Loading Mouse GIF
Loading...

Strain Name:
C57BL/6J-MtgxR2229Btlr/Mmmh
Stock Number:
040230-MU
Citation ID:
RRID:MMRRC_040230-MU
Other Names:
R2229 (G1), C57BL/6J-MtgxR2229Btlr
Major Collection:

Strain Information

Kif3c
Name: kinesin family member 3C
Synonyms: N-4 kinesin
Type: Gene
Species: Mouse
Chromosome: 12
NCBI: 16570
VEGA: 12
HGNC: HGNC:6321
Homologene: 55640
Aldh1l1
Name: aldehyde dehydrogenase 1 family, member L1
Synonyms: 1810048F20Rik, Fthfd
Type: Gene
Species: Mouse
Chromosome: 6
NCBI: 107747
HGNC: HGNC:3978
Homologene: 122031
Pmepa1
Name: prostate transmembrane protein, androgen induced 1
Synonyms: N4wbp4, 2210418I02Rik, PMEPA1, STAG1, Tmepai
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 65112
Homologene: 10608
Eml4
Name: echinoderm microtubule associated protein like 4
Synonyms: 4930443C24Rik
Type: Gene
Species: Mouse
Chromosome: 17
NCBI: 78798
VEGA: 17
HGNC: HGNC:1316
Homologene: 56841
Wwp1
Name: WW domain containing E3 ubiquitin protein ligase 1
Synonyms: SDRP1, Tiul1, AIP5, 8030445B08Rik
Type: Gene
Species: Mouse
Chromosome: 4
NCBI: 107568
Homologene: 21385
Gmps
Name: guanine monophosphate synthetase
Synonyms: Gm9479
Type: Gene
Species: Mouse
Chromosome: 3
NCBI: 229363
HGNC: HGNC:4378
Homologene: 68367
Nup93
Name: nucleoporin 93
Synonyms: 2410008G02Rik
Type: Gene
Species: Mouse
Chromosome: 8
NCBI: 71805
Homologene: 40971
Genetic Alterations
ENU-induced transitions at the following base pair locations (GRCm38):
  • T to C, chromosome 1 at 51,773,218 bp
  • A to G, chromosome 1 at 65,267,855 bp
  • C to A, chromosome 1 at 153,822,358 bp
  • T to A, chromosome 2 at 5,024,117 bp
  • A to G, chromosome 2 at 24,685,804 bp
  • C to A, chromosome 2 at 32,306,465 bp
  • T to C, chromosome 2 at 76,729,324 bp
  • A to G, chromosome 2 at 84,690,213 bp
  • T to C, chromosome 2 at 118,222,444 bp
  • A to G, chromosome 2 at 152,983,063 bp
  • G to A, chromosome 2 at 173,228,133 bp
  • A to G, chromosome 3 at 32,917,551 bp
  • T to G, chromosome 3 at 64,014,263 bp
  • A to T, chromosome 3 at 84,547,973 bp
  • T to C, chromosome 3 at 96,220,106 bp
  • T to C, chromosome 4 at 14,773,694 bp
  • A to G, chromosome 4 at 15,970,904 bp
  • A to T, chromosome 4 at 19,641,745 bp
  • T to C, chromosome 4 at 19,839,399 bp
  • G to T, chromosome 4 at 45,948,856 bp
  • C to T, chromosome 4 at 59,207,798 bp
  • TGGAGGAGGAGGAGGAGGAG to TGGAGGAGGAGGAGGAG, chromosome 4 at 134,074,526 bp
  • T to C, chromosome 4 at 135,425,377 bp
  • A to T, chromosome 5 at 73,666,901 bp
