Loading Mouse GIF
Loading...

Strain Name:
C57BL/6J-MtgxR2164Btlr/Mmmh
Stock Number:
040167-MU
Citation ID:
RRID:MMRRC_040167-MU
Other Names:
R2164 (G1), C57BL/6J-MtgxR2164Btlr
Major Collection:

Strain Information

Nrp2
Name: neuropilin 2
Synonyms: NP2, Npn-2, Npn2, NP-2, 1110048P06Rik
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 18187
HGNC: HGNC:8005
Homologene: 2875
Espl1
Name: extra spindle pole bodies 1, separase
Synonyms: separase, SSE, ESP1, PRCE, PRCE, Cerp
Type: Gene
Species: Mouse
Chromosome: 15
NCBI: 105988
VEGA: 15
Homologene: 32151
Erbb4
Name: erb-b2 receptor tyrosine kinase 4
Synonyms: ErbB4, Her4
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 13869
HGNC: HGNC:3432
Homologene: 21084
Frem2
Name: Fras1 related extracellular matrix protein 2
Synonyms: 8430406N05Rik, 6030440P17Rik, my, ne, b2b1562Clo
Type: Gene
Species: Mouse
Chromosome: 3
NCBI: 242022
Homologene: 18454
Ptprk
Name: protein tyrosine phosphatase receptor type K
Synonyms: PTPk, RPTPkappa
Type: Gene
Species: Mouse
Chromosome: 10
NCBI: 19272
VEGA: 10
HGNC: HGNC:9674
Homologene: 55693
Xrn1
Name: 5'-3' exoribonuclease 1
Synonyms: mXrn1, Dhm2
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 24127
Homologene: 5894
Genetic Alterations
ENU-induced transitions at the following base pair locations (GRCm38):
  • A to T, chromosome 1 at 62,744,355 bp
  • A to G, chromosome 1 at 68,346,693 bp
  • A to G, chromosome 1 at 170,794,735 bp
  • C to T, chromosome 1 at 171,220,134 bp
  • T to A, chromosome 2 at 6,100,695 bp
  • T to C, chromosome 2 at 27,273,706 bp
  • T to A, chromosome 2 at 30,892,696 bp
  • A to G, chromosome 2 at 113,365,617 bp
  • A to G, chromosome 2 at 120,036,748 bp
  • A to G, chromosome 2 at 135,346,330 bp
  • T to C, chromosome 3 at 53,537,330 bp
  • T to A, chromosome 3 at 88,985,419 bp
  • C to A, chromosome 3 at 108,085,369 bp
  • G to T, chromosome 4 at 41,723,065 bp
  • A to T, chromosome 4 at 63,225,424 bp
  • G to A, chromosome 4 at 108,503,029 bp
  • G to T, chromosome 4 at 122,843,432 bp
  • T to A, chromosome 4 at 130,728,083 bp
  • G to T, chromosome 4 at 130,728,084 bp
  • T to C, chromosome 4 at 141,464,246 bp
  • T to G, chromosome 4 at 154,898,149 bp
  • A to T, chromosome 5 at 149,754,156 bp
  • A to T, chromosome 6 at 86,676,214 bp
  • T to G, chromosome 6 at 118,525,791 bp
  • T to C, chromosome 6 at 122,322,337 bp
  • A to T, chromosome 6 at 123,839,559 bp
  • A to G, chromosome 7 at 19,157,695 bp
  • A to C, chromosome 7 at 19,613,761 bp
  • A to G, chromosome 7 at 29,139,045 bp
  • A to G, chromosome 7 at 43,223,677 bp
  • T to A, chromosome 7 at 79,395,995 bp
  • T to C, chromosome 7 at 81,041,438 bp
  • C to T, chromosome 7 at 105,595,066 bp
  • A to G, chromosome 7 at 120,120,239 bp
  • T to A, chromosome 7 at 122,999,474 bp
  • A to G, chromosome 7 at 125,459,867 bp
  • C to T, chromosome 7 at 132,270,385 bp
  • C to T, chromosome 7 at 142,492,200 bp
  • T to A, chromosome 8 at 27,114,204 bp
  • G to A, chromosome 8 at 31,112,164 bp
  • T to A, chromosome 9 at 7,124,797 bp
  • A to AT, chromosome 9 at 8,610,465 bp
  • A to G, chromosome 9 at 96,006,820 bp
  • A to T, chromosome 9 at 104,060,243 bp
  • A to T, chromosome 10 at 28,560,142 bp
  • G to A, chromosome 10 at 100,518,795 bp
  • A to G, chromosome 10 at 127,760,172 bp
  • A to G, chromosome 11 at 58,971,411 bp
  • C to T, chromosome 11 at 69,035,615 bp
  • C to T, chromosome 11 at 72,458,671 bp
  • A to G, chromosome 11 at 102,997,357 bp
  • CTGTAGGAAATCTTCAATGT to CTGT, chromosome 11 at 110,210,193 bp
  • A to G, chromosome 12 at 13,330,646 bp
  • G to A, chromosome 12 at 64,473,793 bp
  • A to G, chromosome 12 at 98,887,097 bp
  • A to G, chromosome 12 at 101,985,335 bp
  • T to C, chromosome 12 at 103,316,526 bp
  • A to G, chromosome 12 at 116,450,475 bp
  • C to T, chromosome 13 at 99,429,338 bp
  • A to G, chromosome 14 at 55,592,537 bp
  • A to C, chromosome 15 at 27,847,484 bp
  • CCTTTGCGCTT to CCTT, chromosome 15 at 47,741,236 bp
  • C to T, chromosome 15 at 64,920,934 bp
  • A to G, chromosome 15 at 77,735,439 bp
  • C to T, chromosome 15 at 102,319,588 bp
  • T to A, chromosome 16 at 15,705,207 bp
  • G to A, chromosome 17 at 3,197,210 bp
  • T to C, chromosome 17 at 20,375,642 bp
  • T to A, chromosome 17 at 28,166,134 bp
  • T to C, chromosome 17 at 74,407,195 bp
  • T to C, chromosome 17 at 84,636,274 bp
  • A to T, chromosome 18 at 20,981,287 bp
  • A to T, chromosome 18 at 36,024,293 bp
  • A to T, chromosome 18 at 37,302,186 bp
  • A to T, chromosome 18 at 67,820,360 bp
Genotype Determination
Phenotype
G1 male heterozygous mice are viable and fertile. The G1 mice were not characterized prior to archiving.
Strain GQC Summary
The MMRRC Centers have developed a Strain GQC pipeline using MiniMUGA array genotyping to provide additional information on strain backgrounds for MMRRC strains. For more information on whether data may be available, or to request genotyping for a strain of interest, please contact MMRRC_GeneticQC@med.unc.edu. Older strains may not have this information available.
Suggested Control Mice
Littermates of all relevant genotypes.
Donor
Bruce Beutler, M.D., University of Texas Southwestern Medical Center.
Primary Reference
MUTAGENETIX record for R2164 (G1). B. Beutler and colleagues, Center for the Genetics of Host Defense, UT Southwestern, Dallas, TX.
Strain Development
C57BL/6J mice were injected with ENU, resulting in G0 mice that were bred back to C57BL/6J. Sperm was archived from G1 male mice that produced viable G2 mice.


