Strain Name:
Stock Number:
Citation ID:
Other Names:
R2154 (G1), C57BL/6J-MtgxR2154Btlr
Major Collection:

Gene Information

Name: talin 2
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 9
NCBI: 70549
Homologene: 56692
Name: solute carrier family 6 (neurotransmitter transporter, GABA), member 1
Synonyms: XT-1, Gabt, Xtrp1, Gat1, Gabt1, GAT-1
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 6
NCBI: 232333
Homologene: 2290
Name: aldehyde dehydrogenase 1 family, member L1
Synonyms: 1810048F20Rik, Fthfd
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 6
NCBI: 107747
Homologene: 122031
Name: protein tyrosine phosphatase, non-receptor type 12
Synonyms: P19-PTP, PTP-PEST, PTP-P19
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 5
NCBI: 19248
Homologene: 37691
Name: kinesin family member 16B
Synonyms: N-3 kinesin, 8430434E15Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 2
NCBI: 16558
Homologene: 135708
Name: nuclear factor of kappa light polypeptide gene enhancer in B cells 1, p105
Synonyms: NF kappaB1, p50 subunit of NF kappaB, p50/p105, p50, nuclear factor kappaB p50, NF-kappaB, NF-kappaB p50
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 3
NCBI: 18033
Homologene: 2971
Name: cell division cycle associated 2
Synonyms: 2610311M19Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 14
NCBI: 108912
Homologene: 18444
Name: DEAH (Asp-Glu-Ala-His) box polypeptide 38
Synonyms: Prp16, Ddx38, 5730550P09Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 8
NCBI: 64340
Homologene: 8512
Name: K(lysine) acetyltransferase 6B
Synonyms: qkf, querkopf, Morf, B130044K16Rik, monocytic leukemia, Myst4
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 14
NCBI: 54169
Homologene: 136480
Name: TATA-box binding protein associated factor 3
Synonyms: mTAFII140, 4933439M23Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 2
NCBI: 209361
Homologene: 35415
Name: strawberry notch 1
Synonyms: sno, 9330180L10Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 5
NCBI: 243272
Homologene: 10055
Name: PDS5 cohesin associated factor A
Synonyms: E230024D05Rik, 9030416H16Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 5
NCBI: 71521
Homologene: 22877
Name: chromodomain helicase DNA binding protein 9
Synonyms: 1810014J18Rik, AD013, A330063D19Rik, 9030205D12Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 8
NCBI: 109151
Homologene: 11844
Name: SEC16 homolog A, endoplasmic reticulum export factor
Synonyms: C230052J16Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 2
NCBI: 227648
Homologene: 10533
Name: neural precursor cell expressed, developmentally down-regulated gene 4-like
Synonyms: 1300012C07Rik, Nedd4-2, Nedd4b
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 18
NCBI: 83814
VEGA: 18
Homologene: 86986
Name: metal response element binding transcription factor 2
Synonyms: M96, 9230112N11Rik, C76717, Pcl2
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 5
NCBI: 17765
Homologene: 7207
Name: SMG1 nonsense mediated mRNA decay associated PI3K related kinase
Synonyms: C130002K18Rik, 5430435M13Rik, 2610207I05Rik, SMG1 homolog, phosphatidylinositol 3-kinase-related kinase (C. elegans)
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 7
NCBI: 233789
Homologene: 56697
Name: RAB GTPase activating protein 1
Synonyms: Gapcena
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 2
NCBI: 227800
Homologene: 49301
Name: zinc finger protein 407
Synonyms: LOC240469, LOC381139, 6430585N13Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 18
NCBI: 240476
Homologene: 86402
Name: dedicator of cytokinesis 4
Synonyms: EST N28122, 6330411N01Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 12
NCBI: 238130
VEGA: 12
Homologene: 56680
Name: growth differentiation factor 10
Synonyms: Bmp3b
