Strain Name:
C57BL/6J-MtgxR2164Btlr/Mmmh
Stock Number:
040167-MU
Citation ID:
RRID:MMRRC_040167-MU
Other Names:
R2164 (G1), C57BL/6J-MtgxR2164Btlr
Major Collection:

Strain Information

Nrp2
Name: neuropilin 2
Synonyms: NP2, Npn-2, Npn2, NP-2, 1110048P06Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 1
NCBI: 18187
HGNC: HGNC:8005
Homologene: 2875
Espl1
Name: extra spindle pole bodies 1, separase
Synonyms: separase, SSE, ESP1, PRCE, PRCE, Cerp
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 15
NCBI: 105988
VEGA: 15
Homologene: 32151
Erbb4
Name: erb-b2 receptor tyrosine kinase 4
Synonyms: ErbB4, Her4
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 1
NCBI: 13869
HGNC: HGNC:3432
Homologene: 21084
Frem2
Name: Fras1 related extracellular matrix protein 2
Synonyms: 8430406N05Rik, 6030440P17Rik, my, ne, b2b1562Clo
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 3
NCBI: 242022
Homologene: 18454
Ptprk
Name: protein tyrosine phosphatase receptor type K
Synonyms: PTPk, RPTPkappa
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 10
NCBI: 19272
VEGA: 10
HGNC: HGNC:9674
Homologene: 55693
Pum1
Name: pumilio RNA-binding family member 1
Synonyms: Pumm
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 4
NCBI: 80912
Homologene: 22830
Xrn1
Name: 5'-3' exoribonuclease 1
Synonyms: mXrn1, Dhm2
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 9
NCBI: 24127
Homologene: 5894
Map1b
Name: microtubule-associated protein 1B
Synonyms: MAP5, Mtap-5, Mtap5, LC1, Mtap1b
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 13
NCBI: 17755
VEGA: 13
HGNC: HGNC:6836
Homologene: 38111
Prkdc
Name: protein kinase, DNA activated, catalytic polypeptide
Synonyms: DNA-PKcs, slip, DNAPDcs, XRCC7, DNA-PK, DOXNPH, dxnph
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 16
NCBI: 19090
HGNC: HGNC:9413
Homologene: 5037
Atf6
Name: activating transcription factor 6
Synonyms: ESTM49, 9130025P16Rik, Atf6alpha
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 1
NCBI: 226641
HGNC: HGNC:791
Homologene: 32015
Cep290
Name: centrosomal protein 290
Synonyms: Nphp6, b2b1454Clo, b2b1752Clo, Kiaa
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 10
NCBI: 216274
VEGA: 10
Homologene: 77213
Ctc1
Name: CTS telomere maintenance complex component 1
Synonyms: 1500010J02Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 11
NCBI: 68964
Homologene: 11830
Ncapg2
Name: non-SMC condensin II complex, subunit G2
Synonyms: 5830426I05Rik, Mtb, Luzp5, mCAP-G2
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 12
NCBI: 76044
VEGA: 12
Homologene: 9820
Tut4
Name: terminal uridylyl transferase 4
Synonyms: 6030404K05Rik, 9230115F04Rik, Tent3a, Zcchc11
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 4
NCBI: 230594
Homologene: 35279
Phc1
Name: polyhomeotic 1
Synonyms: Rae-28, Mph1, rae28, Edr1
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 6
NCBI: 13619
HGNC: HGNC:3182
Homologene: 107079
Slc30a6
Name: solute carrier family 30 (zinc transporter), member 6
Synonyms: ZnT6, ZnT-6
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 17
NCBI: 210148
VEGA: 17
Homologene: 32380
Scaf8
Name: SR-related CTD-associated factor 8
Synonyms: A930036P18Rik, A630086M08Rik, Rbm16
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 17
NCBI: 106583
VEGA: 17
Homologene: 8928
Zbtb17
Name: zinc finger and BTB domain containing 17
Synonyms: mZ13, Miz1, Zfp100
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 4
NCBI: 22642
Homologene: 2575
Rbbp6
Name: retinoblastoma binding protein 6, ubiquitin ligase
Synonyms: 4933422O15Rik, C030034J04Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 7
NCBI: 19647
HGNC: HGNC:9889
Homologene: 136812
Fanci
Name: Fanconi anemia, complementation group I
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 7
NCBI: 208836
Homologene: 49530
Rnf125
Name: ring finger protein 125
Synonyms: 4930553F04Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 18
NCBI: 67664
VEGA: 18
Ash1l
Name: ASH1 like histone lysine methyltransferase
Synonyms: chromatin remodeling factor, 8030453L17Rik, E430018P19Rik, KMT2H
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 3
NCBI: 192195
Homologene: 10225
Trio
Name: triple functional domain (PTPRF interacting)