Disclaimer: If MMRRC Strain Genetic Quality Control (GQC; based on MiniMUGA genotyping and analysis) has been completed for this strain, the information might differ from the genetic background information provided by the submitter. MiniMUGA genetic analysis is done on a strain’s tissue samples taken when archived by or ordered from the assigned MMRRC Center.

Colony and Husbandry Information

Colony Surveillance Program and Current Health Reports

Mice recovered from a cryo-archive will have health surveillance performed on recipient females. Health reports will be provided prior to shipment. If you require additional health status information, please email mmrrc@missouri.edu.
Coat Color
Black
MMRRC Breeding System
Random intra-strain mating
Breeding Scheme(s)
When maintaining a live colony, heterozygous mice may be bred together, bred with wild-type siblings, or bred with C57BL/6J inbred mice.
Overall Breeding Performance
Undetermined; during development, mating was done with heterozygous males; viability, fertility and other breeding statistics for heterozygous females and homozygotes are unverified, but presumably would be similar to the C57BL/6J background strain
Average litter size
Undetermined
Recommended wean age
3 weeks

Order Request Information

Limited quantities of breeder mice (recovered litter) are available from a cryoarchive; recovered litter usually available to ship in 3 to 4 months.

Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

Distribution of this strain requires submission of the MMRRC Conditions of Use (COU). A link to the COU web form will be provided via email after an order has been placed; the form should be completed then or the email forwarded to your institutional official for completion.

The donor or their institution limits the distribution to non-profit institutions only.

Additional charges may apply for any special requests. Shipping costs are in addition to the basic distribution/resuscitation fees. Information on shipping costs and any additional charges will be provided by the supplying MMRRC facility.

Click button to Request this one strain. (Use the MMRRC Catalog Search to request more than one strain.)
MMRRC Item # Description Distribution Fee / Unit (US $)
*Shipping & Handling not included*
Units Notes
040167-MU-RESUS Litter recovered from cryo-archive $5,475.00 / Non-Profit Litter Recovered litter4; additional fees for any special requests.
Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

Some MMRRC strains were submitted by the donor as cryopreserved germplasm, and because these strains were not cryopreserved by the MMRRC, we have not assessed the quality, nor genotype, of this material. Our expertise in reviving mice from various qualities of frozen sperm and embryos, using methods like IVF and ICSI, gives us confidence in successful recoveries in most cases. However, due to the uncertain quality of these samples, we'll limit revival attempts to two per order. Additional attempts are available for a fee, on top of standard charges, if requested. It's important to note that some strains may lack the expected mutation, so we can't assure successful order fulfillment until we attempt to revive the strain.

1 The distribution fee covers the expense of rederiving mice from a live mouse; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

2 An aliquot contains a sufficient number of embryos (in one or more vials or straws and based on the transfer success rate of the MMRRC facility) to transfer into one to three recipients. The MMRRC makes no guarantee concerning embryo transfer success experienced in the recipient investigator's laboratory. Neither gender nor genotype ratios are guaranteed.

3 An aliquot is one straw or vial with sufficient sperm to recover at least one litter of mice, as per provided protocols, when performed at the MMRRC facility. The MMRRC makes no guarantee concerning the success of these procedures when performed outside the MMRRC facilities.

4 The distribution fee covers the expense of resuscitating mice from the cryo-archive; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

To request material from the MMRRC: Please fill out our on-line request form (accessible from the catalog search results page, or click the Request this Strain button in the fees section). If you have questions or need assistance completing this form, you may call Customer Service at (800) 910-2291 (in USA or Canada) or (530) 757-5710 (international calls). Before you call, please have with you: the MMRRC item number, quantity needed, Bill-to and Ship-to contact information.