Strain Name:
Stock Number:
Citation ID:
Other Names:
R2265 (G1), C57BL/6J-MtgxR2265Btlr
Major Collection:

Gene Information

Name: valosin containing protein
Synonyms: CDC48, p97/VCP, AAA ATPase p97, p97
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 4
NCBI: 269523
Homologene: 5168
Name: COP9 signalosome subunit 3
Synonyms: Sgn3, Csn3, COP9 complex S3
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 11
NCBI: 26572
Homologene: 2710
Name: N-terminal Xaa-Pro-Lys N-methyltransferase 1
Synonyms: Mettl11a, 2610205E22Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 2
NCBI: 66617
Homologene: 5439
Name: regulator of telomere elongation helicase 1
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 2
NCBI: 269400
Homologene: 13168
Name: pericentriolar material 1
Synonyms: 9430077F19Rik, C030044G17Rik, 2600002H09Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 8
NCBI: 18536
Homologene: 4518
Name: vacuolar protein sorting 13C
Synonyms: C230055H22Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 9
NCBI: 320528
Homologene: 41188
Name: MYC binding protein 2, E3 ubiquitin protein ligase
Synonyms: Pam, Phr1, C130061D10Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 14
NCBI: 105689
Homologene: 9005
Name: agrin
Synonyms: nmf380, Agrin, NMF380
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 4
NCBI: 11603
Homologene: 27907
Name: centrosomal protein 41
Synonyms: Cep41, 1700017E11Rik, Tsga14, 2810431D15Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 6
NCBI: 83922
Homologene: 10284
Name: DEAD box helicase 4
Synonyms: DEAD (Asp-Glu-Ala-Asp) box polypeptide 4, mvh / m'vasa, Mvh, VASA
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 13
NCBI: 13206
VEGA: 13
Homologene: 49227
Name: zinc finger protein 280D
Synonyms: Suhw4
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 9
NCBI: 235469
Homologene: 17151
Name: protein phosphatase 1, regulatory subunit 12A
Synonyms: 5730577I22Rik, Mypt1, 1200015F06Rik, D10Ertd625e
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 10
NCBI: 17931
VEGA: 10
Homologene: 1855
Name: HEAT repeat containing 5A
Synonyms: D930036F22Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 12
NCBI: 320487
VEGA: 12
Homologene: 19635
Name: PHD finger protein 8
Synonyms: 9830141C09Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: X
NCBI: 320595
Homologene: 49405
Name: apolipoprotein B
Synonyms: apob-100, apob-48
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 12
NCBI: 238055
Homologene: 328
Name: SPG11, spatacsin vesicle trafficking associated
Synonyms: spastic paraplegia 11, 6030465E24Rik, C530005A01Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 2
NCBI: 214585
Homologene: 41614
Name: serine and arginine-rich splicing factor 4
Synonyms: MNCb-2616, 5730499P16Rik, SRp75, Sfrs4
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 4
NCBI: 57317
Homologene: 25624
Name: centromere protein E
Synonyms: N-7 kinesin, CENP-E, 312kDa, Kif10
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 3
NCBI: 229841
Homologene: 20429
Name: multiple PDZ domain crumbs cell polarity complex component
Synonyms: B930003D11Rik, MUPP1, multiple PDZ domain protein
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 4
NCBI: 17475
Homologene: 2841
Name: forkhead box O1
Synonyms: Fkhr1, Afxh, Foxo1a, FKHR
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 3
NCBI: 56458
Homologene: 1527
Name: exosome component 1
Synonyms: 2610104C07Rik, 2610312F07Rik, 2610035C18Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 19
NCBI: 66583
VEGA: 19
Homologene: 9359
Name: membrane associated guanylate kinase, WW and PDZ domain containing 3
Synonyms: 6530407C02Rik, 4732496O19Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 3
NCBI: 99470
Homologene: 26431
Name: debranching RNA lariats 1
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 9
NCBI: 83703
Homologene: 9428
Name: solute carrier family 38, member 6
Synonyms: EG625098
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 12
NCBI: 625098
Homologene: 27550
Name: ATP-binding cassette, sub-family A (ABC1), member 16
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 7
NCBI: 233810
Homologene: 132942
Name: nuclear receptor subfamily 4, group A, member 2
Synonyms: RNR-1, Nurr1, HZF-3
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 2
NCBI: 18227
Homologene: 4509
Name: laminin, alpha 2
Synonyms: merosin, mer
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 10
NCBI: 16773
Homologene: 37306
Name: maestro heat-like repeat family member 7
