Strain Name:
C57BL/6J-MtgxR2229Btlr/Mmmh
Stock Number:
040230-MU
Citation ID:
RRID:MMRRC_040230-MU
Other Names:
R2229 (G1), C57BL/6J-MtgxR2229Btlr
Major Collection:

Gene Information

Kif3c
Name: kinesin family member 3C
Synonyms: N-4 kinesin
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 12
Alteration at locus: Chemically Induced
NCBI: 16570
VEGA: 12
HGNC: HGNC:6321
Homologene: 55640
Aldh1l1
Name: aldehyde dehydrogenase 1 family, member L1
Synonyms: 1810048F20Rik, Fthfd
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 6
Alteration at locus: Chemically Induced
NCBI: 107747
HGNC: HGNC:3978
Homologene: 122031
Pmepa1
Name: prostate transmembrane protein, androgen induced 1
Synonyms: PMEPA1, STAG1, N4wbp4, Tmepai, 2210418I02Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 2
Alteration at locus: Chemically Induced
NCBI: 65112
Homologene: 10608
Eml4
Name: echinoderm microtubule associated protein like 4
Synonyms: 4930443C24Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 17
Alteration at locus: Chemically Induced
NCBI: 78798
VEGA: 17
HGNC: HGNC:1316
Homologene: 56841
Wwp1
Name: WW domain containing E3 ubiquitin protein ligase 1
Synonyms: SDRP1, 8030445B08Rik, AIP5, Tiul1
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 4
Alteration at locus: Chemically Induced
NCBI: 107568
Homologene: 21385
Gmps
Name: guanine monophosphate synthetase
Synonyms: Gm9479
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 3
Alteration at locus: Chemically Induced
NCBI: 229363
HGNC: HGNC:4378
Homologene: 68367
Nup93
Name: nucleoporin 93
Synonyms: 2410008G02Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 8
Alteration at locus: Chemically Induced
NCBI: 71805
Homologene: 40971
Cdc5l
Name: cell division cycle 5-like (S. pombe)
Synonyms: PCDC5RP, 1200002I02Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 17
Alteration at locus: Chemically Induced
NCBI: 71702
VEGA: 17
HGNC: HGNC:1743
Homologene: 13291
Tubgcp5
Name: tubulin, gamma complex associated protein 5
Synonyms: B130010C12Rik, GCP5
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 7
Alteration at locus: Chemically Induced
NCBI: 233276
Homologene: 14172
Banp
Name: BTG3 associated nuclear protein
Synonyms: SMAR1
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 8
Alteration at locus: Chemically Induced
NCBI: 53325
Homologene: 9635
Myo1b
Name: myosin IB
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 1
Alteration at locus: Chemically Induced
NCBI: 17912
HGNC: HGNC:7596
Homologene: 7856
Ccdc18
Name: coiled-coil domain containing 18
Synonyms: 4932411G06Rik, 1700021E15Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 5
Alteration at locus: Chemically Induced
NCBI: 73254
Homologene: 35455
Tcof1
Name: treacle ribosome biogenesis factor 1
Synonyms: treacle
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 18
Alteration at locus: Chemically Induced
NCBI: 21453
Homologene: 68049
Tg
Name: thyroglobulin
Synonyms: Tgn
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 15
Alteration at locus: Chemically Induced
NCBI: 21819
Homologene: 2430
Arfip1
Name: ADP-ribosylation factor interacting protein 1
Synonyms: Arfaptin, D3Ertd598e, 2310030I10Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 3
Alteration at locus: Chemically Induced
NCBI: 99889
Homologene: 8692
Nbn
Name: nibrin
Synonyms: Nbs1
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 4
Alteration at locus: Chemically Induced
NCBI: 27354
HGNC: HGNC:7652
Homologene: 1858
Pikfyve
Name: phosphoinositide kinase, FYVE type zinc finger containing
Synonyms: Pip5k3, 5230400C17Rik, PipkIII
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 1
Alteration at locus: Chemically Induced
NCBI: 18711
Homologene: 32115
Lmnb2
Name: lamin B2
Synonyms: lamin B3
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 10
Alteration at locus: Chemically Induced
NCBI: 16907
HGNC: HGNC:6638
Homologene: 7818
Atp6v1b2
Name: ATPase, H+ transporting, lysosomal V1 subunit B2
Synonyms: HO57, Atp6b2
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 8
Alteration at locus: Chemically Induced
NCBI: 11966
HGNC: HGNC:854
Homologene: 1279
