Loading Mouse GIF
Loading...

Strain Name:
C57BL/6J-MtgxR2180Btlr/Mmmh
Stock Number:
040182-MU
Citation ID:
RRID:MMRRC_040182-MU
Other Names:
R2180 (G1), C57BL/6J-MtgxR2180Btlr
Major Collection:

Strain Information

Rptor
Name: regulatory associated protein of MTOR, complex 1
Synonyms: raptor, 4932417H02Rik, Rap
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 74370
Homologene: 80210
Satb1
Name: special AT-rich sequence binding protein 1
Synonyms: 2610306G12Rik
Type: Gene
Species: Mouse
Chromosome: 17
NCBI: 20230
Homologene: 2232
Trib2
Name: tribbles pseudokinase 2
Synonyms: TRB2
Type: Gene
Species: Mouse
Chromosome: 12
NCBI: 217410
Homologene: 41445
Utp20
Name: UTP20 small subunit processome component
Synonyms: mDRIM, DRIM, 3830408P06Rik
Type: Gene
Species: Mouse
Chromosome: 10
NCBI: 70683
VEGA: 10
Homologene: 38373
Fancd2
Name: Fanconi anemia, complementation group D2
Synonyms: 2410150O07Rik
Type: Gene
Species: Mouse
Chromosome: 6
NCBI: 211651
HGNC: HGNC:3585
Homologene: 13212
Ppp6c
Name: protein phosphatase 6, catalytic subunit
Synonyms: 2310003C10Rik
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 67857
HGNC: HGNC:9323
Homologene: 68273
Genetic Alterations
ENU-induced transitions at the following base pair locations (GRCm38):
  • A to G, chromosome 1 at 46,353,059 bp
  • G to A, chromosome 1 at 54,272,547 bp
  • A to T, chromosome 1 at 58,213,067 bp
  • G to A, chromosome 1 at 87,416,920 bp
  • A to T, chromosome 1 at 151,718,078 bp
  • A to G, chromosome 1 at 174,369,401 bp
  • A to T, chromosome 1 at 181,918,459 bp
  • T to C, chromosome 2 at 39,197,513 bp
  • C to T, chromosome 2 at 102,828,610 bp
  • A to G, chromosome 2 at 111,945,003 bp
  • A to T, chromosome 2 at 181,233,732 bp
  • A to G, chromosome 3 at 62,604,068 bp
  • T to C, chromosome 3 at 95,306,424 bp
  • A to T, chromosome 3 at 151,500,142 bp
  • T to A, chromosome 4 at 41,507,170 bp
  • T to A, chromosome 4 at 95,696,951 bp
  • G to A, chromosome 4 at 98,523,502 bp
  • T to C, chromosome 4 at 115,788,360 bp
  • G to T, chromosome 4 at 141,409,508 bp
  • T to C, chromosome 5 at 31,072,735 bp
  • G to A, chromosome 5 at 92,245,379 bp
  • T to G, chromosome 5 at 103,569,558 bp
  • T to C, chromosome 5 at 121,535,864 bp
  • T to C, chromosome 5 at 130,839,408 bp
  • C to T, chromosome 6 at 42,927,525 bp
  • A to G, chromosome 6 at 77,244,346 bp
  • A to T, chromosome 6 at 113,574,637 bp
  • A to T, chromosome 6 at 118,085,860 bp
  • A to T, chromosome 6 at 135,240,145 bp
  • T to A, chromosome 7 at 4,601,868 bp
  • G to A, chromosome 7 at 29,012,241 bp
  • A to G, chromosome 7 at 80,212,835 bp
  • T to C, chromosome 7 at 101,999,990 bp
  • T to C, chromosome 7 at 105,056,885 bp
  • C to T, chromosome 8 at 11,547,857 bp
  • T to A, chromosome 8 at 72,753,295 bp
  • T to C, chromosome 8 at 91,090,055 bp
  • T to C, chromosome 8 at 111,629,386 bp
  • A to T, chromosome 9 at 20,499,679 bp
  • A to T, chromosome 9 at 42,542,005 bp
  • A to T, chromosome 9 at 44,388,019 bp
  • G to A, chromosome 9 at 75,447,214 bp
  • A to T, chromosome 9 at 101,127,015 bp
  • A to G, chromosome 9 at 119,516,051 bp
  • A to G, chromosome 10 at 88,820,939 bp
  • G to A, chromosome 10 at 120,105,448 bp
  • C to T, chromosome 11 at 4,108,964 bp
  • C to A, chromosome 11 at 51,254,610 bp
  • T to G, chromosome 11 at 60,783,742 bp
  • T to C, chromosome 11 at 68,992,187 bp
  • T to C, chromosome 11 at 74,393,146 bp
  • C to T, chromosome 11 at 110,148,729 bp
  • T to A, chromosome 11 at 119,491,967 bp
  • T to A, chromosome 11 at 119,725,144 bp
  • A to T, chromosome 12 at 15,810,003 bp
  • A to T, chromosome 12 at 102,785,897 bp
  • A to G, chromosome 13 at 21,981,975 bp
  • G to A, chromosome 13 at 67,671,194 bp
  • ATTCTTCTTCTTCTTCTTC to ATTCTTCTTCTTCTTCTTCTTC, chromosome 13 at 100,061,405 bp
  • T to C, chromosome 13 at 112,962,872 bp
  • T to C, chromosome 13 at 114,849,381 bp
  • T to A, chromosome 14 at 51,715,994 bp
  • A to T, chromosome 15 at 98,543,600 bp
  • G to T, chromosome 15 at 99,671,965 bp
  • T to C, chromosome 16 at 85,887,924 bp
  • A to G, chromosome 17 at 26,143,335 bp
  • T to C, chromosome 17 at 30,840,647 bp
  • G to A, chromosome 17 at 32,775,301 bp
  • C to T, chromosome 17 at 51,803,496 bp
  • T to C, chromosome 17 at 71,378,267 bp
  • C to A, chromosome 17 at 71,463,799 bp
  • T to C, chromosome 17 at 74,612,151 bp
  • A to G, chromosome 18 at 67,824,742 bp
  • T to C, chromosome 19 at 20,824,084 bp
Genotype Determination
Phenotype
G1 male heterozygous mice are viable and fertile. The G1 mice were not characterized prior to archiving.
Strain GQC Summary
Gene Specific Genotyping:

To request gene-specific and other genotyping services for a strain, please contact the distribution MMRRC Center for more information.

Background Genetic Quality:

The MMRRC has developed a Genetic Quality Control pipeline using the MiniMUGA array to provide additional information to identify and validate genetic backgrounds of MMRRC strains. For more information on whether genetic background data is available, please contact MMRRC_GeneticQC@med.unc.edu. Note: that MiniMUGA genetic background data is not available on all strains, but can be ordered if desired.

Suggested Control Mice
Littermates of all relevant genotypes.
Donor
Bruce Beutler, M.D., University of Texas Southwestern Medical Center.
Primary Reference
MUTAGENETIX record for R2180 (G1). B. Beutler and colleagues, Center for the Genetics of Host Defense, UT Southwestern, Dallas, TX.
Strain Development
C57BL/6J mice were injected with ENU, resulting in G0 mice that were bred back to C57BL/6J. Sperm was archived from G1 male mice that produced viable G2 mice.


Disclaimer: If MMRRC Strain Genetic Quality Control (GQC; based on MiniMUGA genotyping and analysis) has been completed for this strain, the information might differ from the genetic background information provided by the submitter. MiniMUGA genetic analysis is done on a strain’s tissue samples taken when archived by or ordered from the assigned MMRRC Center.

Colony and Husbandry Information

Colony Surveillance Program and Current Health Reports

Mice recovered from a cryo-archive will have health surveillance performed on recipient females. Health reports will be provided prior to shipment. If you require additional health status information, please email mmrrc@missouri.edu.
Coat Color
Black
MMRRC Breeding System
Random intra-strain mating
Breeding Scheme(s)
When maintaining a live colony, heterozygous mice may be bred together, bred with wild-type siblings, or bred with C57BL/6J inbred mice.
Overall Breeding Performance
Undetermined; during development, mating was done with heterozygous males; viability, fertility and other breeding statistics for heterozygous females and homozygotes are unverified, but presumably would be similar to the C57BL/6J background strain
Average litter size
Undetermined
Recommended wean age
3 weeks

Order Information

Limited quantities of breeder mice (recovered litter) are available from a cryoarchive; recovered litter usually available to ship in 3 to 4 months.

Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

Distribution of this strain requires submission of the MMRRC Conditions of Use (COU). A link to the COU web form will be provided via email after an order has been placed; the form should be completed then or the email forwarded to your institutional official for completion.

The donor or their institution limits the distribution to non-profit institutions only.

Additional charges may apply for any special requests. Shipping costs are in addition to the basic distribution/resuscitation fees. Information on shipping costs and any additional charges will be provided by the supplying MMRRC facility.

Click button to Request this one strain. (Use the MMRRC Catalog Search to request more than one strain.)
MMRRC Item # Description Distribution Fee / Unit (US $)
*Shipping & Handling not included*
Units Notes
040182-MU-RESUS Litter recovered from cryo-archive $5,475.00 / Non-Profit Litter Recovered litter4; additional fees for any special requests.
Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

Some MMRRC strains were submitted by the donor as cryopreserved germplasm, and because these strains were not cryopreserved by the MMRRC, we have not assessed the quality, nor genotype, of this material. Our expertise in reviving mice from various qualities of frozen sperm and embryos, using methods like IVF and ICSI, gives us confidence in successful recoveries in most cases. However, due to the uncertain quality of these samples, we'll limit revival attempts to two per order. Additional attempts are available for a fee, on top of standard charges, if requested. It's important to note that some strains may lack the expected mutation, so we can't assure successful order fulfillment until we attempt to revive the strain.

1 The distribution fee covers the expense of rederiving mice from a live mouse; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

2 An aliquot contains a sufficient number of embryos (in one or more vials or straws and based on the transfer success rate of the MMRRC facility) to transfer into one to three recipients. The MMRRC makes no guarantee concerning embryo transfer success experienced in the recipient investigator's laboratory. Neither gender nor genotype ratios are guaranteed.

3 An aliquot is one straw or vial with sufficient sperm to recover at least one litter of mice, as per provided protocols, when performed at the MMRRC facility. The MMRRC makes no guarantee concerning the success of these procedures when performed outside the MMRRC facilities.

4 The distribution fee covers the expense of resuscitating mice from the cryo-archive; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

To request material from the MMRRC: Please fill out our on-line request form (accessible from the catalog search results page, or click the Request this Strain button in the fees section). If you have questions or need assistance completing this form, you may call Customer Service at (800) 910-2291 (in USA or Canada) or (530) 757-5710 (international calls). Before you call, please have with you: the MMRRC item number, quantity needed, Bill-to and Ship-to contact information.