Synonyms: Gm1027, Heatr8, LOC381538
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 4
NCBI: 381538
Homologene: 19633
Name: delta/notch-like EGF repeat containing
Synonyms: BET, A930026D19Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 1
NCBI: 227325
Homologene: 26722
Name: sodium leak channel, non-selective
Synonyms: Vgcnl1, A530023G15Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 14
NCBI: 338370
VEGA: 14
Homologene: 21832
Name: dedicator of cyto-kinesis 3
Synonyms: Moca, PBP
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 9
NCBI: 208869
Homologene: 21030
Name: RAD9 checkpoint clamp component B
Synonyms: A630082N15Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 5
NCBI: 231724
Homologene: 17006
Name: aldehyde oxidase 1
Synonyms: Aox-1, retinal oxidase, Aox2, Aox-2
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 1
NCBI: 11761
Homologene: 68165
Name: tetratricopeptide repeat domain 21A
Synonyms: Thm2, 4921538N17Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 9
NCBI: 74052
Homologene: 14728
Name: diacylglycerol kinase, beta
Synonyms: C630029D13Rik, DGK-beta
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 12
NCBI: 217480
VEGA: 12
Homologene: 37875
Name: integrin alpha L
Synonyms: LFA-1, Ly-15, Cd11a, Ly-21
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 7
NCBI: 16408
Homologene: 1666
Name: immunoglobulin kappa variable 1-115
Synonyms: Gm6854
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 6
NCBI: 628206
Name: adrenergic receptor, alpha 2b
Synonyms: Adra-2b, alpha2B, a2b-AR, [a]2B
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 2
NCBI: 11552
Homologene: 553
Name: ArfGAP with GTPase domain, ankyrin repeat and PH domain 2
Synonyms: Centg1
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 10
NCBI: 216439
VEGA: 10
Homologene: 86815
Name: vomeronasal 2, receptor 18
Synonyms: EG632671
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 5
NCBI: 632671
Name: potassium voltage-gated channel, subfamily H (eag-related), member 6
Synonyms: m-erg2
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 11
NCBI: 192775
Homologene: 32740
Name: purinergic receptor P2Y, G-protein coupled, 14
Synonyms: P2Y14, Gpr105, A330108O13Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 3
NCBI: 140795
Homologene: 15769
Name: sperm associated antigen 17
Synonyms: 4931427F14Rik, PF6
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 3
NCBI: 74362
Homologene: 52601
Name: solute carrier family 6 (neurotransmitter transporter), member 19
Synonyms: 4632401C08Rik, B0AT1
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 13
NCBI: 74338
Homologene: 52819
Name: phospholipase C, eta 2
Synonyms: A930027K05Rik, Plcl4, PLCeta2
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 4
NCBI: 269615
Homologene: 85172
Name: collagen, type XVI, alpha 1
Synonyms: 2700007F12Rik, [a]1 (XVI) collagen, A530052M23Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 4
NCBI: 107581
Homologene: 1397
Name: RAN binding protein 3-like
Synonyms: C130037N17Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 15
NCBI: 223332
VEGA: 15
Homologene: 35407
Name: kallikrein 1-related peptidase b21
Synonyms: mGk-21, Klk21
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 7
NCBI: 16616
Homologene: 68141
Name: protocadherin beta 19
Synonyms: Pcdhb11, PcdhbS
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 18
NCBI: 93890
Homologene: 128411
Name: myosin binding protein H-like
Synonyms: 1110037P11Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 3
NCBI: 68753
Homologene: 19221
Name: a disintegrin and metallopeptidase domain 24 (testase 1)
Synonyms: Dtgn5
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 8
NCBI: 13526
Homologene: 137232
Name: zinc finger protein 616
Synonyms: Gm12330
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 11
NCBI: 327963
Homologene: 88945
Name: asparagine-linked glycosylation 11 (alpha-1,2-mannosyltransferase)
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 8
NCBI: 207958
Homologene: 68893
Name: mannose receptor, C type 2
Synonyms: Endo180, uPARAP, novel lectin
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 11
NCBI: 17534
Homologene: 4408
Name: myosin XVIIIb
Synonyms: 4933411E19Rik, 4932408L24Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 5
NCBI: 74376
Homologene: 53435
Name: leukocyte immunoglobulin-like receptor, subfamily B, member 4A
Synonyms: ILT3, Lilrb4, Gp49b, HM18, CD85K
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 10
NCBI: 14728
VEGA: 10
