Strain Name:
C57BL/6J-MtgxR2217Btlr/Mmmh
Stock Number:
040219-MU
Citation ID:
RRID:MMRRC_040219-MU
Other Names:
R2217 (G1), C57BL/6J-MtgxR2217Btlr
Major Collection:

Strain Information

Tmem59l
Name: transmembrane protein 59-like
Synonyms: 5330410G16Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 8
NCBI: 67937
Homologene: 8104
Polr2a
Name: polymerase (RNA) II (DNA directed) polypeptide A
Synonyms: Rpo2-1, 220kDa
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 11
NCBI: 20020
HGNC: HGNC:9187
Homologene: 721
Virma
Name: vir like m6A methyltransferase associated
Synonyms: 1110037F02Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 4
NCBI: 66185
Homologene: 41043
Nsrp1
Name: nuclear speckle regulatory protein 1
Synonyms: NSpr70, Ccdc55
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 11
NCBI: 237859
Homologene: 134095
Daam1
Name: dishevelled associated activator of morphogenesis 1
Synonyms: 1700066F09Rik, 2310028E21Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 12
NCBI: 208846
VEGA: 12
Homologene: 36635
Gpat4
Name: glycerol-3-phosphate acyltransferase 4
Synonyms: Agpat6
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 8
NCBI: 102247
Homologene: 32425
Atxn2
Name: ataxin 2
Synonyms: 9630045M23Rik, ATX2, Sca2
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 5
NCBI: 20239
Homologene: 2234
Fmr1
Name: fragile X messenger ribonucleoprotein 1
Synonyms: fragile X mental retardation 1, Fmr-1, FMRP
Type: Gene
Species: Mus musculus (mouse)
Chromosome: X
NCBI: 14265
HGNC: HGNC:3775
Homologene: 1531
Slf1
Name: SMC5-SMC6 complex localization factor 1
Synonyms: Ankrd32, C730024G01Rik, Brctx, Brctd1, 2700017A04Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 13
NCBI: 105377
Homologene: 13000
Adat1
Name: adenosine deaminase, tRNA-specific 1
Synonyms: mADAT1
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 8
NCBI: 30947
HGNC: HGNC:228
Homologene: 8096
Myh14
Name: myosin, heavy polypeptide 14
Synonyms: NMHC II-C, 2400004E04Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 7
NCBI: 71960
Homologene: 23480
Ptger1
Name: prostaglandin E receptor 1 (subtype EP1)
Synonyms: 42kDa, Ptgerep1, EP1
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 8
NCBI: 19216
HGNC: HGNC:9593
Homologene: 738
Epg5
Name: ectopic P-granules autophagy protein 5 homolog (C. elegans)
Synonyms: 5430411K18Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 18
NCBI: 100502841
VEGA: 18
Homologene: 14575
Pank2
Name: pantothenate kinase 2
Synonyms: 4933409I19Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 2
NCBI: 74450
Homologene: 65126
Crb3
Name: crumbs family member 3
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 17
NCBI: 224912
Homologene: 134352
Canx
Name: calnexin
Synonyms: CNX, 1110069N15Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 11
NCBI: 12330
HGNC: HGNC:1473
Homologene: 1324
Slc20a2
Name: solute carrier family 20, member 2
Synonyms: PiT-2, Ram-1, MolPit2, Ram1, Pit-2
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 8
NCBI: 20516
Homologene: 68531
Tmem64
Name: transmembrane protein 64
Synonyms: 9630015D15Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 4
NCBI: 100201
Homologene: 45636
Plxna2
Name: plexin A2
Synonyms: PlexA2, Plxn2, OCT, 2810428A13Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 1
NCBI: 18845
HGNC: HGNC:9100
Homologene: 56427
Tmc2
Name: transmembrane channel-like gene family 2
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 2
NCBI: 192140
Homologene: 25877
Trpm2
Name: transient receptor potential cation channel, subfamily M, member 2
Synonyms: LTRPC2, 9830168K16Rik, Trrp7, TRPC7
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 10
NCBI: 28240
Homologene: 20709
Nfkb2
Name: nuclear factor of kappa light polypeptide gene enhancer in B cells 2, p49/p100
Synonyms: NF kappaB2, p52
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 19
NCBI: 18034
VEGA: 19
HGNC: HGNC:7795
Homologene: 1873
Tomm20l
Name: translocase of outer mitochondrial membrane 20-like
Synonyms: 4930553D19Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 12
NCBI: 75266
VEGA: 12
Homologene: 52617
Hmcn2
Name: hemicentin 2
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 2
NCBI: 665700
Homologene: 90772
Ptgr1
Name: prostaglandin reductase 1