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 14
NCBI: 14560
VEGA: 14
Homologene: 3640
Name: checkpoint kinase 1
Synonyms: Chk1
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 9
NCBI: 12649
Homologene: 975
Name: glucose-fructose oxidoreductase domain containing 1
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 13
NCBI: 328232
VEGA: 13
Homologene: 49581
Name: aquarius
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 2
NCBI: 11834
Homologene: 7629
Name: family with sequence similarity 120, member C
Synonyms: D930001I21Rik, orf34
Type: Gene
Species: Mus musculus (mouse)
Chromosome: X
NCBI: 207375
Homologene: 9876
Name: POC1 centriolar protein A
Synonyms: 2510040D07Rik, Wdr51a, cha
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 9
NCBI: 70235
Homologene: 51460
Name: guanylate cyclase 1, soluble, alpha 1
Synonyms: alpha 1 sGC, 1200016O07Rik, sGC-alpha1, Gucy1a3
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 3
NCBI: 60596
Homologene: 37360
Name: myosin, heavy polypeptide 14
Synonyms: NMHC II-C, 2400004E04Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 7
NCBI: 71960
Homologene: 23480
Name: RAD1 checkpoint DNA exonuclease
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 15
NCBI: 19355
Homologene: 37695
Name: SID1 transmembrane family, member 2
Synonyms: CGI-40
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 9
NCBI: 214597
Homologene: 22943
Name: YME1-like 1 (S. cerevisiae)
Synonyms: Ftsh, ATP-dependent metalloprotease FtsH1
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 2
NCBI: 27377
Homologene: 31996
Name: death associated protein kinase 1
Synonyms: 2310039H24Rik, 2810425C21Rik, D13Ucla1, DAP-Kinase
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 13
NCBI: 69635
VEGA: 13
Homologene: 3626
Name: actin related protein 2/3 complex, subunit 1A
Synonyms: Sid32, 1110030K07Rik, 0610010H08Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 5
NCBI: 56443
Homologene: 4675
Name: sarcolemma associated protein
Synonyms: Slap, D330001L02Rik, Miranda
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 14
NCBI: 83997
Homologene: 31428
Name: pseudopodium-enriched atypical kinase 1
Synonyms: 1110049L02Rik, C230081A13Rik, NKF3 kinase family member
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 9
NCBI: 244895
Homologene: 18259
Name: K(lysine) acetyltransferase 6A
Synonyms: MOZ, Zfp220, 9930021N24Rik, Myst3
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 8
NCBI: 244349
Homologene: 4924
Name: HEAT repeat containing 5B
Synonyms: D330050P16Rik, 2010013B10Rik, A230048G03Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 17
NCBI: 320473
VEGA: 17
Homologene: 25536
Name: thiosulfate sulfurtransferase (rhodanese)-like domain containing 2
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 4
NCBI: 272027
Homologene: 16403
Name: syntaxin binding protein 1
Synonyms: Munc-18a, Sxtbp1, Munc18-1, Unc18h, Rb-sec1, N-sec1, nsec1
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 2
NCBI: 20910
Homologene: 2382
Name: B cell leukemia/lymphoma 2 related protein A1a
Synonyms: A1, Bfl-1, Bcl2a1, Hbpa1
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 9
NCBI: 12044
Homologene: 2988
Name: ATP-binding cassette, sub-family A (ABC1), member 3
Synonyms: ABC-C, Abc3, 1810036E22Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 17
NCBI: 27410
Homologene: 37437
Name: zinc finger homeodomain 4
Synonyms: Zfh-4, C130041O22Rik, Zfh4
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 3
NCBI: 80892
Homologene: 23477
Name: integrin alpha M
Synonyms: complement component receptor 3 alpha, CD11B (p170), Mac-1 alpha, Mac-1, complement receptor type 3, CR3, CD11b/CD18, Mac-1a, F730045J24Rik, Ly-40, Cd11b
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 7
NCBI: 16409
