Strain Name:
Stock Number:
Citation ID:
Other Names:
R2208 (G1), C57BL/6J-MtgxR2208Btlr
Major Collection:

Gene Information

Name: cholinergic receptor, muscarinic 1, CNS
Synonyms: M1, muscarinic acetylcholine receptor 1, Chrm-1, M1R, AW495047
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 19
NCBI: 12669
Homologene: 20189
Name: protein tyrosine phosphatase, receptor type, F
Synonyms: LAR, RPTP-LAR
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 4
NCBI: 19268
Homologene: 20623
Name: musashi RNA-binding protein 2
Synonyms: msi2h, Musashi2
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 11
NCBI: 76626
Homologene: 62199
Name: guanine nucleotide binding protein (G protein), gamma 10
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 4
NCBI: 14700
Homologene: 20874
Name: CDC42 binding protein kinase beta
Synonyms: DMPK-like
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 12
NCBI: 217866
VEGA: 12
Homologene: 55945
Name: cell division cycle 73, Paf1/RNA polymerase II complex component
Synonyms: C130030P16Rik, 8430414L16Rik, Hrpt2
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 1
NCBI: 214498
Homologene: 11571
Name: telomerase associated protein 1
Synonyms: Tp1
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 14
NCBI: 21745
VEGA: 14
Homologene: 5157
Name: PR domain containing 15
Synonyms: Zfp298, E130018M06Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 16
NCBI: 114604
Homologene: 56941
Name: pleckstrin homology like domain, family B, member 1
Synonyms: LL5A, D330037A14Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 9
NCBI: 102693
Homologene: 15903
Name: fatty acid binding protein 3, muscle and heart
Synonyms: H-FABP, Fabph-4, Fabph-1, Fabph4, Fabph1, Mdgi, Fabp3
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 4
NCBI: 14077
Homologene: 68379
Name: nuclear factor I/X
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 8
NCBI: 18032
Homologene: 1872
Name: PILR alpha associated neural protein
Synonyms: C530028O21Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 6
NCBI: 319352
Homologene: 17799
Name: cytochrome P450, family 4, subfamily x, polypeptide 1
Synonyms: Cyp4a28-ps
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 4
NCBI: 81906
Homologene: 75853
Name: ectonucleotide pyrophosphatase/phosphodiesterase 7
Synonyms: Alk-SMase, LOC238011
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 11
NCBI: 238011
Homologene: 110852
Name: nucleoporin 88
Synonyms: Nup84, Prei2
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 11
NCBI: 19069
Homologene: 1901
Name: breast cancer 2, early onset
Synonyms: RAB163, Fancd1
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 5
NCBI: 12190
Homologene: 41
Name: meiotic nuclear divisions 1
Synonyms: 2610034E18Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 3
NCBI: 76915
Homologene: 5890
Name: centrosomal protein 170B
Synonyms: AW555464
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 12
NCBI: 217882
VEGA: 12
Homologene: 46165
Name: regulatory factor X, 7
Synonyms: 2510005N23Rik, 9930116O05Rik, D130086K05Rik, Rfxdc2
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 9
NCBI: 319758
Homologene: 11275
Name: TBC1 domain family, member 32
Synonyms: Bromi, C6orf170, D630037F22Rik, b2b2284Clo
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 10
NCBI: 544696
VEGA: 10
Homologene: 51889
Name: threonyl-tRNA synthetase-like 2
Synonyms: A530046H20Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 7
NCBI: 272396
Homologene: 65036
Name: transmembrane channel-like gene family 2
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 2
NCBI: 192140
Homologene: 25877
Name: C-type lectin domain family 4, member d
Synonyms: mMCL, Mpcl, Clecsf8, mcl
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 6
NCBI: 17474
Homologene: 7844
Name: mucin 19
