Loading Mouse GIF
Loading...

Strain Name:
C57BL/6J-MtgxR2217Btlr/Mmmh
Stock Number:
040219-MU
Citation ID:
RRID:MMRRC_040219-MU
Other Names:
R2217 (G1), C57BL/6J-MtgxR2217Btlr
Major Collection:

Strain Information

Tmem59l
Name: transmembrane protein 59-like
Synonyms: 5330410G16Rik
Type: Gene
Species: Mouse
Chromosome: 8
NCBI: 67937
Homologene: 8104
Polr2a
Name: polymerase (RNA) II (DNA directed) polypeptide A
Synonyms: 220kDa, Rpo2-1
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 20020
HGNC: HGNC:9187
Homologene: 721
Virma
Name: vir like m6A methyltransferase associated
Synonyms: 1110037F02Rik
Type: Gene
Species: Mouse
Chromosome: 4
NCBI: 66185
Homologene: 41043
Nsrp1
Name: nuclear speckle regulatory protein 1
Synonyms: NSpr70, Ccdc55
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 237859
Homologene: 134095
Daam1
Name: dishevelled associated activator of morphogenesis 1
Synonyms: 1700066F09Rik, 2310028E21Rik
Type: Gene
Species: Mouse
Chromosome: 12
NCBI: 208846
VEGA: 12
Homologene: 36635
Gpat4
Name: glycerol-3-phosphate acyltransferase 4
Synonyms: Agpat6
Type: Gene
Species: Mouse
Chromosome: 8
NCBI: 102247
Homologene: 32425
Atxn2
Name: ataxin 2
Synonyms: ATX2, 9630045M23Rik, Sca2
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 20239
Homologene: 2234
Genetic Alterations
ENU-induced transitions at the following base pair locations (GRCm38):
  • T to C, chromosome 1 at 194,797,748 bp
  • A to T, chromosome 2 at 31,350,574 bp
  • G to T, chromosome 2 at 89,023,426 bp
  • A to G, chromosome 2 at 126,567,752 bp
  • T to C, chromosome 2 at 130,260,161 bp
  • A to G, chromosome 2 at 131,282,681 bp
  • A to G, chromosome 2 at 136,116,203 bp
  • T to C, chromosome 4 at 11,544,924 bp
  • T to C, chromosome 4 at 15,266,658 bp
  • C to T, chromosome 4 at 58,968,752 bp
  • T to A, chromosome 4 at 133,246,672 bp
  • T to C, chromosome 5 at 121,803,077 bp
  • T to C, chromosome 5 at 124,624,313 bp
  • C to A, chromosome 5 at 137,410,306 bp
  • A to T, chromosome 6 at 83,737,889 bp
  • T to C, chromosome 6 at 118,670,407 bp
  • T to C, chromosome 7 at 6,073,114 bp
  • A to G, chromosome 7 at 29,896,111 bp
  • G to A, chromosome 7 at 44,634,376 bp
  • C to T, chromosome 7 at 114,264,938 bp
  • T to C, chromosome 8 at 12,863,870 bp
  • C to A, chromosome 8 at 22,560,516 bp
  • G to A, chromosome 8 at 23,180,155 bp
  • A to G, chromosome 8 at 70,487,301 bp
  • C to T, chromosome 8 at 83,668,728 bp
  • G to A, chromosome 8 at 110,418,506 bp
  • T to C, chromosome 8 at 111,982,496 bp
  • CAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGA to CAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGA, chromosome 9 at 119,160,716 bp
  • T to A, chromosome 10 at 77,941,182 bp
  • G to T, chromosome 10 at 83,608,737 bp
  • T to A, chromosome 11 at 29,818,907 bp
  • T to A, chromosome 11 at 46,687,017 bp
  • T to A, chromosome 11 at 49,624,728 bp
  • C to T, chromosome 11 at 50,310,867 bp
  • T to C, chromosome 11 at 61,313,671 bp
  • A to G, chromosome 11 at 69,742,685 bp
  • A to T, chromosome 11 at 77,045,761 bp
  • T to C, chromosome 12 at 71,122,020 bp
  • G to A, chromosome 12 at 71,989,827 bp
  • T to C, chromosome 12 at 101,594,219 bp
  • T to A, chromosome 13 at 77,046,706 bp
  • A to G, chromosome 17 at 3,415,114 bp
  • A to G, chromosome 17 at 17,911,674 bp
  • T to G, chromosome 17 at 33,917,965 bp
  • C to A, chromosome 17 at 53,515,454 bp
  • T to C, chromosome 17 at 57,065,090 bp
  • T to A, chromosome 18 at 77,949,072 bp
  • T to A, chromosome 19 at 6,298,472 bp
  • A to G, chromosome 19 at 7,598,180 bp
  • T to C, chromosome 19 at 23,893,962 bp
  • T to C, chromosome 19 at 46,307,724 bp
  • A to T, chromosome X at 52,942,648 bp
  • T to A, chromosome X at 68,695,095 bp
Genotype Determination
Phenotype
G1 male heterozygous mice are viable and fertile. The G1 mice were not characterized prior to archiving.
Strain GQC Summary
Gene Specific Genotyping:

To request gene-specific and other genotyping services for a strain, please contact the distribution MMRRC Center for more information.