Synonyms: Zadh3, Ltb4dh, 2510002C21Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 4
NCBI: 67103
Homologene: 40820
Cacna1c
Name: calcium channel, voltage-dependent, L type, alpha 1C subunit
Synonyms: D930026N18Rik, L-type Cav1.2, Cav1.2, Cchl1a1, (alpha)1 subunit
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 6
NCBI: 12288
HGNC: HGNC:1390
Homologene: 55484
Hydin
Name: HYDIN, axonemal central pair apparatus protein
Synonyms: 1700034M11Rik, hy-3, 4930545D19Rik, hy3, hyrh
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 8
NCBI: 244653
Homologene: 52118
Slc27a2
Name: solute carrier family 27 (fatty acid transporter), member 2
Synonyms: FATP2, Vlac, FATP2, ACSVL1, Vlacs, VLCS
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 2
NCBI: 26458
Homologene: 37830
Pak5
Name: p21 (RAC1) activated kinase 5
Synonyms: Pak5, 2900083L08Rik, Pak7
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 2
NCBI: 241656
Homologene: 22211
Zan
Name: zonadhesin
Synonyms: Zan
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 5
NCBI: 22635
Homologene: 124417
Psma1
Name: proteasome subunit alpha 1
Synonyms: C2, Pros-30, HC2
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 7
NCBI: 26440
HGNC: HGNC:9530
Homologene: 2080
Slc47a2
Name: solute carrier family 47, member 2
Synonyms: 4933429E10Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 11
NCBI: 380701
Homologene: 134426
Apba1
Name: amyloid beta (A4) precursor protein binding, family A, member 1
Synonyms: X11alpha, Mint1, Mint, X11, Lin-10, 6430513E09Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 19
NCBI: 319924
VEGA: 19
HGNC: HGNC:578
Homologene: 897
Tctn2
Name: tectonic family member 2
Synonyms: 4432405B04Rik, Tect2
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 5
NCBI: 67978
Homologene: 11729
Map3k6
Name: mitogen-activated protein kinase kinase kinase 6
Synonyms: Ask2, MEKK6, MAPKKK6
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 4
NCBI: 53608
HGNC: HGNC:6858
Homologene: 3435
Eml6
Name: echinoderm microtubule associated protein like 6
Synonyms: C230094A16Rik, 2900083P10Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 11
NCBI: 237711
Homologene: 104282
Lgals12
Name: lectin, galactose binding, soluble 12
Synonyms: galectin-12, GRIP1, galectin-related inhibitor of proliferation
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 19
NCBI: 56072
Homologene: 10462
Atp11a
Name: ATPase, class VI, type 11A
Synonyms: 4930558F19Rik, Ih, LOC100045280, 9130422H11Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 8
NCBI: 50770
Homologene: 75050
Or4c112
Name: olfactory receptor family 4 subfamily C member 112
Synonyms: MOR233-4, GA_x6K02T2Q125-50504545-50503631, Olfr1217
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 2
NCBI: 258903
Homologene: 73985
Gm7535
Name: predicted gene 7535
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 17
NCBI: 665187
VEGA: 17
Zfp27
Name: zinc finger protein 27
Synonyms: mkr-4, Zfp-27
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 7
NCBI: 22689
Homologene: 81823
Tiam2
Name: T cell lymphoma invasion and metastasis 2
Synonyms: 3000002F19Rik, STEF
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 17
NCBI: 24001
VEGA: 17
Homologene: 40796
Vax2
Name: ventral anterior homeobox 2
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 6
NCBI: 24113
Homologene: 8048
Nlrp4c
Name: NLR family, pyrin domain containing 4C
Synonyms: Nalp4c, Rnh2, Nalp-alpha
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 7
NCBI: 83564
Homologene: 75315
Flt4
Name: FMS-like tyrosine kinase 4
Synonyms: VEGFR3, VEGFR-3, Flt-4
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 11
NCBI: 14257
HGNC: HGNC:3767
Homologene: 7321
Pp2d1
Name: protein phosphatase 2C-like domain containing 1
Synonyms: 4921523A10Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 17
NCBI: 110332
VEGA: 17
Homologene: 16981
Zbtb22
Name: zinc finger and BTB domain containing 22
Synonyms: 1110008J20Rik, Bing1, Zfp297
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 17
NCBI: 81630
Homologene: 3982
Catsperb
Name: cation channel sperm associated auxiliary subunit beta
Synonyms: 4932415G16Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 12
NCBI: 271036
VEGA: 12
Homologene: 81904
Appl2