Synonyms: apomucin, sld
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 15
Name: hemicentin 2
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 2
NCBI: 665700
Homologene: 90772
Name: RUN domain containing 3A
Synonyms: Rpip8, Rap2ip
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 11
NCBI: 51799
Homologene: 4871
Name: zinc finger, AN1-type domain 4
Synonyms: 2810002D23Rik, Anubl1
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 6
NCBI: 67492
Homologene: 18373
Name: ciliogenesis and planar polarity effector 1
Synonyms: b2b012Clo, Jbts17, Hug, 2410089E03Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 15
NCBI: 73692
Homologene: 11315
Name: vomeronasal 2, receptor 15
Synonyms: EG211223
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 5
NCBI: 211223
Homologene: 129606
Name: coiled-coil domain containing 39
Synonyms: 4921507O14Rik, D3Ertd789e, b2b1735Clo, b2b1304Clo, b2b2025.1Clo, prh
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 3
NCBI: 51938
Homologene: 12149
Name: AHNAK nucleoprotein (desmoyokin)
Synonyms: DY6, 2310047C17Rik, 1110004P15Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 19
NCBI: 66395
VEGA: 19
Homologene: 67425
Name: leiomodin 3 (fetal)
Synonyms: 5430424A14Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 6
NCBI: 320502
Homologene: 28097
Name: cytochrome P450, family 2, subfamily c, polypeptide 39
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 19
NCBI: 13098
Homologene: 117948
Name: tensin 1
Synonyms: 1200014E20Rik, E030018G17Rik, 1110018I21Rik, Tns, E030037J05Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 1
NCBI: 21961
Homologene: 11219
Name: WD repeat domain 90
Synonyms: 3230401M21Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 17
NCBI: 106618
Homologene: 27066
Name: syntrophin, basic 1
Synonyms: beta1-Syntrophin, 59-1 DAP
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 15
NCBI: 20649
Homologene: 9618
Name: predicted gene 14139
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 2
NCBI: 100271882
Homologene: 134546
Name: regulator of G-protein signalling 22
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 15
NCBI: 626596
Homologene: 75047
Name: potassium voltage-gated channel, subfamily H (eag-related), member 8
Synonyms: Kv12.1, ELK1, C130090D05Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 17
NCBI: 211468
Homologene: 14332
Name: olfactory receptor family 11 subfamily H member 4B
Synonyms: GA_x6K02T2PMLR-6420220-6419279, MOR106-7, MOR106-16, Olfr747
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 14
NCBI: 258264
Homologene: 10652
Name: keratin 36
Synonyms: HRa-1, Krt1-22, keratin 5, Krt1-5
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 11
NCBI: 16673
Homologene: 88459
Name: mannan-binding lectin serine peptidase 2
Synonyms: MAp19, MASP-2
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 4
NCBI: 17175
Homologene: 4819
Name: phosphodiesterase 3A, cGMP inhibited
Synonyms: A930022O17Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 6
NCBI: 54611
Homologene: 708
Name: coiled-coil domain containing 142
Synonyms: A230058J24Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 6
NCBI: 243510
Homologene: 27813
Name: cytochrome P450, family 2, subfamily d, polypeptide 12
Synonyms: 9030605E09Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 15
NCBI: 380997
VEGA: 15
Homologene: 86099
Name: low density lipoprotein receptor-related protein 8, apolipoprotein e receptor
Synonyms: apoER2, 4932703M08Rik, Lr8b
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 4
NCBI: 16975
Homologene: 31250
Name: dihydropyrimidinase-like 5
Synonyms: Crmp5, CRMP-5, CRAM
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 5
NCBI: 65254
Homologene: 41347
Name: beta-carotene oxygenase 2
Synonyms: beta-diox-II, B-diox-II, CMO2, Bcdo2, Bcmo2