Btnl9
Name: butyrophilin-like 9
Synonyms: D330012D11Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 11
Alteration at locus: Chemically Induced
NCBI: 237754
Homologene: 68540
Trim25
Name: tripartite motif-containing 25
Synonyms: estrogen-responsive finger protein, Zfp147
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 11
Alteration at locus: Chemically Induced
NCBI: 217069
Homologene: 48325
Spats2
Name: spermatogenesis associated, serine-rich 2
Synonyms: p59scr, Scr59, 59kDa, 2700012F11Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 15
Alteration at locus: Chemically Induced
NCBI: 72572
VEGA: 15
Homologene: 11314
Zdhhc5
Name: zinc finger, DHHC domain containing 5
Synonyms: Zisp, 1110032A17Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 2
Alteration at locus: Chemically Induced
NCBI: 228136
Homologene: 9147
Golga2
Name: golgi autoantigen, golgin subfamily a, 2
Synonyms: GM130
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 2
Alteration at locus: Chemically Induced
NCBI: 99412
HGNC: HGNC:4425
Homologene: 3300
Smarcc2
Name: SWI/SNF related, matrix associated, actin dependent regulator of chromatin, subfamily c, member 2
Synonyms: 5930405J04Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 10
Alteration at locus: Chemically Induced
NCBI: 68094
VEGA: 10
Homologene: 2312
Optn
Name: optineurin
Synonyms: 4930441O07Rik, TFIIIA-INTP
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 2
Alteration at locus: Chemically Induced
NCBI: 71648
Homologene: 11085
Myo7a
Name: myosin VIIA
Synonyms: USH1B, Hdb, Myo7, polka, nmf371
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 7
Alteration at locus: Chemically Induced
NCBI: 17921
HGNC: HGNC:7606
Homologene: 219
Pkd2l2
Name: polycystic kidney disease 2-like 2
Synonyms: TRPP5, Polycystin - L2
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 18
Alteration at locus: Chemically Induced
NCBI: 53871
VEGA: 18
HGNC: HGNC:9012
Homologene: 22812
Oca2
Name: oculocutaneous albinism II
Synonyms: D7H15S12, p, D7H15S12
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 7
Alteration at locus: Chemically Induced
NCBI: 18431
HGNC: HGNC:8101
Homologene: 37281
Tex15
Name: testis expressed gene 15
Synonyms: 2210014E14Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 8
Alteration at locus: Chemically Induced
NCBI: 104271
Homologene: 12837
Ttn
Name: titin
Synonyms: shru, connectin, mdm, 2310057K23Rik, D330041I19Rik, 1100001C23Rik, D830007G01Rik, 2310036G12Rik, L56, 2310074I15Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 2
Alteration at locus: Chemically Induced
NCBI: 22138
Homologene: 130650
Agbl1
Name: ATP/GTP binding protein-like 1
Synonyms: EG244071, Nna1-l1, Ccp4
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 7
Alteration at locus: Chemically Induced
NCBI: 244071
Homologene: 17552
Slc4a8
Name: solute carrier family 4 (anion exchanger), member 8
Synonyms: sodium bicarbonate cotransporter isoform 3 kNBC-3, KNBC-3, NDCBE
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 15
Alteration at locus: Chemically Induced
NCBI: 59033
Homologene: 68419
Pdzph1
Name: PDZ and pleckstrin homology domains 1
Synonyms: 2610034M16Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 17
Alteration at locus: Chemically Induced
NCBI: 69239
Homologene: 130756
Myh8
Name: myosin, heavy polypeptide 8, skeletal muscle, perinatal
Synonyms: Myhs-p, 4832426G23Rik, Myhsp, MyHC-pn
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 11
Alteration at locus: Chemically Induced
NCBI: 17885
HGNC: HGNC:7578
Homologene: 68256
Ugcg
Name: UDP-glucose ceramide glucosyltransferase
Synonyms: Ugcgl, Epcs21, GlcT-1
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 4
Alteration at locus: Chemically Induced
NCBI: 22234
Homologene: 37763
Rcan3
Name: regulator of calcineurin 3
Synonyms: Csp3, Dscr1l2
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 4
Alteration at locus: Chemically Induced
NCBI: 53902
HGNC: HGNC:3042
Homologene: 8388
Nckap1l
Name: NCK associated protein 1 like
Synonyms: Hem1, 4930568P13Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 15
Alteration at locus: Chemically Induced
