Loading Mouse GIF
Loading...

Strain Name:
C57BL/6J-MtgxR2208Btlr/Mmmh
Stock Number:
040210-MU
Citation ID:
RRID:MMRRC_040210-MU
Other Names:
R2208 (G1), C57BL/6J-MtgxR2208Btlr
Major Collection:

Strain Information

Chrm1
Name: cholinergic receptor, muscarinic 1, CNS
Synonyms: M1, muscarinic acetylcholine receptor 1, Chrm-1, M1R, AW495047
Type: Gene
Species: Mouse
Chromosome: 19
NCBI: 12669
HGNC: HGNC:1950
Homologene: 20189
Ptprf
Name: protein tyrosine phosphatase receptor type F
Synonyms: LAR, RPTP-LAR
Type: Gene
Species: Mouse
Chromosome: 4
NCBI: 19268
HGNC: HGNC:9670
Homologene: 20623
Msi2
Name: musashi RNA-binding protein 2
Synonyms: msi2h, Musashi2
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 76626
Homologene: 62199
Gng10
Name: guanine nucleotide binding protein (G protein), gamma 10
Type: Gene
Species: Mouse
Chromosome: 4
NCBI: 14700
HGNC: HGNC:4402
Homologene: 20874
Cdc42bpb
Name: CDC42 binding protein kinase beta
Synonyms: DMPK-like
Type: Gene
Species: Mouse
Chromosome: 12
NCBI: 217866
VEGA: 12
HGNC: HGNC:1738
Homologene: 55945
Cdc73
Name: cell division cycle 73, Paf1/RNA polymerase II complex component
Synonyms: C130030P16Rik, 8430414L16Rik, Hrpt2
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 214498
Homologene: 11571
Tep1
Name: telomerase associated protein 1
Synonyms: Tp1
Type: Gene
Species: Mouse
Chromosome: 14
NCBI: 21745
VEGA: 14
Homologene: 5157
Genetic Alterations
ENU-induced transitions at the following base pair locations (GRCm38):
  • G to A, chromosome 1 at 51,477,614 bp
  • A to C, chromosome 1 at 74,079,240 bp
  • T to A, chromosome 1 at 143,609,382 bp
  • G to A, chromosome 2 at 31,380,297 bp
  • C to A, chromosome 2 at 130,214,563 bp
  • T to A, chromosome 2 at 150,193,145 bp
  • T to A, chromosome 2 at 163,472,684 bp
  • A to G, chromosome 3 at 33,841,178 bp
  • C to A, chromosome 3 at 84,134,109 bp
  • T to A, chromosome 4 at 59,035,314 bp
  • T to C, chromosome 4 at 107,855,790 bp
  • G to T, chromosome 4 at 115,126,594 bp
  • A to T, chromosome 4 at 118,269,172 bp
  • C to T, chromosome 4 at 130,312,387 bp
  • T to C, chromosome 4 at 148,614,415 bp
  • G to A, chromosome 5 at 30,791,597 bp
  • A to C, chromosome 5 at 109,297,443 bp
  • T to A, chromosome 5 at 150,532,344 bp
  • T to C, chromosome 6 at 83,107,960 bp
  • T to C, chromosome 6 at 97,247,877 bp
  • T to C, chromosome 6 at 116,305,602 bp
  • T to A, chromosome 6 at 123,265,355 bp
  • C to A, chromosome 6 at 124,999,639 bp
  • A to G, chromosome 6 at 141,250,347 bp
  • T to C, chromosome 7 at 65,682,848 bp
  • CAAAAA to CAAAA, chromosome 8 at 84,716,247 bp
  • C to T, chromosome 9 at 44,696,131 bp
  • A to G, chromosome 9 at 50,533,455 bp
  • A to G, chromosome 9 at 72,617,964 bp
  • A to T, chromosome 10 at 56,150,792 bp
  • T to C, chromosome 11 at 70,965,719 bp
  • A to T, chromosome 11 at 88,590,108 bp
  • C to T, chromosome 11 at 100,102,939 bp
  • A to T, chromosome 11 at 102,402,088 bp
  • T to C, chromosome 11 at 118,988,762 bp
  • C to T, chromosome 12 at 52,023,453 bp
  • T to A, chromosome 12 at 111,336,029 bp
  • T to A, chromosome 12 at 112,738,985 bp
  • T to C, chromosome 14 at 50,681,563 bp
  • T to C, chromosome 14 at 50,866,864 bp
  • T to A, chromosome 15 at 8,194,403 bp
  • T to C, chromosome 15 at 36,050,232 bp
  • T to C, chromosome 15 at 55,906,318 bp
  • T to C, chromosome 15 at 82,556,936 bp
  • T to C, chromosome 15 at 91,871,549 bp
  • A to C, chromosome 16 at 97,799,264 bp
  • A to T, chromosome 17 at 25,860,388 bp
  • T to C, chromosome 17 at 26,974,124 bp
  • GAGACCAACGAGCAGCTGATGCTTCAGA to GAGA, chromosome 17 at 52,725,906 bp
  • T to C, chromosome 19 at 8,678,099 bp
  • T to C, chromosome 19 at 9,017,732 bp
  • T to C, chromosome 19 at 30,004,246 bp
  • T to C, chromosome 19 at 39,560,961 bp
Genotype Determination
Phenotype
G1 male heterozygous mice are viable and fertile. The G1 mice were not characterized prior to archiving.
Strain GQC Summary
Gene Specific Genotyping:

To request gene-specific and other genotyping services for a strain, please contact the distribution MMRRC Center for more information.

