Strain Name:
C57BL/6J-MtgxR2242Btlr/Mmmh
Stock Number:
040242-MU
Citation ID:
RRID:MMRRC_040242-MU
Other Names:
R2242 (G1), C57BL/6J-MtgxR2242Btlr
Major Collection:

Gene Information

Zic4
Name: zinc finger protein of the cerebellum 4
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 9
NCBI: 22774
Homologene: 32075
Dysf
Name: dysferlin
Synonyms: 2310004N10Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 6
NCBI: 26903
HGNC: HGNC:3097
Homologene: 20748
Jarid2
Name: jumonji, AT rich interactive domain 2
Synonyms: jumonji, Jmj
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 13
NCBI: 16468
HGNC: HGNC:6196
Homologene: 31279
Wdr47
Name: WD repeat domain 47
Synonyms: 1810073M12Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 3
NCBI: 99512
Homologene: 8984
Slc37a3
Name: solute carrier family 37 (glycerol-3-phosphate transporter), member 3
Synonyms: 2610507O21Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 6
NCBI: 72144
Homologene: 41740
Washc2
Name: WASH complex subunit 2`
Synonyms: Fam21, C530005J20Rik, D6Wsu116e
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 6
NCBI: 28006
Homologene: 41686
Dctn1
Name: dynactin 1
Synonyms: p150, p150glued, Glued
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 6
NCBI: 13191
HGNC: HGNC:2711
Homologene: 3011
Clca2
Name: chloride channel accessory 2
Synonyms: Clca5
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 3
NCBI: 229933
HGNC: HGNC:2016
Homologene: 4765
Ripor2
Name: RHO family interacting cell polarization regulator 2
Synonyms: Fam65b, 1700108N18Rik, 6330500D04Rik, E430013J17Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 13
NCBI: 193385
Homologene: 9284
Gpc6
Name: glypican 6
Synonyms: 6720429C22Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 14
NCBI: 23888
HGNC: HGNC:4454
Homologene: 55922
Dync2h1
Name: dynein cytoplasmic 2 heavy chain 1
Synonyms: Dnchc2, D030010H02Rik, b2b414Clo, D330044F14Rik, 4432416O06Rik, m152Asp, DHC1b, DHC2, m407Asp
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 9
NCBI: 110350
HGNC: HGNC:2962
Homologene: 14468
Cdc20
Name: cell division cycle 20
Synonyms: p55CDC, 2310042N09Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 4
NCBI: 107995
HGNC: HGNC:1723
Homologene: 37459
Col4a3
Name: collagen, type IV, alpha 3
Synonyms: tumstatin, alpha3(IV)
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 1
NCBI: 12828
HGNC: HGNC:2204
Homologene: 68033
Eif1ad
Name: eukaryotic translation initiation factor 1A domain containing
Synonyms: 2010003J03Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 19
NCBI: 69860
VEGA: 19
Homologene: 41860
Ftsj3
Name: FtsJ RNA methyltransferase homolog 3 (E. coli)
Synonyms: Epcs3, C79843, D11Ertd400e
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 11
NCBI: 56095
Homologene: 5451
Lama4
Name: laminin, alpha 4
Synonyms: laminin [a]4
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 10
NCBI: 16775
HGNC: HGNC:6484
Homologene: 37604
Hivep2
Name: human immunodeficiency virus type I enhancer binding protein 2
Synonyms: Gm20114, Schnurri-2, Shn-2, MIBP1
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 10
NCBI: 15273
HGNC: HGNC:4921
Homologene: 4900
Vmn2r57
Name: vomeronasal 2, receptor 57
Synonyms: EG269902
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 7
NCBI: 269902
Homologene: 104832
Mfsd6
Name: major facilitator superfamily domain containing 6
Synonyms: 9630025I22Rik, 2210010L05Rik, MMR2
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 1
NCBI: 98682
Homologene: 9784
Adcy2
Name: adenylate cyclase 2
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 13
NCBI: 210044
VEGA: 13
HGNC: HGNC:233
Homologene: 75133
Olfr273
Name: olfactory receptor 273
Synonyms: MOR262-8, GA_x6K02T2N78B-7137430-7138383
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 4
NCBI: 258821
Homologene: 73999
Corin
Name: corin, serine peptidase
Synonyms: Lrp4
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 5
NCBI: 53419
Homologene: 4804
Afap1l2
Name: actin filament associated protein 1-like 2
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 19
NCBI: 226250
Homologene: 13057
Fes
Name: feline sarcoma oncogene
Synonyms: c-fes
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 7
NCBI: 14159
HGNC: HGNC:3657
Homologene: 37563
Ofcc1
Name: orofacial cleft 1 candidate 1
Synonyms: ojoplano, Opo
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 13
NCBI: 218165
VEGA: 13
Homologene: 125376
Sardh
Name: sarcosine dehydrogenase
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 2
NCBI: 192166
Homologene: 5149
Duoxa1
Name: dual oxidase maturation factor 1
Synonyms: Nip1
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 2
NCBI: 213696
Homologene: 16043
Olfr133
Name: olfactory receptor 133
Synonyms: MOR256-6, GA_x6K02T2PSCP-2597192-2598130
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 17
NCBI: 258828
Homologene: 110603
Gm13318
Name: predicted gene 13318
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 2
C2cd6
Name: C2 calcium dependent domain containing 6
Synonyms: Gm33589, Als2cr11, 1700052H20Rik, C2cd6b, Als2cr11b, 4930408G06Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 1
NCBI: 102636554
Homologene: 134310
Genetic Alterations
ENU-induced transitions at the following base pair locations (GRCm38):
  • G to T, chromosome 1 at 52,709,598 bp
  • T to C, chromosome 1 at 59,062,542 bp
  • T to A, chromosome 1 at 82,717,830 bp
  • T to C, chromosome 2 at 16,101,944 bp
  • A to T, chromosome 2 at 27,235,515 bp
  • A to G, chromosome 2 at 122,306,380 bp
  • A to G, chromosome 3 at 108,619,115 bp
  • T to C, chromosome 3 at 145,090,790 bp
  • A to G, chromosome 4 at 52,855,769 bp
  • A to G, chromosome 4 at 118,433,525 bp
  • A to T, chromosome 5 at 72,332,711 bp
  • A to G, chromosome 6 at 39,338,805 bp
  • A to G, chromosome 6 at 83,199,705 bp
  • G to A, chromosome 6 at 84,186,509 bp
  • T to A, chromosome 6 at 116,231,632 bp
  • T to C, chromosome 7 at 41,428,074 bp
  • T to G, chromosome 7 at 80,381,725 bp
  • A to T, chromosome 9 at 7,037,828 bp
  • C to T, chromosome 9 at 91,378,653 bp
  • C to A, chromosome 10 at 14,128,969 bp
  • G to A, chromosome 10 at 39,026,693 bp
  • T to A, chromosome 11 at 106,250,778 bp
  • A to G, chromosome 13 at 24,671,772 bp
  • A to G, chromosome 13 at 40,142,787 bp
  • T to A, chromosome 13 at 44,906,276 bp
  • A to T, chromosome 13 at 68,689,341 bp
  • A to T, chromosome 14 at 117,186,787 bp
  • A to G, chromosome 17 at 38,148,722 bp
  • CGAGGAGGAGGAGGAGGAGG to CGAGGAGGAGGAGGAGG, chromosome 19 at 5,370,058 bp
  • T to C, chromosome 19 at 56,914,468 bp
Genotype Determination
Phenotype
G1 male heterozygous mice are viable and fertile. The G1 mice were not characterized prior to archiving.
Strain Development
C57BL/6J mice were injected with ENU, resulting in G0 mice that were bred back to C57BL/6J. Sperm was archived from G1 male mice that produced viable G2 mice.
Suggested Control Mice
Wild-type littermates or C57BL/6J mice
Donor
Bruce Beutler, M.D., University of Texas Southwestern Medical Center.
Primary Reference
MUTAGENETIX record for R2242 (G1). B. Beutler and colleagues, Center for the Genetics of Host Defense, UT Southwestern, Dallas, TX.