Name: adaptor protein, phosphotyrosine interaction, PH domain and leucine zipper containing 2
Synonyms: Dip3b
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 10
NCBI: 216190
Homologene: 10046
Gm10608
Name: predicted gene 10608
Synonyms: EG546165
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 9
NCBI: 546165
VEGA: 9
Ehd1
Name: EH-domain containing 1
Synonyms: RME-1, Past1
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 19
NCBI: 13660
HGNC: HGNC:3242
Homologene: 81678
Timd2
Name: T cell immunoglobulin and mucin domain containing 2
Synonyms: Tim2, TIM-2
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 11
NCBI: 171284
Homologene: 82236
Phf6
Name: PHD finger protein 6
Synonyms: 2700007B13Rik, 4931428F02Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: X
NCBI: 70998
Homologene: 12375
Genetic Alterations
ENU-induced transitions at the following base pair locations (GRCm38):
  • T to C, chromosome 1 at 194,797,748 bp
  • A to T, chromosome 2 at 31,350,574 bp
  • G to T, chromosome 2 at 89,023,426 bp
  • A to G, chromosome 2 at 126,567,752 bp
  • T to C, chromosome 2 at 130,260,161 bp
  • A to G, chromosome 2 at 131,282,681 bp
  • A to G, chromosome 2 at 136,116,203 bp
  • T to C, chromosome 4 at 11,544,924 bp
  • T to C, chromosome 4 at 15,266,658 bp
  • C to T, chromosome 4 at 58,968,752 bp
  • T to A, chromosome 4 at 133,246,672 bp
  • T to C, chromosome 5 at 121,803,077 bp
  • T to C, chromosome 5 at 124,624,313 bp
  • C to A, chromosome 5 at 137,410,306 bp
  • A to T, chromosome 6 at 83,737,889 bp
  • T to C, chromosome 6 at 118,670,407 bp
  • T to C, chromosome 7 at 6,073,114 bp
  • A to G, chromosome 7 at 29,896,111 bp
  • G to A, chromosome 7 at 44,634,376 bp
  • C to T, chromosome 7 at 114,264,938 bp
  • T to C, chromosome 8 at 12,863,870 bp
  • C to A, chromosome 8 at 22,560,516 bp
  • G to A, chromosome 8 at 23,180,155 bp
  • A to G, chromosome 8 at 70,487,301 bp
  • C to T, chromosome 8 at 83,668,728 bp
  • G to A, chromosome 8 at 110,418,506 bp
  • T to C, chromosome 8 at 111,982,496 bp
  • CAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGA to CAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGA, chromosome 9 at 119,160,716 bp
  • T to A, chromosome 10 at 77,941,182 bp
  • G to T, chromosome 10 at 83,608,737 bp
  • T to A, chromosome 11 at 29,818,907 bp
  • T to A, chromosome 11 at 46,687,017 bp
  • T to A, chromosome 11 at 49,624,728 bp
  • C to T, chromosome 11 at 50,310,867 bp
  • T to C, chromosome 11 at 61,313,671 bp
  • A to G, chromosome 11 at 69,742,685 bp
  • A to T, chromosome 11 at 77,045,761 bp
  • T to C, chromosome 12 at 71,122,020 bp
  • G to A, chromosome 12 at 71,989,827 bp
  • T to C, chromosome 12 at 101,594,219 bp
  • T to A, chromosome 13 at 77,046,706 bp
  • A to G, chromosome 17 at 3,415,114 bp
  • A to G, chromosome 17 at 17,911,674 bp
  • T to G, chromosome 17 at 33,917,965 bp
  • C to A, chromosome 17 at 53,515,454 bp
  • T to C, chromosome 17 at 57,065,090 bp
  • T to A, chromosome 18 at 77,949,072 bp
  • T to A, chromosome 19 at 6,298,472 bp
  • A to G, chromosome 19 at 7,598,180 bp
  • T to C, chromosome 19 at 23,893,962 bp
  • T to C, chromosome 19 at 46,307,724 bp
  • A to T, chromosome X at 52,942,648 bp
  • T to A, chromosome X at 68,695,095 bp
Genotype Determination
Phenotype
G1 male heterozygous mice are viable and fertile. The G1 mice were not characterized prior to archiving.
Strain Development
C57BL/6J mice were injected with ENU, resulting in G0 mice that were bred back to C57BL/6J. Sperm was archived from G1 male mice that produced viable G2 mice.
Suggested Control Mice
Wild-type littermates or C57BL/6J mice
MMRRC Genetic QC Summary
The MMRRC Centers have developed a genetic QC pipeline using MiniMUGA array genotyping to provide additional information on strain backgrounds for MMRRC congenic and inbred strains. For more information on when data may be available, or to request genotyping for a strain of interest, please contact mmrrc@missouri.edu. Older strains may not have this information.
Donor
Bruce Beutler, M.D., University of Texas Southwestern Medical Center.
Primary Reference
MUTAGENETIX record for R2217 (G1). B. Beutler and colleagues, Center for the Genetics of Host Defense, UT Southwestern, Dallas, TX.