Synonyms: 6720464I07Rik, Solo
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 15
NCBI: 223435
VEGA: 15
Homologene: 20847
Kdm8
Name: lysine (K)-specific demethylase 8
Synonyms: 3110005O21Rik, Jmjd5
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 7
NCBI: 77035
Homologene: 49791
Cpsf2
Name: cleavage and polyadenylation specific factor 2
Synonyms: Cpsf, 2610024B04Rik, 100kDa
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 12
NCBI: 51786
VEGA: 12
HGNC: HGNC:2325
Homologene: 6460
Zfp592
Name: zinc finger protein 592
Synonyms: A730014M16Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 7
NCBI: 233410
Homologene: 8759
Chst15
Name: carbohydrate sulfotransferase 15
Synonyms: GalNAcS-6ST, 4631426J05Rik, MAd5, MAd5
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 7
NCBI: 77590
Homologene: 8908
Ampd2
Name: adenosine monophosphate deaminase 2
Synonyms: Ampd-2, 1200014F01Rik, m4521Dajl
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 3
NCBI: 109674
HGNC: HGNC:469
Homologene: 2979
Vav2
Name: vav 2 oncogene
Synonyms: 2810040F13Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 2
NCBI: 22325
Homologene: 2530
Dync2h1
Name: dynein cytoplasmic 2 heavy chain 1
Synonyms: DHC1b, DHC2, 4432416O06Rik, D330044F14Rik, D030010H02Rik, Dnchc2, b2b414Clo, m407Asp, m152Asp
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 9
NCBI: 110350
HGNC: HGNC:2962
Homologene: 14468
Ppt1
Name: palmitoyl-protein thioesterase 1
Synonyms: D4Ertd184e, CLN1, 9530043G02Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 4
NCBI: 19063
HGNC: HGNC:9325
Homologene: 7488
Snrnp27
Name: small nuclear ribonucleoprotein 27 (U4/U6.U5)
Synonyms: 2610209M04Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 6
NCBI: 66618
Homologene: 135794
Dcakd
Name: dephospho-CoA kinase domain containing
Synonyms: 3010024O21Rik, 6720485C15Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 11
NCBI: 68087
Homologene: 5652
Ankrd26
Name: ankyrin repeat domain 26
Synonyms: 5730521P14Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 6
NCBI: 232339
Homologene: 45968
Eml5
Name: echinoderm microtubule associated protein like 5
Synonyms: C130068M19Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 12
NCBI: 319670
VEGA: 12
Homologene: 26807
Cep192
Name: centrosomal protein 192
Synonyms: D430014P18Rik, 4631422C13Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 18
NCBI: 70799
VEGA: 18
Homologene: 73526
Nbas
Name: neuroblastoma amplified sequence
Synonyms: 4933425L03Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 12
NCBI: 71169
VEGA: 12
Homologene: 41073
Trpc6
Name: transient receptor potential cation channel, subfamily C, member 6
Synonyms: mtrp6, Trrp6
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 9
NCBI: 22068
VEGA: 9
Homologene: 37944
Trim17
Name: tripartite motif-containing 17
Synonyms: terf, Rnf16
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 11
NCBI: 56631
Homologene: 9387
Col27a1
Name: collagen, type XXVII, alpha 1
Synonyms: 5730512J02Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 4
NCBI: 373864
Homologene: 69400
Plcb1
Name: phospholipase C, beta 1
Synonyms: 3110043I21Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 2
NCBI: 18795
Homologene: 22876
Scube3
Name: signal peptide, CUB domain, EGF-like 3
Synonyms: D030038I21Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 17
NCBI: 268935
Homologene: 65059
Uba5
Name: ubiquitin-like modifier activating enzyme 5
Synonyms: 5730525G14Rik, Ube1dc1
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 9
NCBI: 66663
Homologene: 11738
Adcy8
Name: adenylate cyclase 8
Synonyms: AC8
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 15
NCBI: 11514
VEGA: 15
HGNC: HGNC:239
Homologene: 37443
Csmd3
Name: CUB and Sushi multiple domains 3
Synonyms: 4930500N14Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 15
NCBI: 239420
Homologene: 65982
Vmn2r25
Name: vomeronasal 2, receptor 25
Synonyms: EG545874
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 6
NCBI: 545874
Homologene: 135915
Fscb
Name: fibrous sheath CABYR binding protein
Synonyms: EG623046
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 12
NCBI: 623046
VEGA: 12
Homologene: 136275
Abca6
Name: ATP-binding cassette, sub-family A member 6
