Loading Mouse GIF
Loading...

Strain Name:
C57BL/6J-MtgxR2154Btlr/Mmmh
Stock Number:
040157-MU
Citation ID:
RRID:MMRRC_040157-MU
Other Names:
R2154 (G1), C57BL/6J-MtgxR2154Btlr
Major Collection:

Strain Information

Tln2
Name: talin 2
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 70549
VEGA: 9
Homologene: 56692
Slc6a1
Name: solute carrier family 6 (neurotransmitter transporter, GABA), member 1
Synonyms: XT-1, Gabt, Xtrp1, Gat1, Gabt1, GAT-1
Type: Gene
Species: Mouse
Chromosome: 6
NCBI: 232333
Homologene: 2290
Aldh1l1
Name: aldehyde dehydrogenase 1 family, member L1
Synonyms: 1810048F20Rik, Fthfd
Type: Gene
Species: Mouse
Chromosome: 6
NCBI: 107747
HGNC: HGNC:3978
Homologene: 122031
Ptpn12
Name: protein tyrosine phosphatase, non-receptor type 12
Synonyms: P19-PTP, PTP-PEST, PTP-P19
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 19248
HGNC: HGNC:9645
Homologene: 37691
Kif16b
Name: kinesin family member 16B
Synonyms: N-3 kinesin, 8430434E15Rik
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 16558
Homologene: 135708
Nfkb1
Name: nuclear factor of kappa light polypeptide gene enhancer in B cells 1, p105
Synonyms: NF kappaB1, p50 subunit of NF kappaB, p50/p105, p50, nuclear factor kappaB p50, NF-kappaB, NF-kappaB p50
Type: Gene
Species: Mouse
Chromosome: 3
NCBI: 18033
HGNC: HGNC:7794
Homologene: 2971
Cdca2
Name: cell division cycle associated 2
Synonyms: 2610311M19Rik
Type: Gene
Species: Mouse
Chromosome: 14
NCBI: 108912
Homologene: 18444
Genetic Alterations
ENU-induced transitions at the following base pair locations (GRCm38):
  • A to T, chromosome 1 at 10,337,322 bp
  • C to T, chromosome 2 at 9,951,566 bp
  • T to C, chromosome 2 at 23,162,508 bp
  • A to T, chromosome 2 at 26,413,745 bp
  • T to A, chromosome 2 at 32,802,856 bp
  • A to C, chromosome 2 at 34,991,103 bp
  • T to C, chromosome 2 at 37,475,441 bp
  • A to C, chromosome 2 at 114,137,004 bp
  • T to C, chromosome 2 at 142,690,580 bp
  • G to A, chromosome 2 at 170,800,896 bp
  • A to G, chromosome 3 at 5,401,741 bp
  • A to T, chromosome 3 at 38,887,539 bp
  • A to G, chromosome 3 at 82,111,151 bp
  • G to T, chromosome 3 at 90,238,485 bp
  • T to C, chromosome 3 at 135,601,479 bp
  • T to C, chromosome 4 at 46,129,235 bp
  • A to G, chromosome 4 at 155,429,296 bp
  • C to A, chromosome 5 at 21,002,468 bp
  • C to G, chromosome 5 at 21,803,129 bp
  • T to C, chromosome 5 at 30,108,299 bp
  • A to T, chromosome 5 at 35,605,224 bp
  • A to T, chromosome 5 at 65,650,498 bp
  • A to G, chromosome 5 at 108,080,931 bp
  • A to T, chromosome 5 at 124,378,511 bp
  • G to A, chromosome 5 at 137,414,249 bp
  • A to T, chromosome 5 at 145,092,559 bp
  • C to T, chromosome 6 at 3,372,945 bp
  • T to A, chromosome 6 at 18,870,031 bp