Colony and Husbandry Information

Colony Surveillance Program and Current Health Reports

Mice recovered from a cryo-archive will have health surveillance performed on recipient females. Health reports will be provided prior to shipment. If you require additional health status information, please email mmrrc@missouri.edu .
Coat Color
Black
MMRRC Breeding System
Random intra-strain mating
Breeding Scheme(s)
When maintaining a live colony, heterozygous mice may be bred together, bred with wild-type siblings, or bred with C57BL/6J inbred mice.
Overall Breeding Performance
Undetermined; during development, mating was done with heterozygous males; viability, fertility and other breeding statistics for heterozygous females and homozygotes are unverified, but presumably would be similar to the C57BL/6J background strain
Average litter size
Undetermined
Recommended wean age
3 weeks

Order Request Information

Limited quantities of breeder mice (recovered litter) are available from a cryoarchive; recovered litter usually available to ship in 3 to 4 months.

Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

Distribution of this strain requires submission of the MMRRC Conditions of Use (COU). A link to the COU web form will be provided via email after an order has been placed; the form should be completed then or the email forwarded to your institutional official for completion.

The donor or their institution limits the distribution to non-profit institutions only.

Additional charges may apply for any special requests. Shipping costs are in addition to the basic distribution/resuscitation fees. Information on shipping costs and any additional charges will be provided by the supplying MMRRC facility.

Click button to Request this one strain. (Use the MMRRC Catalog Search to request more than one strain.)
MMRRC Item # Description Distribution Fee / Unit (US $) Units Notes
040242-MU-RESUS Litter recovered from cryo-archive $5,475.00 / Non-Profit Litter Recovered litter4; additional fees for any special requests.
Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

Some MMRRC strains were submitted by the donor as cryopreserved germplasm, and because these strains were not cryopreserved by the MMRRC, we have not assessed the quality of this material. We have extensive experience with recovery of mice from cryopreserved sperm and embryos of varying quality, including using techniques such as IVF and ICSI, and are confident that we will have success in most, if not all, cases. However, because of the unknown quality of these frozen samples, we will restrict recovery efforts to two attempts for each order. Subsequent attempts can be performed on a fee-for-service basis, in addition to the standard fees, upon request.

1 The distribution fee covers the expense of rederiving mice from a live mouse; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

2 An aliquot contains a sufficient number of embryos (in one or more vials or straws and based on the transfer success rate of the MMRRC facility) to transfer into one to three recipients. The MMRRC makes no guarantee concerning embryo transfer success experienced in the recipient investigator's laboratory. Neither gender nor genotype ratios are guaranteed.

3 An aliquot is one straw or vial with sufficient sperm to recover at least one litter of mice, as per provided protocols, when performed at the MMRRC facility. The MMRRC makes no guarantee concerning the success of these procedures when performed outside the MMRRC facilities.

4 The distribution fee covers the expense of resuscitating mice from the cryo-archive; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

To request material from the MMRRC: Please fill out our on-line request form (accessible from the catalog search results page, or click the Request this Strain button in the fees section). If you have questions or need assistance completing this form, you may call Customer Service at (800) 910-2291 (in USA or Canada) or (530) 757-5710 (international calls). Before you call, please have with you: the MMRRC item number, quantity needed, Bill-to and Ship-to contact information.