Homologene: 526
Name: cilia and flagella associated protein 74
Synonyms: 2010015L04Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 4
NCBI: 544678
Homologene: 129584
Name: killer cell lectin-like receptor, subfamily A, member 3
Synonyms: 5E6, Ly49C, Nk-2, Ly49c, NK-2.1, Nk2.1, Nk2
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 6
NCBI: 16634
Homologene: 110821
Name: fucose kinase
Synonyms: L-fucose kinase, 1110046B12Rik, Fuk
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 8
NCBI: 234730
Homologene: 15452
Name: FAT atypical cadherin 4
Synonyms: 6030410K14Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 3
NCBI: 329628
Homologene: 14377
Name: hemolytic complement
Synonyms: C5a, C5, He, Hfib2
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 2
NCBI: 15139
Homologene: 20412
Name: zonadhesin
Synonyms: Zan
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 5
NCBI: 22635
Homologene: 124417
Name: IKAROS family zinc finger 3
Synonyms: Aiolos, 5830411O07Rik, Zfpn1a3
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 11
NCBI: 22780
Homologene: 8269
Name: ankyrin repeat domain 7
Synonyms: 4930532L20Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 6
NCBI: 75196
Homologene: 35506
Name: ATPase, Ca++ transporting, type 2C, member 2
Synonyms: 1810010G06Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 8
NCBI: 69047
Homologene: 73463
Name: vomeronasal 2, receptor 70
Synonyms: EG620835
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 7
NCBI: 670940
Homologene: 115466
Name: vomeronasal 2, receptor 25
Synonyms: EG545874
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 6
NCBI: 545874
Homologene: 135915
Name: ciliary associated calcium binding coiled-coil 1
Synonyms: 1700040L02Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 10
NCBI: 73287
Homologene: 12495
Name: DIS3 like exosome 3'-5' exoribonuclease
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 9
NCBI: 213550
Homologene: 15797
Name: transmembrane and coiled-coil domains 6
Synonyms: 2410015B03Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 18
NCBI: 71983
VEGA: 18
Homologene: 12431
Name: folate hydrolase 1
Synonyms: mopsm, prostate-specific membrane antigen, glutamate carboxypeptidase II, GCP2
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 7
NCBI: 53320
Homologene: 55826
Name: ATP-binding cassette, sub-family A (ABC1), member 5
Synonyms: ABC13, B930033A02Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 11
NCBI: 217265
Homologene: 10263
Name: sterile alpha motif domain containing 9-like
Synonyms: ESTM25
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 6
NCBI: 209086
Homologene: 7707
Name: vomeronasal 1 receptor 45
Synonyms: V1r2, V1ra2
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 6
NCBI: 22297
Homologene: 130651
Name: excision repair cross-complementing rodent repair deficiency, complementation group 6 like 2
Synonyms: 1700019D06Rik, 9330134C04Rik, 0610007P08Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 13
NCBI: 76251
Homologene: 32564
Name: ArfGAP with SH3 domain, ankyrin repeat and PH domain 2
Synonyms: LOC385250, Ddef2, 6530401G17Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 12
NCBI: 211914
Homologene: 2888
Name: synaptojanin 1
Synonyms: A930006D20Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 16
NCBI: 104015
Homologene: 48252
Name: RAD51 associated protein 2
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 12
NCBI: 209550
VEGA: 12
Homologene: 85245
Name: GRB2 associated regulator of MAPK1 subtype 2
Synonyms: LOC242915, Fam59b, Gareml
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 5
NCBI: 242915
Homologene: 19063
Name: PHD finger protein 2
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 13
NCBI: 18676
VEGA: 13
Homologene: 3934