NCBI: 105855
VEGA: 15
HGNC: HGNC:4862
Homologene: 3901
Kpna7
Name: karyopherin alpha 7 (importin alpha 8)
Synonyms: importin alpha 2, LOC381686
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 5
Alteration at locus: Chemically Induced
NCBI: 381686
Homologene: 73467
Pwwp2b
Name: PWWP domain containing 2B
Synonyms: D7Ertd517e, D930023J19Rik, Pwwp2
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 7
Alteration at locus: Chemically Induced
NCBI: 101631
Homologene: 19056
Adcy8
Name: adenylate cyclase 8
Synonyms: AC8
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 15
Alteration at locus: Chemically Induced
NCBI: 11514
VEGA: 15
HGNC: HGNC:239
Homologene: 37443
Ifit1bl2
Name: interferon induced protein with tetratricopeptide repeats 1B like 2
Synonyms: 2010002M12Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 19
Alteration at locus: Chemically Induced
NCBI: 112419
Homologene: 78213
Gprc6a
Name: G protein-coupled receptor, family C, group 6, member A
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 10
Alteration at locus: Chemically Induced
NCBI: 210198
VEGA: 10
Homologene: 17529
Fsip1
Name: fibrous sheath-interacting protein 1
Synonyms: 4933432K11Rik, 1700012M13Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 2
Alteration at locus: Chemically Induced
NCBI: 71313
Homologene: 12390
Muc5b
Name: mucin 5, subtype B, tracheobronchial
Synonyms: MUC5, MUC9, 2300002I04Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 7
Alteration at locus: Chemically Induced
NCBI: 74180
HGNC: HGNC:7516
Homologene: 136756
Ccdc180
Name: coiled-coil domain containing 180
Synonyms: LOC381522, E230008N13Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 4
Alteration at locus: Chemically Induced
NCBI: 381522
Homologene: 117988
Ttll9
Name: tubulin tyrosine ligase-like family, member 9
Synonyms: 1700016F23Rik, 4930509O20Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 2
Alteration at locus: Chemically Induced
NCBI: 74711
Homologene: 41769
Cacna1b
Name: calcium channel, voltage-dependent, N type, alpha 1B subunit
Synonyms: Cchn1a, Cav2.2, alpha(1B)
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 2
Alteration at locus: Chemically Induced
NCBI: 12287
HGNC: HGNC:1389
Homologene: 20184
Wnk4
Name: WNK lysine deficient protein kinase 4
Synonyms: Prkwnk4, 2010002J11Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 11
Alteration at locus: Chemically Induced
NCBI: 69847
Homologene: 13020
Gm7853
Name: predicted gene 7853
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 14
Alteration at locus: Chemically Induced
NCBI: 665933
Wdr91
Name: WD repeat domain 91
Synonyms: 9530020G05Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 6
Alteration at locus: Chemically Induced
NCBI: 101240
Homologene: 8562
Adgb
Name: androglobin
Synonyms: 9130014G24Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 10
Alteration at locus: Chemically Induced
NCBI: 215772
Homologene: 100289
Mppe1
Name: metallophosphoesterase 1
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 18
Alteration at locus: Chemically Induced
NCBI: 225651
VEGA: 18
Homologene: 41512
Crybg2
Name: crystallin beta-gamma domain containing 2
Synonyms: Aim1l
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 4
Alteration at locus: Chemically Induced
NCBI: 230806
Homologene: 19232
Ppp1r3c
Name: protein phosphatase 1, regulatory subunit 3C
Synonyms: protein targeting to glicogen, Ppp1r5, PTG
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 19
Alteration at locus: Chemically Induced
NCBI: 53412
VEGA: 19
HGNC: HGNC:9293
Homologene: 3938
Usp13
Name: ubiquitin specific peptidase 13 (isopeptidase T-3)
Synonyms: ISOT3, 2700071E21Rik, IsoT-3
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 3
Alteration at locus: Chemically Induced
NCBI: 72607
Homologene: 68372
Igsf9b
Name: immunoglobulin superfamily, member 9B
Synonyms: LOC235086
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 9
Alteration at locus: Chemically Induced
NCBI: 235086
Homologene: 19472
Vmn2r92
Name: vomeronasal 2, receptor 92
Synonyms: EG627111
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 17