  • T to A, chromosome 5 at 108,193,852 bp
  • A to T, chromosome 5 at 144,989,697 bp
  • A to G, chromosome 6 at 34,908,330 bp
  • C to G, chromosome 6 at 90,583,186 bp
  • G to A, chromosome 6 at 131,685,132 bp
  • A to G, chromosome 7 at 55,830,881 bp
  • T to A, chromosome 7 at 56,357,155 bp
  • A to G, chromosome 7 at 76,433,378 bp
  • T to A, chromosome 7 at 85,152,042 bp
  • T to C, chromosome 7 at 98,054,910 bp
  • T to C, chromosome 7 at 139,255,188 bp
  • T to A, chromosome 7 at 141,861,644 bp
  • C to T, chromosome 7 at 143,644,776 bp
  • A to T, chromosome 8 at 22,113,632 bp
  • C to A, chromosome 8 at 33,571,237 bp
  • A to T, chromosome 8 at 40,680,365 bp
  • C to A, chromosome 8 at 69,102,759 bp
  • C to T, chromosome 8 at 94,304,191 bp
  • G to A, chromosome 8 at 121,978,685 bp
  • T to C, chromosome 9 at 27,333,496 bp
  • T to C, chromosome 9 at 49,274,190 bp
  • A to T, chromosome 10 at 10,436,051 bp
  • A to G, chromosome 10 at 51,626,795 bp
  • T to C, chromosome 10 at 80,904,392 bp
  • T to A, chromosome 10 at 127,750,141 bp
  • A to G, chromosome 10 at 128,488,341 bp
  • T to C, chromosome 11 at 49,169,118 bp
  • T to G, chromosome 11 at 67,308,348 bp
  • T to A, chromosome 11 at 89,016,621 bp
  • T to A, chromosome 11 at 101,275,641 bp
  • T to A, chromosome 12 at 3,366,671 bp
  • A to G, chromosome 13 at 55,808,054 bp
  • T to C, chromosome 13 at 67,595,265 bp
  • A to G, chromosome 14 at 36,089,527 bp
  • T to C, chromosome 14 at 57,036,714 bp
  • T to C, chromosome 15 at 6,445,420 bp
  • C to A, chromosome 15 at 64,822,207 bp
  • A to T, chromosome 15 at 66,674,011 bp
  • T to C, chromosome 15 at 99,174,453 bp
  • T to C, chromosome 15 at 100,809,299 bp
  • T to C, chromosome 15 at 103,455,934 bp
  • C to T, chromosome 16 at 56,752,403 bp
  • A to C, chromosome 17 at 18,167,392 bp
  • A to G, chromosome 17 at 45,407,846 bp
  • A to G, chromosome 17 at 58,932,412 bp
  • C to T, chromosome 17 at 83,451,056 bp
  • G to A, chromosome 18 at 34,430,329 bp
  • A to G, chromosome 18 at 52,695,267 bp
  • A to G, chromosome 18 at 60,832,177 bp
  • A to G, chromosome 18 at 67,228,011 bp
  • A to G, chromosome 19 at 10,897,598 bp
  • G to T, chromosome 19 at 34,619,230 bp
  • C to A, chromosome 19 at 36,733,698 bp
  • C to T, chromosome 19 at 60,851,020 bp
Genotype Determination
Phenotype
G1 male heterozygous mice are viable and fertile. The G1 mice were not characterized prior to archiving.
Strain GQC Summary
Gene Specific Genotyping:

To request gene-specific and other genotyping services for a strain, please contact the distribution MMRRC Center for more information.

Background Genetic Quality:

The MMRRC has developed a Genetic Quality Control pipeline using the MiniMUGA array to provide additional information to identify and validate genetic backgrounds of MMRRC strains. For more information on whether genetic background data is available, please contact MMRRC_GeneticQC@med.unc.edu. Note: that MiniMUGA genetic background data is not available on all strains, but can be ordered if desired.

Suggested Control Mice
Littermates of all relevant genotypes.
Submitter
Bruce Beutler, M.D., University of Texas Southwestern Medical Center.
Primary Reference
MUTAGENETIX record for R2229 (G1). B. Beutler and colleagues, Center for the Genetics of Host Defense, UT Southwestern, Dallas, TX.
Strain Development
C57BL/6J mice were injected with ENU, resulting in G0 mice that were bred back to C57BL/6J. Sperm was archived from G1 male mice that produced viable G2 mice.


Disclaimer: If MMRRC Strain Genetic Quality Control (GQC; based on MiniMUGA genotyping and analysis) has been completed for this strain, the information might differ from the genetic background information provided by the submitter. MiniMUGA genetic analysis is done on a strain’s tissue samples taken when archived by or ordered from the assigned MMRRC Center.

Colony and Husbandry Information

Colony Surveillance Program and Current Health Reports

Mice recovered from a cryo-archive will have health surveillance performed on recipient females. Health reports will be provided prior to shipment. If you require additional health status information, please email mmrrc@missouri.edu.
Coat Color
Black
MMRRC Breeding System
Random intra-strain mating
Breeding Scheme(s)
When maintaining a live colony, heterozygous mice may be bred together, bred with wild-type siblings, or bred with C57BL/6J inbred mice.
Overall Breeding Performance
Undetermined; during development, mating was done with heterozygous males; viability, fertility and other breeding statistics for heterozygous females and homozygotes are unverified, but presumably would be similar to the C57BL/6J background strain
Average litter size
Undetermined
Recommended wean age
3 weeks

Order Information

Limited quantities of breeder mice (recovered litter) are available from a cryoarchive; recovered litter usually available to ship in 3 to 4 months.

Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

Distribution of this strain requires submission of the MMRRC Conditions of Use (COU). A link to the COU web form will be provided via email after an order has been placed; the form should be completed then or the email forwarded to your institutional official for completion.

The submitter or their institution limits the distribution to non-profit institutions only.

Additional charges may apply for any special requests. Shipping costs are in addition to the basic distribution/resuscitation fees. Information on shipping costs and any additional charges will be provided by the supplying MMRRC facility.

Click button to Request this one strain. (Use the MMRRC Catalog Search to request more than one strain.)
MMRRC Item # Description Distribution Fee / Unit (US $)
*Shipping & Handling not included*
Units Notes
040230-MU-RESUS Litter recovered from cryo-archive $5,475.00 / Non-Profit Litter Recovered litter4; additional fees for any special requests.
Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

Some MMRRC strains were submitted by the submitter as cryopreserved germplasm, and because these strains were not cryopreserved by the MMRRC, we have not assessed the quality, nor genotype, of this material. Our expertise in reviving mice from various qualities of frozen sperm and embryos, using methods like IVF and ICSI, gives us confidence in successful recoveries in most cases. However, due to the uncertain quality of these samples, we'll limit revival attempts to two per order. Additional attempts are available for a fee, on top of standard charges, if requested. It's important to note that some strains may lack the expected mutation, so we can't assure successful order fulfillment until we attempt to revive the strain.

1 The distribution fee covers the expense of rederiving mice from a live mouse; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

2 An aliquot contains a sufficient number of embryos (in one or more vials or straws and based on the transfer success rate of the MMRRC facility) to transfer into one to three recipients. The MMRRC makes no guarantee concerning embryo transfer success experienced in the recipient investigator's laboratory. Neither gender nor genotype ratios are guaranteed.

3 An aliquot is one straw or vial with sufficient sperm to recover at least one litter of mice, as per provided protocols, when performed at the MMRRC facility. The MMRRC makes no guarantee concerning the success of these procedures when performed outside the MMRRC facilities.

4 The distribution fee covers the expense of resuscitating mice from the cryo-archive; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

To request material from the MMRRC: Please fill out our on-line request form (accessible from the catalog search results page, or click the Request this Strain button in the fees section). If you have questions or need assistance completing this form, you may call Customer Service at (800) 910-2291 (in USA or Canada) or (530) 757-5710 (international calls). Before you call, please have with you: the MMRRC item number, quantity needed, Bill-to and Ship-to contact information.