Synonyms: 6330565N06Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 11
NCBI: 76184
HGNC: HGNC:36
Homologene: 71264
Rdh1
Name: retinol dehydrogenase 1 (all trans)
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 10
NCBI: 107605
Homologene: 129514
EU599041
Name: expressed sequence EU599041
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 7
NCBI: 100170401
Rasgrp4
Name: RAS guanyl releasing protein 4
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 7
NCBI: 233046
Homologene: 15635
Rnf122
Name: ring finger protein 122
Synonyms: 1110063C11Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 8
NCBI: 68867
Homologene: 11717
Hpx
Name: hemopexin
Synonyms: hx, Hpxn
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 7
NCBI: 15458
HGNC: HGNC:5171
Homologene: 511
Pla2g4b
Name: phospholipase A2, group IVB (cytosolic)
Synonyms: A030011C02Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 2
NCBI: 211429
Homologene: 3730
Nrg2
Name: neuregulin 2
Synonyms: NTAK, Don1
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 18
NCBI: 100042150
HGNC: HGNC:7998
Homologene: 75024
B3glct
Name: beta-3-glucosyltransferase
Synonyms: LOC381694, B3galtl
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 5
NCBI: 381694
Homologene: 14978
Rnf31
Name: ring finger protein 31
Synonyms: Paul, HOIP
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 14
NCBI: 268749
Homologene: 33228
Vmn2r107
Name: vomeronasal 2, receptor 107
Synonyms: V2r6
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 17
NCBI: 22312
Homologene: 129750
Fmn1
Name: formin 1
Synonyms: Fmn, formin-1
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 2
NCBI: 14260
HGNC: HGNC:3768
Homologene: 121778
Ptges
Name: prostaglandin E synthase
Synonyms: 2410099E23Rik, D2Ertd369e, mPGES, mPGES-1
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 2
NCBI: 64292
HGNC: HGNC:9599
Homologene: 3587
Pcdhb3
Name: protocadherin beta 3
Synonyms: PcdhbC
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 18
NCBI: 93874
HGNC: HGNC:8688
Homologene: 115665
Dync2li1
Name: dynein cytoplasmic 2 light intermediate chain 1
Synonyms: mD2LIC, CGI-60, LIC3, 4933404O11Rik, D2lic
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 17
NCBI: 213575
VEGA: 17
Homologene: 9336
Proser2
Name: proline and serine rich 2
Synonyms: 5430407P10Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 2
NCBI: 227545
Homologene: 51648
Apol9a
Name: apolipoprotein L 9a
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 15
NCBI: 223672
VEGA: 15
Homologene: 77567
Ldaf1
Name: lipid droplet assembly factor 1
Synonyms: 8430420C20Rik, Tmem159
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 7
NCBI: 233806
Homologene: 10705
Adgra2
Name: adhesion G protein-coupled receptor A2
Synonyms: Tem5, 9530074E10Rik, 8430414O08Rik, Gpr124
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 8
NCBI: 78560
Homologene: 13112
Spns2
Name: SPNS lysolipid transporter 2, sphingosine-1-phosphate
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 11
NCBI: 216892
Homologene: 71040
Relb
Name: avian reticuloendotheliosis viral (v-rel) oncogene related B
Synonyms: shep
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 7
NCBI: 19698
HGNC: HGNC:9956
Homologene: 4747
Prxl2b
Name: peroxiredoxin like 2B
Synonyms: PM/PGFS, 2810405K02Rik, Fam213b
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 4
NCBI: 66469
Homologene: 11976
Gipr
Name: gastric inhibitory polypeptide receptor
Synonyms: LOC232937, LOC381853, glucose-dependent insulinotropic polypeptide receptor
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 7
NCBI: 381853
HGNC: HGNC:4271
Homologene: 20081
Tomm40l
Name: translocase of outer mitochondrial membrane 40-like
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 1
NCBI: 641376
Homologene: 134180
AC160131.1
Name:
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 12
Dctn3
Name: dynactin 3
Synonyms: p24
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 4
NCBI: 53598
HGNC: HGNC:2713
Homologene: 5233
Prr33
Name: proline rich 33
Synonyms: ENSMUSG00000043795, Gm14492
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 7
NCBI: 677289
Genetic Alterations
ENU-induced transitions at the following base pair locations (GRCm38):