Colony and Husbandry Information

Colony Surveillance Program and Current Health Reports

Mice recovered from a cryo-archive will have health surveillance performed on recipient females. Health reports will be provided prior to shipment. If you require additional health status information, please email mmrrc@missouri.edu .
Coat Color
Black
MMRRC Breeding System
Random intra-strain mating
Breeding Scheme(s)
When maintaining a live colony, heterozygous mice may be bred together, bred with wild-type siblings, or bred with C57BL/6J inbred mice.
Overall Breeding Performance
Undetermined; during development, mating was done with heterozygous males; viability, fertility and other breeding statistics for heterozygous females and homozygotes are unverified, but presumably would be similar to the C57BL/6J background strain
Average litter size
Undetermined
Recommended wean age
3 weeks

Order Request Information

Limited quantities of breeder mice (recovered litter) are available from a cryoarchive; recovered litter usually available to ship in 3 to 4 months.

Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

Distribution of this strain requires submission of the MMRRC Conditions of Use (COU). A link to the COU web form will be provided via email after an order has been placed; the form should be completed then or the email forwarded to your institutional official for completion.

The donor or their institution limits the distribution to non-profit institutions only.

Additional charges may apply for any special requests. Shipping costs are in addition to the basic distribution/resuscitation fees. Information on shipping costs and any additional charges will be provided by the supplying MMRRC facility.

Click button to Request this one strain. (Use the MMRRC Catalog Search to request more than one strain.)
MMRRC Item # Description Distribution Fee / Unit (US $)
*Shipping & Handling not included*
Units Notes
040219-MU-RESUS Litter recovered from cryo-archive $5,475.00 / Non-Profit Litter Recovered litter4; additional fees for any special requests.
Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

Some MMRRC strains were submitted by the donor as cryopreserved germplasm, and because these strains were not cryopreserved by the MMRRC, we have not assessed the quality of this material. We have extensive experience with recovery of mice from cryopreserved sperm and embryos of varying quality, including using techniques such as IVF and ICSI, and are confident that we will have success in most, if not all, cases. However, because of the unknown quality of these frozen samples, we will restrict recovery efforts to two attempts for each order. Subsequent attempts can be performed on a fee-for-service basis, in addition to the standard fees, upon request.

1 The distribution fee covers the expense of rederiving mice from a live mouse; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

2 An aliquot contains a sufficient number of embryos (in one or more vials or straws and based on the transfer success rate of the MMRRC facility) to transfer into one to three recipients. The MMRRC makes no guarantee concerning embryo transfer success experienced in the recipient investigator's laboratory. Neither gender nor genotype ratios are guaranteed.

3 An aliquot is one straw or vial with sufficient sperm to recover at least one litter of mice, as per provided protocols, when performed at the MMRRC facility. The MMRRC makes no guarantee concerning the success of these procedures when performed outside the MMRRC facilities.

4 The distribution fee covers the expense of resuscitating mice from the cryo-archive; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

To request material from the MMRRC: Please fill out our on-line request form (accessible from the catalog search results page, or click the Request this Strain button in the fees section). If you have questions or need assistance completing this form, you may call Customer Service at (800) 910-2291 (in USA or Canada) or (530) 757-5710 (international calls). Before you call, please have with you: the MMRRC item number, quantity needed, Bill-to and Ship-to contact information.