  • T to A, chromosome 6 at 89,933,983 bp
  • T to C, chromosome 6 at 90,562,726 bp
  • G to T, chromosome 6 at 114,307,770 bp
  • T to A, chromosome 6 at 123,839,846 bp
  • G to C, chromosome 6 at 130,333,144 bp
  • A to C, chromosome 7 at 44,652,429 bp
  • A to G, chromosome 7 at 85,563,715 bp
  • G to A, chromosome 7 at 86,719,851 bp
  • A to T, chromosome 7 at 118,158,076 bp
  • A to G, chromosome 7 at 118,489,884 bp
  • A to C, chromosome 7 at 128,085,577 bp
  • A to G, chromosome 8 at 22,910,270 bp
  • A to G, chromosome 8 at 72,455,115 bp
  • A to G, chromosome 8 at 91,026,664 bp
  • T to C, chromosome 8 at 109,560,674 bp
  • T to A, chromosome 8 at 110,889,072 bp
  • T to C, chromosome 8 at 114,205,951 bp
  • A to G, chromosome 8 at 119,756,102 bp
  • C to A, chromosome 9 at 36,723,983 bp
  • G to T, chromosome 9 at 38,594,411 bp
  • T to C, chromosome 9 at 45,945,340 bp
  • C to T, chromosome 9 at 56,207,212 bp
  • T to A, chromosome 9 at 64,307,263 bp
  • T to C, chromosome 9 at 67,302,560 bp
  • T to A, chromosome 9 at 88,957,481 bp
  • T to A, chromosome 9 at 106,285,574 bp
  • T to C, chromosome 9 at 119,208,687 bp
  • A to G, chromosome 10 at 68,431,262 bp
  • T to A, chromosome 11 at 98,485,649 bp
  • A to G, chromosome 11 at 110,292,174 bp
  • A to G, chromosome 11 at 118,411,437 bp
  • A to G, chromosome 12 at 11,457,985 bp
  • A to T, chromosome 12 at 21,112,083 bp
  • T to A, chromosome 12 at 40,820,662 bp
  • ACCTGCTCTGCC to ACCTGCTCTGCCTGCTCTGCC, chromosome 12 at 40,844,548 bp
  • A to G, chromosome 12 at 112,120,974 bp
  • T to C, chromosome 13 at 43,303,470 bp
  • T to C, chromosome 13 at 48,820,073 bp
  • T to A, chromosome 13 at 60,729,503 bp
  • T to C, chromosome 13 at 63,866,007 bp
  • A to T, chromosome 14 at 21,668,667 bp
  • A to G, chromosome 14 at 26,418,247 bp
  • T to C, chromosome 14 at 33,934,389 bp
  • G to A, chromosome 14 at 67,676,976 bp
  • C to A, chromosome 15 at 10,486,635 bp
  • A to T, chromosome 16 at 90,961,536 bp
  • A to T, chromosome 17 at 18,947,322 bp
  • T to A, chromosome 17 at 20,846,801 bp
  • T to A, chromosome 17 at 23,631,074 bp
  • C to T, chromosome 17 at 23,834,843 bp
  • A to G, chromosome 17 at 24,377,719 bp
  • G to T, chromosome 17 at 78,831,444 bp
  • T to C, chromosome 18 at 36,741,687 bp
  • A to T, chromosome 18 at 44,169,127 bp
  • C to T, chromosome 18 at 61,259,849 bp
  • T to A, chromosome 18 at 65,210,330 bp
  • T to C, chromosome 18 at 84,209,649 bp
  • T to C, chromosome 19 at 4,627,158 bp
  • T to A, chromosome 19 at 39,034,375 bp
  • T to A, chromosome X at 151,382,004 bp
Genotype Determination
Phenotype
G1 male heterozygous mice are viable and fertile. The G1 mice were not characterized prior to archiving.
Strain GQC Summary
Gene Specific Genotyping:

To request gene-specific and other genotyping services for a strain, please contact the distribution MMRRC Center for more information.

Background Genetic Quality:

The MMRRC has developed a Genetic Quality Control pipeline using the MiniMUGA array to provide additional information to identify and validate genetic backgrounds of MMRRC strains. For more information on whether genetic background data is available, please contact MMRRC_GeneticQC@med.unc.edu. Note: that MiniMUGA genetic background data is not available on all strains, but can be ordered if desired.

Suggested Control Mice
Littermates of all relevant genotypes.
Submitter
Bruce Beutler, M.D., University of Texas Southwestern Medical Center.
Primary Reference
MUTAGENETIX record for R2154 (G1). B. Beutler and colleagues, Center for the Genetics of Host Defense, UT Southwestern, Dallas, TX.
Strain Development
C57BL/6J mice were injected with ENU, resulting in G0 mice that were bred back to C57BL/6J. Sperm was archived from G1 male mice that produced viable G2 mice.


Disclaimer: If MMRRC Strain Genetic Quality Control (GQC; based on MiniMUGA genotyping and analysis) has been completed for this strain, the information might differ from the genetic background information provided by the submitter. MiniMUGA genetic analysis is done on a strain’s tissue samples taken when archived by or ordered from the assigned MMRRC Center.

Colony and Husbandry Information

Colony Surveillance Program and Current Health Reports

Mice recovered from a cryo-archive will have health surveillance performed on recipient females. Health reports will be provided prior to shipment. If you require additional health status information, please email mmrrc@missouri.edu.
Coat Color
Black
MMRRC Breeding System
Random intra-strain mating
Breeding Scheme(s)
When maintaining a live colony, heterozygous mice may be bred together, bred with wild-type siblings, or bred with C57BL/6J inbred mice.
Overall Breeding Performance
Undetermined; during development, mating was done with heterozygous males; viability, fertility and other breeding statistics for heterozygous females and homozygotes are unverified, but presumably would be similar to the C57BL/6J background strain
Average litter size
Undetermined
Recommended wean age
3 weeks

Order Information

Limited quantities of breeder mice (recovered litter) are available from a cryoarchive; recovered litter usually available to ship in 3 to 4 months.

Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

Distribution of this strain requires submission of the MMRRC Conditions of Use (COU). A link to the COU web form will be provided via email after an order has been placed; the form should be completed then or the email forwarded to your institutional official for completion.

The submitter or their institution limits the distribution to non-profit institutions only.

Additional charges may apply for any special requests. Shipping costs are in addition to the basic distribution/resuscitation fees. Information on shipping costs and any additional charges will be provided by the supplying MMRRC facility.

Click button to Request this one strain. (Use the MMRRC Catalog Search to request more than one strain.)
MMRRC Item # Description Distribution Fee / Unit (US $)
*Shipping & Handling not included*
Units Notes
040157-MU-RESUS Litter recovered from cryo-archive $5,475.00 / Non-Profit Litter Recovered litter4; additional fees for any special requests.
Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

Some MMRRC strains were submitted by the submitter as cryopreserved germplasm, and because these strains were not cryopreserved by the MMRRC, we have not assessed the quality, nor genotype, of this material. Our expertise in reviving mice from various qualities of frozen sperm and embryos, using methods like IVF and ICSI, gives us confidence in successful recoveries in most cases. However, due to the uncertain quality of these samples, we'll limit revival attempts to two per order. Additional attempts are available for a fee, on top of standard charges, if requested. It's important to note that some strains may lack the expected mutation, so we can't assure successful order fulfillment until we attempt to revive the strain.

1 The distribution fee covers the expense of rederiving mice from a live mouse; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

2 An aliquot contains a sufficient number of embryos (in one or more vials or straws and based on the transfer success rate of the MMRRC facility) to transfer into one to three recipients. The MMRRC makes no guarantee concerning embryo transfer success experienced in the recipient investigator's laboratory. Neither gender nor genotype ratios are guaranteed.

3 An aliquot is one straw or vial with sufficient sperm to recover at least one litter of mice, as per provided protocols, when performed at the MMRRC facility. The MMRRC makes no guarantee concerning the success of these procedures when performed outside the MMRRC facilities.

4 The distribution fee covers the expense of resuscitating mice from the cryo-archive; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

To request material from the MMRRC: Please fill out our on-line request form (accessible from the catalog search results page, or click the Request this Strain button in the fees section). If you have questions or need assistance completing this form, you may call Customer Service at (800) 910-2291 (in USA or Canada) or (530) 757-5710 (international calls). Before you call, please have with you: the MMRRC item number, quantity needed, Bill-to and Ship-to contact information.