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 9
NCBI: 170752
Homologene: 12912
Name: zinc finger and BTB domain containing 9
Synonyms: 3930402F13Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 17
NCBI: 474156
Homologene: 45145
Name: G protein-coupled receptor 33
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 12
NCBI: 14762
Homologene: 7345
Name: nucleic acid binding protein 1
Synonyms: 4930434H03Rik, 4930442A21Rik, 4930488J04Rik, 4933440J18Rik, 5830411E10Rik, Nbp1, Obfc2a, Ssb2
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 1
NCBI: 109019
Homologene: 57094
Name: tumor protein D52-like 3
Synonyms: 4931412G03Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 19
NCBI: 66745
VEGA: 19
Homologene: 12024
Name: RIKEN cDNA 2310001K24 gene
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 2
NCBI: 69517
Genetic Alterations
ENU-induced transitions at the following base pair locations (GRCm38):
  • G to A, chromosome 1 at 51,477,614 bp
  • A to C, chromosome 1 at 74,079,240 bp
  • T to A, chromosome 1 at 143,609,382 bp
  • G to A, chromosome 2 at 31,380,297 bp
  • C to A, chromosome 2 at 130,214,563 bp
  • T to A, chromosome 2 at 150,193,145 bp
  • T to A, chromosome 2 at 163,472,684 bp
  • A to G, chromosome 3 at 33,841,178 bp
  • C to A, chromosome 3 at 84,134,109 bp
  • T to A, chromosome 4 at 59,035,314 bp
  • T to C, chromosome 4 at 107,855,790 bp
  • G to T, chromosome 4 at 115,126,594 bp
  • A to T, chromosome 4 at 118,269,172 bp
  • C to T, chromosome 4 at 130,312,387 bp
  • T to C, chromosome 4 at 148,614,415 bp
  • G to A, chromosome 5 at 30,791,597 bp
  • A to C, chromosome 5 at 109,297,443 bp
  • T to A, chromosome 5 at 150,532,344 bp
  • T to C, chromosome 6 at 83,107,960 bp
  • T to C, chromosome 6 at 97,247,877 bp
  • T to C, chromosome 6 at 116,305,602 bp
  • T to A, chromosome 6 at 123,265,355 bp
  • C to A, chromosome 6 at 124,999,639 bp
  • A to G, chromosome 6 at 141,250,347 bp
  • T to C, chromosome 7 at 65,682,848 bp
  • CAAAAA to CAAAA, chromosome 8 at 84,716,247 bp
  • C to T, chromosome 9 at 44,696,131 bp
  • A to G, chromosome 9 at 50,533,455 bp
  • A to G, chromosome 9 at 72,617,964 bp
  • A to T, chromosome 10 at 56,150,792 bp
  • T to C, chromosome 11 at 70,965,719 bp
  • A to T, chromosome 11 at 88,590,108 bp
  • C to T, chromosome 11 at 100,102,939 bp
  • A to T, chromosome 11 at 102,402,088 bp
  • T to C, chromosome 11 at 118,988,762 bp
  • C to T, chromosome 12 at 52,023,453 bp
  • T to A, chromosome 12 at 111,336,029 bp
  • T to A, chromosome 12 at 112,738,985 bp
  • T to C, chromosome 14 at 50,681,563 bp
  • T to C, chromosome 14 at 50,866,864 bp
  • T to A, chromosome 15 at 8,194,403 bp
  • T to C, chromosome 15 at 36,050,232 bp
  • T to C, chromosome 15 at 55,906,318 bp
  • T to C, chromosome 15 at 82,556,936 bp
  • T to C, chromosome 15 at 91,871,549 bp
  • A to C, chromosome 16 at 97,799,264 bp
  • A to T, chromosome 17 at 25,860,388 bp
  • T to C, chromosome 17 at 26,974,124 bp
  • GAGACCAACGAGCAGCTGATGCTTCAGA to GAGA, chromosome 17 at 52,725,906 bp
  • T to C, chromosome 19 at 8,678,099 bp
  • T to C, chromosome 19 at 9,017,732 bp
  • T to C, chromosome 19 at 30,004,246 bp
  • T to C, chromosome 19 at 39,560,961 bp
Genotype Determination
G1 male heterozygous mice are viable and fertile. The G1 mice were not characterized prior to archiving.
Strain Development
C57BL/6J mice were injected with ENU, resulting in G0 mice that were bred back to C57BL/6J. Sperm was archived from G1 male mice that produced viable G2 mice.
Suggested Control Mice
Wild-type littermates or C57BL/6J mice
Bruce Beutler, M.D., University of Texas Southwestern Medical Center.
Primary Reference
MUTAGENETIX record for R2208 (G1). B. Beutler and colleagues, Center for the Genetics of Host Defense, UT Southwestern, Dallas, TX.