Name: vomeronasal 1 receptor 230
Synonyms: V1re8
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 17
NCBI: 171231
Homologene: 136306
Name: cytochrome P450, family 2, subfamily c, polypeptide 55
Synonyms: 2010318C06Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 19
NCBI: 72082
Homologene: 133567
Name: docking protein 5
Synonyms: 2700055C10Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 2
NCBI: 76829
Homologene: 10195
Name: RIKEN cDNA 1700030K09 gene
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 8
NCBI: 72254
Homologene: 12975
Name: matrix metallopeptidase 25
Synonyms: Leukolysin, MT6-MMP, F730048C11Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 17
NCBI: 240047
VEGA: 17
Homologene: 23375
Name: vomeronasal 2, receptor 97
Synonyms: EG627367
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 17
NCBI: 627367
Homologene: 115024
Name: predicted gene 960
Synonyms: Top6bl
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 19
NCBI: 381196
VEGA: 19
Homologene: 69381
Name: carboxypeptidase A6
Synonyms: 9030616D13Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 1
NCBI: 329093
Homologene: 75130
Name: vesicle amine transport protein 1 like
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 8
NCBI: 270097
Homologene: 10855
Name: protease, serine 33
Synonyms: tryptase-6, mT6, Eos
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 17
NCBI: 353130
Homologene: 77185
Name: calcium activated nucleotidase 1
Synonyms: 5830420C20Rik, Apy1h, Shapy, D11Bwg0554e, SCAN-1
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 11
NCBI: 76025
Homologene: 69460
Name: inositol 1,4,5-triphosphate receptor interacting protein-like 2
Synonyms: E030018N11Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 7
NCBI: 319622
Homologene: 45882
Name: asparaginase
Synonyms: A530050D06Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 12
NCBI: 104816
VEGA: 12
Homologene: 113390
Name: solute carrier family 22 (organic cation transporter), member 13
Synonyms: ORCTL3, OCTL3, OCTL1
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 9
NCBI: 102570
Homologene: 3140
Name: cAMP responsive element binding protein 3-like 4
Synonyms: 5330432F22Rik, ATCE1, 1700012K17Rik, mJAL, JAL, Tisp40beta, Tisp40alpha, Tisp40
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 3
NCBI: 78284
Homologene: 12693
Name: acyl-Coenzyme A oxidase 3, pristanoyl
Synonyms: pristanoyl-CoA oxidase, PCOX, EST-s59
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 5
NCBI: 80911
Homologene: 37792
Name: proteasome (prosome, macropain) 26S subunit, ATPase 2
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 5
NCBI: 19181
Homologene: 2096
Name: predicted gene 8841
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 18
Name: olfactory receptor 913
Synonyms: GA_x6K02T2PVTD-32296575-32297513, MOR165-10, MOR165-9P
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 9
NCBI: 258225
Homologene: 79398
Name: serine protease inhibitor, Kazal type-like
Synonyms: 9530002K18Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 18
NCBI: 77424
VEGA: 18
Homologene: 128818
Genetic Alterations
ENU-induced transitions at the following base pair locations (GRCm38):
  • A to T, chromosome 1 at 10,337,322 bp
  • C to T, chromosome 2 at 9,951,566 bp
  • T to C, chromosome 2 at 23,162,508 bp
  • A to T, chromosome 2 at 26,413,745 bp
  • T to A, chromosome 2 at 32,802,856 bp
  • A to C, chromosome 2 at 34,991,103 bp
  • T to C, chromosome 2 at 37,475,441 bp
  • A to C, chromosome 2 at 114,137,004 bp
  • T to C, chromosome 2 at 142,690,580 bp
  • G to A, chromosome 2 at 170,800,896 bp
  • A to G, chromosome 3 at 5,401,741 bp
  • A to T, chromosome 3 at 38,887,539 bp
  • A to G, chromosome 3 at 82,111,151 bp
  • G to T, chromosome 3 at 90,238,485 bp