  • A to T, chromosome 1 at 62,744,355 bp
  • A to G, chromosome 1 at 68,346,693 bp
  • A to G, chromosome 1 at 170,794,735 bp
  • C to T, chromosome 1 at 171,220,134 bp
  • T to A, chromosome 2 at 6,100,695 bp
  • T to C, chromosome 2 at 27,273,706 bp
  • T to A, chromosome 2 at 30,892,696 bp
  • A to G, chromosome 2 at 113,365,617 bp
  • A to G, chromosome 2 at 120,036,748 bp
  • A to G, chromosome 2 at 135,346,330 bp
  • T to C, chromosome 3 at 53,537,330 bp
  • T to A, chromosome 3 at 88,985,419 bp
  • C to A, chromosome 3 at 108,085,369 bp
  • G to T, chromosome 4 at 41,723,065 bp
  • A to T, chromosome 4 at 63,225,424 bp
  • G to A, chromosome 4 at 108,503,029 bp
  • G to T, chromosome 4 at 122,843,432 bp
  • T to A, chromosome 4 at 130,728,083 bp
  • G to T, chromosome 4 at 130,728,084 bp
  • T to C, chromosome 4 at 141,464,246 bp
  • T to G, chromosome 4 at 154,898,149 bp
  • A to T, chromosome 5 at 149,754,156 bp
  • A to T, chromosome 6 at 86,676,214 bp
  • T to G, chromosome 6 at 118,525,791 bp
  • T to C, chromosome 6 at 122,322,337 bp
  • A to T, chromosome 6 at 123,839,559 bp
  • A to G, chromosome 7 at 19,157,695 bp
  • A to C, chromosome 7 at 19,613,761 bp
  • A to G, chromosome 7 at 29,139,045 bp
  • A to G, chromosome 7 at 43,223,677 bp
  • T to A, chromosome 7 at 79,395,995 bp
  • T to C, chromosome 7 at 81,041,438 bp
  • C to T, chromosome 7 at 105,595,066 bp
  • A to G, chromosome 7 at 120,120,239 bp
  • T to A, chromosome 7 at 122,999,474 bp
  • A to G, chromosome 7 at 125,459,867 bp
  • C to T, chromosome 7 at 132,270,385 bp
  • C to T, chromosome 7 at 142,492,200 bp
  • T to A, chromosome 8 at 27,114,204 bp
  • G to A, chromosome 8 at 31,112,164 bp
  • T to A, chromosome 9 at 7,124,797 bp
  • A to AT, chromosome 9 at 8,610,465 bp
  • A to G, chromosome 9 at 96,006,820 bp
  • A to T, chromosome 9 at 104,060,243 bp
  • A to T, chromosome 10 at 28,560,142 bp
  • G to A, chromosome 10 at 100,518,795 bp
  • A to G, chromosome 10 at 127,760,172 bp
  • A to G, chromosome 11 at 58,971,411 bp
  • C to T, chromosome 11 at 69,035,615 bp
  • C to T, chromosome 11 at 72,458,671 bp
  • A to G, chromosome 11 at 102,997,357 bp
  • CTGTAGGAAATCTTCAATGT to CTGT, chromosome 11 at 110,210,193 bp
  • A to G, chromosome 12 at 13,330,646 bp
  • G to A, chromosome 12 at 64,473,793 bp
  • A to G, chromosome 12 at 98,887,097 bp
  • A to G, chromosome 12 at 101,985,335 bp
  • T to C, chromosome 12 at 103,316,526 bp
  • A to G, chromosome 12 at 116,450,475 bp
  • C to T, chromosome 13 at 99,429,338 bp
  • A to G, chromosome 14 at 55,592,537 bp
  • A to C, chromosome 15 at 27,847,484 bp
  • CCTTTGCGCTT to CCTT, chromosome 15 at 47,741,236 bp
  • C to T, chromosome 15 at 64,920,934 bp
  • A to G, chromosome 15 at 77,735,439 bp
  • C to T, chromosome 15 at 102,319,588 bp
  • T to A, chromosome 16 at 15,705,207 bp
  • G to A, chromosome 17 at 3,197,210 bp
  • T to C, chromosome 17 at 20,375,642 bp
  • T to A, chromosome 17 at 28,166,134 bp
  • T to C, chromosome 17 at 74,407,195 bp
  • T to C, chromosome 17 at 84,636,274 bp
  • A to T, chromosome 18 at 20,981,287 bp
  • A to T, chromosome 18 at 36,024,293 bp
  • A to T, chromosome 18 at 37,302,186 bp
  • A to T, chromosome 18 at 67,820,360 bp
Genotype Determination
Phenotype
G1 male heterozygous mice are viable and fertile. The G1 mice were not characterized prior to archiving.
Strain Development
C57BL/6J mice were injected with ENU, resulting in G0 mice that were bred back to C57BL/6J. Sperm was archived from G1 male mice that produced viable G2 mice.
Suggested Control Mice
Wild-type littermates or C57BL/6J mice
MMRRC Genetic QC Summary
The MMRRC Centers have developed a genetic QC pipeline using MiniMUGA array genotyping to provide additional information on strain backgrounds for MMRRC congenic and inbred strains. For more information on when data may be available, or to request genotyping for a strain of interest, please contact mmrrc@missouri.edu. Older strains may not have this information.
Donor
Bruce Beutler, M.D., University of Texas Southwestern Medical Center.
Primary Reference
MUTAGENETIX record for R2164 (G1). B. Beutler and colleagues, Center for the Genetics of Host Defense, UT Southwestern, Dallas, TX.

