584,001 bp
  • A to C, chromosome 17 at 24,735,516 bp
  • A to T, chromosome 17 at 25,105,408 bp
  • A to T, chromosome 17 at 32,774,777 bp
  • T to C, chromosome 17 at 33,066,967 bp
  • A to G, chromosome 17 at 34,671,750 bp
  • A to G, chromosome 17 at 35,060,426 bp
  • A to G, chromosome 17 at 37,772,576 bp
  • A to G, chromosome 17 at 84,994,202 bp
  • A to T, chromosome 18 at 6,770,113 bp
  • A to T, chromosome 18 at 61,083,334 bp
  • C to A, chromosome 19 at 59,276,505 bp
Genotype Determination
Phenotype
G1 male heterozygous mice are viable and fertile. The G1 mice were not characterized prior to archiving.
Strain GQC Summary
The MMRRC Centers have developed a Strain GQC pipeline using MiniMUGA array genotyping to provide additional information on strain backgrounds for MMRRC strains. For more information on whether data may be available, or to request genotyping for a strain of interest, please contact MMRRC_GeneticQC@med.unc.edu. Older strains may not have this information available.
Suggested Control Mice
Littermates of all relevant genotypes.
Donor
Bruce Beutler, M.D., University of Texas Southwestern Medical Center.
Primary Reference
MUTAGENETIX record for R2018 (G1). B. Beutler and colleagues, Center for the Genetics of Host Defense, UT Southwestern, Dallas, TX.
Strain Development
C57BL/6J mice were injected with ENU, resulting in G0 mice that were bred back to C57BL/6J. Sperm was archived from G1 male mice that produced viable G2 mice.


Disclaimer: If MMRRC Strain Genetic Quality Control (GQC; based on MiniMUGA genotyping and analysis) has been completed for this strain, the information might differ from the genetic background information provided by the submitter. MiniMUGA genetic analysis is done on a strain’s tissue samples taken when archived by or ordered from the assigned MMRRC Center.

Colony and Husbandry Information

Colony Surveillance Program and Current Health Reports

Mice recovered from a cryo-archive will have health surveillance performed on recipient females. Health reports will be provided prior to shipment. If you require additional health status information, please email mmrrc@missouri.edu.
Coat Color
Black
MMRRC Breeding System
Random intra-strain mating
Breeding Scheme(s)
When maintaining a live colony, heterozygous mice may be bred together, bred with wild-type siblings, or bred with C57BL/6J inbred mice.
Overall Breeding Performance
Undetermined; during development, mating was done with heterozygous males; viability, fertility and other breeding statistics for heterozygous females and homozygotes are unverified, but presumably would be similar to the C57BL/6J background strain
Average litter size
Undetermined
Recommended wean age
3 weeks

Order Request Information

Limited quantities of breeder mice (recovered litter) are available from a cryoarchive; recovered litter usually available to ship in 3 to 4 months.

Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

Distribution of this strain requires submission of the MMRRC Conditions of Use (COU). A link to the COU web form will be provided via email after an order has been placed; the form should be completed then or the email forwarded to your institutional official for completion.

The donor or their institution limits the distribution to non-profit institutions only.

Additional charges may apply for any special requests. Shipping costs are in addition to the basic distribution/resuscitation fees. Information on shipping costs and any additional charges will be provided by the supplying MMRRC facility.

Click button to Request this one strain. (Use the MMRRC Catalog Search to request more than one strain.)
MMRRC Item # Description Distribution Fee / Unit (US $)
*Shipping & Handling not included*
Units Notes
040027-MU-RESUS Litter recovered from cryo-archive $5,475.00 / Non-Profit Litter Recovered litter4; additional fees for any special requests.
Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

Some MMRRC strains were submitted by the donor as cryopreserved germplasm, and because these strains were not cryopreserved by the MMRRC, we have not assessed the quality, nor genotype, of this material. Our expertise in reviving mice from various qualities of frozen sperm and embryos, using methods like IVF and ICSI, gives us confidence in successful recoveries in most cases. However, due to the uncertain quality of these samples, we'll limit revival attempts to two per order. Additional attempts are available for a fee, on top of standard charges, if requested. It's important to note that some strains may lack the expected mutation, so we can't assure successful order fulfillment until we attempt to revive the strain.

1 The distribution fee covers the expense of rederiving mice from a live mouse; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

2 An aliquot contains a sufficient number of embryos (in one or more vials or straws and based on the transfer success rate of the MMRRC facility) to transfer into one to three recipients. The MMRRC makes no guarantee concerning embryo transfer success experienced in the recipient investigator's laboratory. Neither gender nor genotype ratios are guaranteed.

3 An aliquot is one straw or vial with sufficient sperm to recover at least one litter of mice, as per provided protocols, when performed at the MMRRC facility. The MMRRC makes no guarantee concerning the success of these procedures when performed outside the MMRRC facilities.

4 The distribution fee covers the expense of resuscitating mice from the cryo-archive; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

To request material from the MMRRC: Please fill out our on-line request form (accessible from the catalog search results page, or click the Request this Strain button in the fees section). If you have questions or need assistance completing this form, you may call Customer Service at (800) 910-2291 (in USA or Canada) or (530) 757-5710 (international calls). Before you call, please have with you: the MMRRC item number, quantity needed, Bill-to and Ship-to contact information.