  • T to C, chromosome 3 at 135,601,479 bp
  • T to C, chromosome 4 at 46,129,235 bp
  • A to G, chromosome 4 at 155,429,296 bp
  • C to A, chromosome 5 at 21,002,468 bp
  • C to G, chromosome 5 at 21,803,129 bp
  • T to C, chromosome 5 at 30,108,299 bp
  • A to T, chromosome 5 at 35,605,224 bp
  • A to T, chromosome 5 at 65,650,498 bp
  • A to G, chromosome 5 at 108,080,931 bp
  • A to T, chromosome 5 at 124,378,511 bp
  • G to A, chromosome 5 at 137,414,249 bp
  • A to T, chromosome 5 at 145,092,559 bp
  • C to T, chromosome 6 at 3,372,945 bp
  • T to A, chromosome 6 at 18,870,031 bp
  • T to A, chromosome 6 at 89,933,983 bp
  • T to C, chromosome 6 at 90,562,726 bp
  • G to T, chromosome 6 at 114,307,770 bp
  • T to A, chromosome 6 at 123,839,846 bp
  • G to C, chromosome 6 at 130,333,144 bp
  • A to C, chromosome 7 at 44,652,429 bp
  • A to G, chromosome 7 at 85,563,715 bp
  • G to A, chromosome 7 at 86,719,851 bp
  • A to T, chromosome 7 at 118,158,076 bp
  • A to G, chromosome 7 at 118,489,884 bp
  • A to C, chromosome 7 at 128,085,577 bp
  • A to G, chromosome 8 at 22,910,270 bp
  • A to G, chromosome 8 at 72,455,115 bp
  • A to G, chromosome 8 at 91,026,664 bp
  • T to C, chromosome 8 at 109,560,674 bp
  • T to A, chromosome 8 at 110,889,072 bp
  • T to C, chromosome 8 at 114,205,951 bp
  • A to G, chromosome 8 at 119,756,102 bp
  • C to A, chromosome 9 at 36,723,983 bp
  • G to T, chromosome 9 at 38,594,411 bp
  • T to C, chromosome 9 at 45,945,340 bp
  • C to T, chromosome 9 at 56,207,212 bp
  • T to A, chromosome 9 at 64,307,263 bp
  • T to C, chromosome 9 at 67,302,560 bp
  • T to A, chromosome 9 at 88,957,481 bp
  • T to A, chromosome 9 at 106,285,574 bp
  • T to C, chromosome 9 at 119,208,687 bp
  • A to G, chromosome 10 at 68,431,262 bp
  • T to A, chromosome 11 at 98,485,649 bp
  • A to G, chromosome 11 at 110,292,174 bp
  • A to G, chromosome 11 at 118,411,437 bp
  • A to G, chromosome 12 at 11,457,985 bp
  • A to T, chromosome 12 at 21,112,083 bp
  • T to A, chromosome 12 at 40,820,662 bp
  • ACCTGCTCTGCC to ACCTGCTCTGCCTGCTCTGCC, chromosome 12 at 40,844,548 bp
  • A to G, chromosome 12 at 112,120,974 bp
  • T to C, chromosome 13 at 43,303,470 bp
  • T to C, chromosome 13 at 48,820,073 bp
  • T to A, chromosome 13 at 60,729,503 bp
  • T to C, chromosome 13 at 63,866,007 bp
  • A to T, chromosome 14 at 21,668,667 bp
  • A to G, chromosome 14 at 26,418,247 bp
  • T to C, chromosome 14 at 33,934,389 bp
  • G to A, chromosome 14 at 67,676,976 bp
  • C to A, chromosome 15 at 10,486,635 bp
  • A to T, chromosome 16 at 90,961,536 bp
  • A to T, chromosome 17 at 18,947,322 bp
  • T to A, chromosome 17 at 20,846,801 bp
  • T to A, chromosome 17 at 23,631,074 bp
  • C to T, chromosome 17 at 23,834,843 bp
  • A to G, chromosome 17 at 24,377,719 bp
  • G to T, chromosome 17 at 78,831,444 bp
  • T to C, chromosome 18 at 36,741,687 bp
  • A to T, chromosome 18 at 44,169,127 bp
  • C to T, chromosome 18 at 61,259,849 bp
  • T to A, chromosome 18 at 65,210,330 bp
  • T to C, chromosome 18 at 84,209,649 bp
  • T to C, chromosome 19 at 4,627,158 bp
  • T to A, chromosome 19 at 39,034,375 bp
  • T to A, chromosome X at 151,382,004 bp
Genotype Determination
G1 male heterozygous mice are viable and fertile. The G1 mice were not characterized prior to archiving.
Strain Development
C57BL/6J mice were injected with ENU, resulting in G0 mice that were bred back to C57BL/6J. Sperm was archived from G1 male mice that produced viable G2 mice.
Suggested Control Mice
Wild-type littermates or C57BL/6J mice
Bruce Beutler, M.D., University of Texas Southwestern Medical Center.
Primary Reference
MUTAGENETIX record for R2154 (G1). B. Beutler and colleagues, Center for the Genetics of Host Defense, UT Southwestern, Dallas, TX.