Alteration at locus: Chemically Induced
NCBI: 627111
Homologene: 115024
Slc7a13
Name: solute carrier family 7, (cationic amino acid transporter, y+ system) member 13
Synonyms: AGT-1, 0610009O04Rik, XAT2, AGT1
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 4
Alteration at locus: Chemically Induced
NCBI: 74087
Homologene: 23656
Rgsl1
Name: regulator of G-protein signaling like 1
Synonyms: 4930415K13Rik, Rgsl2
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 1
Alteration at locus: Chemically Induced
NCBI: 240816
Homologene: 129962
Prpf19
Name: pre-mRNA processing factor 19
Synonyms: Snev, Prp19, D19Wsu55e, PSO4
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 19
Alteration at locus: Chemically Induced
NCBI: 28000
Homologene: 6421
Adam24
Name: a disintegrin and metallopeptidase domain 24 (testase 1)
Synonyms: Dtgn5
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 8
Alteration at locus: Chemically Induced
NCBI: 13526
HGNC: HGNC:203
Homologene: 137232
Tas2r104
Name: taste receptor, type 2, member 104
Synonyms: mt2r45, Tas2r4, T2R04, mGR04
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 6
Alteration at locus: Chemically Induced
NCBI: 387340
Homologene: 130072
Catsper3
Name: cation channel, sperm associated 3
Synonyms: 4921522D01Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 13
Alteration at locus: Chemically Induced
NCBI: 76856
Homologene: 12658
C9
Name: complement component 9
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 15
Alteration at locus: Chemically Induced
NCBI: 12279
HGNC: HGNC:1358
Homologene: 74406
Spata18
Name: spermatogenesis associated 18
Synonyms: 1700067I02Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 5
Alteration at locus: Chemically Induced
NCBI: 73472
Homologene: 17057
Sfxn4
Name: sideroflexin 4
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 19
Alteration at locus: Chemically Induced
NCBI: 94281
Homologene: 14228
Gpr182
Name: G protein-coupled receptor 182
Synonyms: NOW, Gpcr22, Admr, AM-R, G10-D, Gpcr17
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 10
Alteration at locus: Chemically Induced
NCBI: 11536
Homologene: 5255
Gja3
Name: gap junction protein, alpha 3
Synonyms: Cx46, Gja-3, alpha 3 connexin, connexin 46
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 14
Alteration at locus: Chemically Induced
NCBI: 14611
VEGA: 14
HGNC: HGNC:4277
Homologene: 9670
Vmn2r67
Name: vomeronasal 2, receptor 67
Synonyms: EG620672
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 7
Alteration at locus: Chemically Induced
NCBI: 620672
Homologene: 115466
Nek5
Name: NIMA (never in mitosis gene a)-related expressed kinase 5
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 8
Alteration at locus: Chemically Induced
NCBI: 330721
HGNC: HGNC:7748
Homologene: 87952
Lrrc69
Name: leucine rich repeat containing 69
Synonyms: 1700034K16Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 4
Alteration at locus: Chemically Induced
NCBI: 73314
Homologene: 78018
Adgrg7
Name: adhesion G protein-coupled receptor G7
Synonyms: 9130020O16Rik, Gpr128
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 16
Alteration at locus: Chemically Induced
NCBI: 239853
Homologene: 13115
Gykl1
Name: glycerol kinase-like 1
Synonyms: Gk-rs1
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 18
Alteration at locus: Chemically Induced
NCBI: 14625
VEGA: 18
HGNC: HGNC:4289
Homologene: 21848
Hist2h2ab
Name: histone cluster 2, H2ab
Synonyms: EG621893, H2a-613a
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 3
Alteration at locus: Chemically Induced
NCBI: 621893
Homologene: 111318
Gm4894
Name: predicted gene 4894
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 9
Alteration at locus: Chemically Induced
NCBI: 235327
VEGA: 9
Tnfrsf22
Name: tumor necrosis factor receptor superfamily, member 22
Synonyms: mDcTrailr2, C130035G06Rik, Tnfrh2, SOBa, 2810028K06Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 7
Alteration at locus: Chemically Induced
NCBI: 79202
Homologene: 84848
Zfp729b
Name: zinc finger protein 729b
Synonyms: AA987161
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 13