Background Genetic Quality:

The MMRRC has developed a Genetic Quality Control pipeline using the MiniMUGA array to provide additional information to identify and validate genetic backgrounds of MMRRC strains. For more information on whether genetic background data is available, please contact MMRRC_GeneticQC@med.unc.edu. Note: that MiniMUGA genetic background data is not available on all strains, but can be ordered if desired.

Suggested Control Mice
Littermates of all relevant genotypes.
Submitter
Bruce Beutler, M.D., University of Texas Southwestern Medical Center.
Primary Reference
MUTAGENETIX record for R2217 (G1). B. Beutler and colleagues, Center for the Genetics of Host Defense, UT Southwestern, Dallas, TX.
Strain Development
C57BL/6J mice were injected with ENU, resulting in G0 mice that were bred back to C57BL/6J. Sperm was archived from G1 male mice that produced viable G2 mice.


Disclaimer: If MMRRC Strain Genetic Quality Control (GQC; based on MiniMUGA genotyping and analysis) has been completed for this strain, the information might differ from the genetic background information provided by the submitter. MiniMUGA genetic analysis is done on a strain’s tissue samples taken when archived by or ordered from the assigned MMRRC Center.

Colony and Husbandry Information

Colony Surveillance Program and Current Health Reports

Mice recovered from a cryo-archive will have health surveillance performed on recipient females. Health reports will be provided prior to shipment. If you require additional health status information, please email mmrrc@missouri.edu.
Coat Color
Black
MMRRC Breeding System
Random intra-strain mating
Breeding Scheme(s)
When maintaining a live colony, heterozygous mice may be bred together, bred with wild-type siblings, or bred with C57BL/6J inbred mice.
Overall Breeding Performance
Undetermined; during development, mating was done with heterozygous males; viability, fertility and other breeding statistics for heterozygous females and homozygotes are unverified, but presumably would be similar to the C57BL/6J background strain
Average litter size
Undetermined
Recommended wean age
3 weeks

Order Information

Limited quantities of breeder mice (recovered litter) are available from a cryoarchive; recovered litter usually available to ship in 3 to 4 months.

Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

Distribution of this strain requires submission of the MMRRC Conditions of Use (COU). A link to the COU web form will be provided via email after an order has been placed; the form should be completed then or the email forwarded to your institutional official for completion.

The submitter or their institution limits the distribution to non-profit institutions only.

Additional charges may apply for any special requests. Shipping costs are in addition to the basic distribution/resuscitation fees. Information on shipping costs and any additional charges will be provided by the supplying MMRRC facility.

Click button to Request this one strain. (Use the MMRRC Catalog Search to request more than one strain.)
MMRRC Item # Description Distribution Fee / Unit (US $)
*Shipping & Handling not included*
Units Notes
040219-MU-RESUS Litter recovered from cryo-archive $5,475.00 / Non-Profit Litter Recovered litter4; additional fees for any special requests.
Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

Some MMRRC strains were submitted by the submitter as cryopreserved germplasm, and because these strains were not cryopreserved by the MMRRC, we have not assessed the quality, nor genotype, of this material. Our expertise in reviving mice from various qualities of frozen sperm and embryos, using methods like IVF and ICSI, gives us confidence in successful recoveries in most cases. However, due to the uncertain quality of these samples, we'll limit revival attempts to two per order. Additional attempts are available for a fee, on top of standard charges, if requested. It's important to note that some strains may lack the expected mutation, so we can't assure successful order fulfillment until we attempt to revive the strain.

1 The distribution fee covers the expense of rederiving mice from a live mouse; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

2 An aliquot contains a sufficient number of embryos (in one or more vials or straws and based on the transfer success rate of the MMRRC facility) to transfer into one to three recipients. The MMRRC makes no guarantee concerning embryo transfer success experienced in the recipient investigator's laboratory. Neither gender nor genotype ratios are guaranteed.

3 An aliquot is one straw or vial with sufficient sperm to recover at least one litter of mice, as per provided protocols, when performed at the MMRRC facility. The MMRRC makes no guarantee concerning the success of these procedures when performed outside the MMRRC facilities.

4 The distribution fee covers the expense of resuscitating mice from the cryo-archive; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

To request material from the MMRRC: Please fill out our on-line request form (accessible from the catalog search results page, or click the Request this Strain button in the fees section). If you have questions or need assistance completing this form, you may call Customer Service at (800) 910-2291 (in USA or Canada) or (530) 757-5710 (international calls). Before you call, please have with you: the MMRRC item number, quantity needed, Bill-to and Ship-to contact information.