Colony and Husbandry Information

Colony Surveillance Program and Current Health Reports

Mice recovered from a cryo-archive will have health surveillance performed on recipient females. Health reports will be provided prior to shipment. If you require additional health status information, please email .
Coat Color
MMRRC Breeding System
Random intra-strain mating
Breeding Scheme(s)
When maintaining a live colony, heterozygous mice may be bred together, bred with wild-type siblings, or bred with C57BL/6J inbred mice.
Overall Breeding Performance
Undetermined; during development, mating was done with heterozygous males; viability, fertility and other breeding statistics for heterozygous females and homozygotes are unverified, but presumably would be similar to the C57BL/6J background strain
Average litter size
Recommended wean age
3 weeks

Order Request Information

Limited quantities of breeder mice (recovered litter) are available from a cryoarchive; recovered litter usually available to ship in 3 to 4 months.

Cryopreserved material may be available upon request, please inquire to for more information.

Distribution of this strain requires submission of the MMRRC Conditions of Use (COU). A link to the COU web form will be provided via email after an order has been placed; the form should be completed then or the email forwarded to your institutional official for completion.

The donor or their institution limits the distribution to non-profit institutions only.

Additional charges may apply for any special requests. Shipping costs are in addition to the basic distribution/resuscitation fees. Information on shipping costs and any additional charges will be provided by the supplying MMRRC facility.

Click button to Request this one strain. (Use the MMRRC Catalog Search to request more than one strain.)
MMRRC Item # Description Distribution Fee / Unit (US $)
*Shipping & Handling not included*
Units Notes
040157-MU-RESUS Litter recovered from cryo-archive $5,475.00 / Non-Profit Litter Recovered litter4; additional fees for any special requests.
Cryopreserved material may be available upon request, please inquire to for more information.

Some MMRRC strains were submitted by the donor as cryopreserved germplasm, and because these strains were not cryopreserved by the MMRRC, we have not assessed the quality of this material. We have extensive experience with recovery of mice from cryopreserved sperm and embryos of varying quality, including using techniques such as IVF and ICSI, and are confident that we will have success in most, if not all, cases. However, because of the unknown quality of these frozen samples, we will restrict recovery efforts to two attempts for each order. Subsequent attempts can be performed on a fee-for-service basis, in addition to the standard fees, upon request.

1 The distribution fee covers the expense of rederiving mice from a live mouse; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

2 An aliquot contains a sufficient number of embryos (in one or more vials or straws and based on the transfer success rate of the MMRRC facility) to transfer into one to three recipients. The MMRRC makes no guarantee concerning embryo transfer success experienced in the recipient investigator's laboratory. Neither gender nor genotype ratios are guaranteed.

3 An aliquot is one straw or vial with sufficient sperm to recover at least one litter of mice, as per provided protocols, when performed at the MMRRC facility. The MMRRC makes no guarantee concerning the success of these procedures when performed outside the MMRRC facilities.

4 The distribution fee covers the expense of resuscitating mice from the cryo-archive; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

To request material from the MMRRC: Please fill out our on-line request form (accessible from the catalog search results page, or click the Request this Strain button in the fees section). If you have questions or need assistance completing this form, you may call Customer Service at (800) 910-2291 (in USA or Canada) or (530) 757-5710 (international calls). Before you call, please have with you: the MMRRC item number, quantity needed, Bill-to and Ship-to contact information.