Alteration at locus: Chemically Induced
NCBI: 100416706
Homologene: 133713
Genetic Alterations
ENU-induced transitions at the following base pair locations (GRCm38):
  • T to C, chromosome 1 at 51,773,218 bp
  • A to G, chromosome 1 at 65,267,855 bp
  • C to A, chromosome 1 at 153,822,358 bp
  • T to A, chromosome 2 at 5,024,117 bp
  • A to G, chromosome 2 at 24,685,804 bp
  • C to A, chromosome 2 at 32,306,465 bp
  • T to C, chromosome 2 at 76,729,324 bp
  • A to G, chromosome 2 at 84,690,213 bp
  • T to C, chromosome 2 at 118,222,444 bp
  • A to G, chromosome 2 at 152,983,063 bp
  • G to A, chromosome 2 at 173,228,133 bp
  • A to G, chromosome 3 at 32,917,551 bp
  • T to G, chromosome 3 at 64,014,263 bp
  • A to T, chromosome 3 at 84,547,973 bp
  • T to C, chromosome 3 at 96,220,106 bp
  • T to C, chromosome 4 at 14,773,694 bp
  • A to G, chromosome 4 at 15,970,904 bp
  • A to T, chromosome 4 at 19,641,745 bp
  • T to C, chromosome 4 at 19,839,399 bp
  • G to T, chromosome 4 at 45,948,856 bp
  • C to T, chromosome 4 at 59,207,798 bp
  • TGGAGGAGGAGGAGGAGGAG to TGGAGGAGGAGGAGGAG, chromosome 4 at 134,074,526 bp
  • T to C, chromosome 4 at 135,425,377 bp
  • A to T, chromosome 5 at 73,666,901 bp
  • T to A, chromosome 5 at 108,193,852 bp
  • A to T, chromosome 5 at 144,989,697 bp
  • A to G, chromosome 6 at 34,908,330 bp
  • C to G, chromosome 6 at 90,583,186 bp
  • G to A, chromosome 6 at 131,685,132 bp
  • A to G, chromosome 7 at 55,830,881 bp
  • T to A, chromosome 7 at 56,357,155 bp
  • A to G, chromosome 7 at 76,433,378 bp
  • T to A, chromosome 7 at 85,152,042 bp
  • T to C, chromosome 7 at 98,054,910 bp
  • T to C, chromosome 7 at 139,255,188 bp
  • T to A, chromosome 7 at 141,861,644 bp
  • C to T, chromosome 7 at 143,644,776 bp
  • A to T, chromosome 8 at 22,113,632 bp
  • C to A, chromosome 8 at 33,571,237 bp
  • A to T, chromosome 8 at 40,680,365 bp
  • C to A, chromosome 8 at 69,102,759 bp
  • C to T, chromosome 8 at 94,304,191 bp
  • G to A, chromosome 8 at 121,978,685 bp
  • T to C, chromosome 9 at 27,333,496 bp
  • T to C, chromosome 9 at 49,274,190 bp
  • A to T, chromosome 10 at 10,436,051 bp
  • A to G, chromosome 10 at 51,626,795 bp
  • T to C, chromosome 10 at 80,904,392 bp
  • T to A, chromosome 10 at 127,750,141 bp
  • A to G, chromosome 10 at 128,488,341 bp
  • T to C, chromosome 11 at 49,169,118 bp
  • T to G, chromosome 11 at 67,308,348 bp
  • T to A, chromosome 11 at 89,016,621 bp
  • T to A, chromosome 11 at 101,275,641 bp
  • T to A, chromosome 12 at 3,366,671 bp
  • A to G, chromosome 13 at 55,808,054 bp
  • T to C, chromosome 13 at 67,595,265 bp
  • A to G, chromosome 14 at 36,089,527 bp
  • T to C, chromosome 14 at 57,036,714 bp
  • T to C, chromosome 15 at 6,445,420 bp
  • C to A, chromosome 15 at 64,822,207 bp
  • A to T, chromosome 15 at 66,674,011 bp
  • T to C, chromosome 15 at 99,174,453 bp
  • T to C, chromosome 15 at 100,809,299 bp
  • T to C, chromosome 15 at 103,455,934 bp
  • C to T, chromosome 16 at 56,752,403 bp
  • A to C, chromosome 17 at 18,167,392 bp
  • A to G, chromosome 17 at 45,407,846 bp
  • A to G, chromosome 17 at 58,932,412 bp
  • C to T, chromosome 17 at 83,451,056 bp
  • G to A, chromosome 18 at 34,430,329 bp
  • A to G, chromosome 18 at 52,695,267 bp
  • A to G, chromosome 18 at 60,832,177 bp
  • A to G, chromosome 18 at 67,228,011 bp
  • A to G, chromosome 19 at 10,897,598 bp
  • G to T, chromosome 19 at 34,619,230 bp
  • C to A, chromosome 19 at 36,733,698 bp
  • C to T, chromosome 19 at 60,851,020 bp
Genotype Determination
Phenotype
G1 male heterozygous mice are viable and fertile. The G1 mice were not characterized prior to archiving.
Strain Development
C57BL/6J mice were injected with ENU, resulting in G0 mice that were bred back to C57BL/6J. Sperm was archived from G1 male mice that produced viable G2 mice.
Suggested Control Mice
Wild-type littermates or C57BL/6J mice
Donor
Bruce Beutler, M.D., University of Texas Southwestern Medical Center.
Primary Reference
MUTAGENETIX record for R2229 (G1). B. Beutler and colleagues, Center for the Genetics of Host Defense, UT Southwestern, Dallas, TX.