Background Genetic Quality:

The MMRRC has developed a Genetic Quality Control pipeline using the MiniMUGA array to provide additional information to identify and validate genetic backgrounds of MMRRC strains. For more information on whether genetic background data is available, please contact MMRRC_GeneticQC@med.unc.edu. Note: that MiniMUGA genetic background data is not available on all strains, but can be ordered if desired.

Suggested Control Mice
Littermates of all relevant genotypes.
Donor
Bruce Beutler, M.D., University of Texas Southwestern Medical Center.
Primary Reference
MUTAGENETIX record for R2208 (G1). B. Beutler and colleagues, Center for the Genetics of Host Defense, UT Southwestern, Dallas, TX.
Strain Development
C57BL/6J mice were injected with ENU, resulting in G0 mice that were bred back to C57BL/6J. Sperm was archived from G1 male mice that produced viable G2 mice.


Disclaimer: If MMRRC Strain Genetic Quality Control (GQC; based on MiniMUGA genotyping and analysis) has been completed for this strain, the information might differ from the genetic background information provided by the submitter. MiniMUGA genetic analysis is done on a strain’s tissue samples taken when archived by or ordered from the assigned MMRRC Center.

Colony and Husbandry Information

Colony Surveillance Program and Current Health Reports

Mice recovered from a cryo-archive will have health surveillance performed on recipient females. Health reports will be provided prior to shipment. If you require additional health status information, please email mmrrc@missouri.edu.
Coat Color
Black
MMRRC Breeding System
Random intra-strain mating
Breeding Scheme(s)
When maintaining a live colony, heterozygous mice may be bred together, bred with wild-type siblings, or bred with C57BL/6J inbred mice.
Overall Breeding Performance
Undetermined; during development, mating was done with heterozygous males; viability, fertility and other breeding statistics for heterozygous females and homozygotes are unverified, but presumably would be similar to the C57BL/6J background strain
Average litter size
Undetermined
Recommended wean age
3 weeks

Order Information

Limited quantities of breeder mice (recovered litter) are available from a cryoarchive; recovered litter usually available to ship in 3 to 4 months.

Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

Distribution of this strain requires submission of the MMRRC Conditions of Use (COU). A link to the COU web form will be provided via email after an order has been placed; the form should be completed then or the email forwarded to your institutional official for completion.

The submitter or their institution limits the distribution to non-profit institutions only.

Additional charges may apply for any special requests. Shipping costs are in addition to the basic distribution/resuscitation fees. Information on shipping costs and any additional charges will be provided by the supplying MMRRC facility.

Click button to Request this one strain. (Use the MMRRC Catalog Search to request more than one strain.)
MMRRC Item # Description Distribution Fee / Unit (US $)
*Shipping & Handling not included*
Units Notes
040210-MU-RESUS Litter recovered from cryo-archive $5,475.00 / Non-Profit Litter Recovered litter4; additional fees for any special requests.
Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

Some MMRRC strains were submitted by the donor as cryopreserved germplasm, and because these strains were not cryopreserved by the MMRRC, we have not assessed the quality, nor genotype, of this material. Our expertise in reviving mice from various qualities of frozen sperm and embryos, using methods like IVF and ICSI, gives us confidence in successful recoveries in most cases. However, due to the uncertain quality of these samples, we'll limit revival attempts to two per order. Additional attempts are available for a fee, on top of standard charges, if requested. It's important to note that some strains may lack the expected mutation, so we can't assure successful order fulfillment until we attempt to revive the strain.

1 The distribution fee covers the expense of rederiving mice from a live mouse; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

2 An aliquot contains a sufficient number of embryos (in one or more vials or straws and based on the transfer success rate of the MMRRC facility) to transfer into one to three recipients. The MMRRC makes no guarantee concerning embryo transfer success experienced in the recipient investigator's laboratory. Neither gender nor genotype ratios are guaranteed.

3 An aliquot is one straw or vial with sufficient sperm to recover at least one litter of mice, as per provided protocols, when performed at the MMRRC facility. The MMRRC makes no guarantee concerning the success of these procedures when performed outside the MMRRC facilities.

4 The distribution fee covers the expense of resuscitating mice from the cryo-archive; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

To request material from the MMRRC: Please fill out our on-line request form (accessible from the catalog search results page, or click the Request this Strain button in the fees section). If you have questions or need assistance completing this form, you may call Customer Service at (800) 910-2291 (in USA or Canada) or (530) 757-5710 (international calls). Before you call, please have with you: the MMRRC item number, quantity needed, Bill-to and Ship-to contact information.