Colony and Husbandry Information

Colony Surveillance Program and Current Health Reports

Mice recovered from a cryo-archive will have health surveillance performed on recipient females. Health reports will be provided prior to shipment. If you require additional health status information, please email .
Coat Color
MMRRC Breeding System
Random intra-strain mating
Breeding Scheme(s)
When maintaining a live colony, heterozygous mice may be bred together, bred with wild-type siblings, or bred with C57BL/6J inbred mice.
Overall Breeding Performance
Undetermined; during development, mating was done with heterozygous males; viability, fertility and other breeding statistics for heterozygous females and homozygotes are unverified, but presumably would be similar to the C57BL/6J background strain
Average litter size
Recommended wean age
3 weeks

Order Request Information

Limited quantities of breeder mice (recovered litter) are available from a cryoarchive; recovered litter usually available to ship in 3 to 4 months.

Cryopreserved material may be available upon request, please inquire to for more information.

Distribution of this strain requires submission of the MMRRC Conditions of Use (COU). A link to the COU web form will be provided via email after an order has been placed; the form should be completed then or the email forwarded to your institutional official for completion.

The donor or their institution limits the distribution to non-profit institutions only.

Additional charges may apply for any special requests. Shipping costs are in addition to the basic distribution/resuscitation fees. Information on shipping costs and any additional charges will be provided by the supplying MMRRC facility.

Click button to Request this one strain. (Use the MMRRC Catalog Search to request more than one strain.)
MMRRC Item # Description Distribution Fee / Unit (US $)
*Shipping & Handling not included*
Units Notes
040210-MU-RESUS Litter recovered from cryo-archive $5,475.00 / Non-Profit Litter Recovered litter4; additional fees for any special requests.
Cryopreserved material may be available upon request, please inquire to for more information.

Some MMRRC strains were submitted by the donor as cryopreserved germplasm, and because these strains were not cryopreserved by the MMRRC, we have not assessed the quality of this material. We have extensive experience with recovery of mice from cryopreserved sperm and embryos of varying quality, including using techniques such as IVF and ICSI, and are confident that we will have success in most, if not all, cases. However, because of the unknown quality of these frozen samples, we will restrict recovery efforts to two attempts for each order. Subsequent attempts can be performed on a fee-for-service basis, in addition to the standard fees, upon request.

1 The distribution fee covers the expense of rederiving mice from a live mouse; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

2 An aliquot contains a sufficient number of embryos (in one or more vials or straws and based on the transfer success rate of the MMRRC facility) to transfer into one to three recipients. The MMRRC makes no guarantee concerning embryo transfer success experienced in the recipient investigator's laboratory. Neither gender nor genotype ratios are guaranteed.

3 An aliquot is one straw or vial with sufficient sperm to recover at least one litter of mice, as per provided protocols, when performed at the MMRRC facility. The MMRRC makes no guarantee concerning the success of these procedures when performed outside the MMRRC facilities.

4 The distribution fee covers the expense of resuscitating mice from the cryo-archive; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

To request material from the MMRRC: Please fill out our on-line request form (accessible from the catalog search results page, or click the Request this Strain button in the fees section). If you have questions or need assistance completing this form, you may call Customer Service at (800) 910-2291 (in USA or Canada) or (530) 757-5710 (international calls). Before you call, please have with you: the MMRRC item number, quantity needed, Bill-to and Ship-to contact information.