Colony and Husbandry Information

Colony Surveillance Program and Current Health Reports

Mice recovered from a cryo-archive will have health surveillance performed on recipient females. Health reports will be provided prior to shipment. If you require additional health status information, please email mmrrc@missouri.edu .
Coat Color
Black
MMRRC Breeding System
Random intra-strain mating
Breeding Scheme(s)
When maintaining a live colony, heterozygous mice may be bred together, bred with wild-type siblings, or bred with C57BL/6J inbred mice.
Overall Breeding Performance
Undetermined; during development, mating was done with heterozygous males; viability, fertility and other breeding statistics for heterozygous females and homozygotes are unverified, but presumably would be similar to the C57BL/6J background strain
Average litter size
Undetermined
Recommended wean age
3 weeks

Order Request Information

Limited quantities of breeder mice (recovered litter) are available from a cryoarchive; recovered litter usually available to ship in 3 to 4 months.

Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

Distribution of this strain requires submission of the MMRRC Conditions of Use (COU). A link to the COU web form will be provided via email after an order has been placed; the form should be completed then or the email forwarded to your institutional official for completion.

The donor or their institution limits the distribution to non-profit institutions only.

Additional charges may apply for any special requests. Shipping costs are in addition to the basic distribution/resuscitation fees. Information on shipping costs and any additional charges will be provided by the supplying MMRRC facility.

Click button to Request this one strain. (Use the MMRRC Catalog Search to request more than one strain.)
MMRRC Item # Description Distribution Fee / Unit (US $) Units Notes
040230-MU-RESUS Litter recovered from cryo-archive $5,475.00 / Non-Profit Litter Recovered litter1; additional fees for any special requests.
Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

Some MMRRC strains were submitted by the donor as cryopreserved germplasm, and because these strains were not cryopreserved by the MMRRC, we have not assessed the quality of this material. We have extensive experience with recovery of mice from cryopreserved sperm and embryos of varying quality, including using techniques such as IVF and ICSI, and are confident that we will have success in most, if not all, cases. However, because of the unknown quality of these frozen samples, we will restrict recovery efforts to two attempts for each order. Subsequent attempts can be performed on a fee-for-service basis, in addition to the standard fees, upon request.

1 The distribution fee covers the expense of resuscitating mice from the cryo-archive; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

2 An aliquot is one straw or vial with sufficient sperm to recover at least one litter of mice, as per provided protocols, when performed at the MMRRC facility. The MMRRC makes no guarantee concerning the success of these procedures when performed outside the MMRRC facilities.

3 An aliquot contains a sufficient number of embryos (in one or more vials or straws and based on the transfer success rate of the MMRRC facility) to transfer into one to three recipients. The MMRRC makes no guarantee concerning embryo transfer success experienced in the recipient investigator's laboratory. Neither gender nor genotype ratios are guaranteed.

To request material from the MMRRC: Please fill out our on-line request form (accessible from the catalog search results page, or click the Request this Strain button in the fees section). If you have questions or need assistance completing this form, you may call Customer Service at (800) 910-2291 (in USA or Canada) or (530) 757-5710 (international calls). Before you call, please have with you: the MMRRC item number, quantity needed, Bill-to and Ship-to contact information.