Colony and Husbandry Information

Colony Surveillance Program and Current Health Reports

Mice recovered from a cryo-archive will have health surveillance performed on recipient females. Health reports will be provided prior to shipment. If you require additional health status information, please email mmrrc@missouri.edu .
Coat Color
Black
MMRRC Breeding System
Random intra-strain mating
Breeding Scheme(s)
When maintaining a live colony, heterozygous mice may be bred together, bred with wild-type siblings, or bred with C57BL/6J inbred mice.
Overall Breeding Performance
Undetermined; during development, mating was done with heterozygous males; viability, fertility and other breeding statistics for heterozygous females and homozygotes are unverified, but presumably would be similar to the C57BL/6J background strain
Average litter size
Undetermined
Recommended wean age
3 weeks

Order Request Information

Limited quantities of breeder mice (recovered litter) are available from a cryoarchive; recovered litter usually available to ship in 3 to 4 months.

Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

Distribution of this strain requires submission of the MMRRC Conditions of Use (COU). A link to the COU web form will be provided via email after an order has been placed; the form should be completed then or the email forwarded to your institutional official for completion.

The donor or their institution limits the distribution to non-profit institutions only.

Additional charges may apply for any special requests. Shipping costs are in addition to the basic distribution/resuscitation fees. Information on shipping costs and any additional charges will be provided by the supplying MMRRC facility.

Click button to Request this one strain. (Use the MMRRC Catalog Search to request more than one strain.)
MMRRC Item # Description Distribution Fee / Unit (US $)
*Shipping & Handling not included*
Units Notes
040167-MU-RESUS Litter recovered from cryo-archive $5,475.00 / Non-Profit Litter Recovered litter4; additional fees for any special requests.
Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

Some MMRRC strains were submitted by the donor as cryopreserved germplasm, and because these strains were not cryopreserved by the MMRRC, we have not assessed the quality, nor genotype, of this material. Our expertise in reviving mice from various qualities of frozen sperm and embryos, using methods like IVF and ICSI, gives us confidence in successful recoveries in most cases. However, due to the uncertain quality of these samples, we'll limit revival attempts to two per order. Additional attempts are available for a fee, on top of standard charges, if requested. It's important to note that some strains may lack the expected mutation, so we can't assure successful order fulfillment until we attempt to revive the strain.

1 The distribution fee covers the expense of rederiving mice from a live mouse; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

2 An aliquot contains a sufficient number of embryos (in one or more vials or straws and based on the transfer success rate of the MMRRC facility) to transfer into one to three recipients. The MMRRC makes no guarantee concerning embryo transfer success experienced in the recipient investigator's laboratory. Neither gender nor genotype ratios are guaranteed.

3 An aliquot is one straw or vial with sufficient sperm to recover at least one litter of mice, as per provided protocols, when performed at the MMRRC facility. The MMRRC makes no guarantee concerning the success of these procedures when performed outside the MMRRC facilities.

4 The distribution fee covers the expense of resuscitating mice from the cryo-archive; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

To request material from the MMRRC: Please fill out our on-line request form (accessible from the catalog search results page, or click the Request this Strain button in the fees section). If you have questions or need assistance completing this form, you may call Customer Service at (800) 910-2291 (in USA or Canada) or (530) 757-5710 (international calls). Before you call, please have with you: the MMRRC item number, quantity needed, Bill-to and Ship-to contact information.