Homologene: 86756
Name: Kv channel interacting protein 3, calsenilin
Synonyms: DREAM, 4933407H12Rik, Csen, R74849, KChIP3
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 2
NCBI: 56461
Homologene: 8382
Name: potassium voltage-gated channel, subfamily H (eag-related), member 8
Synonyms: Kv12.1, C130090D05Rik, ELK1
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 17
NCBI: 211468
Homologene: 14332
Name: olfactory receptor family 4 subfamily F member 54
Synonyms: Olfr1278, GA_x6K02T2Q125-72343713-72344654, MOR245-11
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 2
NCBI: 258389
Homologene: 74061
Name: RIKEN cDNA A830018L16 gene
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 1
NCBI: 320492
Homologene: 14194
Name: purinergic receptor P2Y, G-protein coupled 13
Synonyms: Gpr86, P2Y13, SP174, 2010001L06Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 3
NCBI: 74191
Homologene: 12543
Name: taste receptor, type 2, member 117
Synonyms: T2R17, mt2r54, Tas2r17, mGR17
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 6
NCBI: 353166
Homologene: 130073
Name: arylacetamide deacetylase
Synonyms: Aada, 5033417E09Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 3
NCBI: 67758
Homologene: 37436
Name: F-box and WD-40 domain protein 22
Synonyms: Gm5164
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 9
NCBI: 382156
Homologene: 110776
Name: olfactory receptor family 8 subfamily K member 28
Synonyms: Olfr1066, MOR256-52P, GA_x6K02T2Q125-47925557-47924616, MOR188-8
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 2
NCBI: 257880
Homologene: 79468
Name: kelch-like 31
Synonyms: D930047P17Rik, Kbtbd1, 9830147P19Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 9
NCBI: 244923
Homologene: 27819
Name: ovochymase 2
Synonyms: 9230106D23Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 7
NCBI: 244199
Homologene: 18255
Name: olfactory receptor family 10 subfamily AK member 16
Synonyms: MOR259-8, Olfr1330, GA_x6K02T2QD9B-18644371-18643424
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 4
NCBI: 258331
Homologene: 121524
Name: cell division cycle associated 7
Synonyms: JPO1, 2310021G01Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 2
NCBI: 66953
Homologene: 49970
Name: toll-like receptor 5
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 1
NCBI: 53791
Homologene: 20698
Name: bradykinin receptor, beta 2
Synonyms: B(2), BK2R, kinin B2, B2R, B2
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 12
NCBI: 12062
VEGA: 12
Homologene: 519
Name: heat shock protein 2
Synonyms: Hsp70-2, 70kDa
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 12
NCBI: 15512
VEGA: 12
Homologene: 68564
Name: vasohibin 2
Synonyms: B130052G07Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 1
NCBI: 226841
Homologene: 57005
Name: cathepsin M
Synonyms: 1600027J17Rik, Catm, Cat M
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 13
NCBI: 64139
VEGA: 13
Homologene: 75181
Name: killer cell immunoglobulin-like receptor, three domains, long cytoplasmic tail, 1
Synonyms: Kirl1
Type: Gene
Species: Mus musculus (mouse)
Chromosome: X
NCBI: 245616
Homologene: 77448
Name: divergent protein kinase domain 2B
Synonyms: 4930578C19Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: X
NCBI: 75905
Homologene: 23469
Name: olfactory receptor family 51 subfamily F member 1D
Synonyms: GA_x6K02T2PBJ9-5762668-5763618, Olfr583, MOR14-6
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 7
NCBI: 258752
Homologene: 133721
Name: NCK interacting protein with SH3 domain
Synonyms: AF3P21, ORF1, WISH, SPIN90, Wasbp, DIP1
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 9
NCBI: 80987
Homologene: 9514
Name: trace amine-associated receptor 8B
Synonyms: LOC382348
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 10
NCBI: 382348
Homologene: 77586
Name: olfactory receptor family 52 subfamily N member 20
Synonyms: MOR34-4, GA_x6K02T2PBJ9-7298889-7299857, Olfr659
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 7
NCBI: 259052
Homologene: 74118
Name: DnaJ heat shock protein family (Hsp40) member C28
Synonyms: ORF28
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 16
NCBI: 246738
Homologene: 9869
Name: leucine-rich single-pass membrane protein 1
Synonyms: LOC380755, Gm889
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 12
NCBI: 380755
VEGA: 12
Homologene: 18800
Name: solute carrier family 35 (UDP-N-acetylglucosamine (UDP-GlcNAc) transporter), member 3
Synonyms: 2310050P13Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 3
NCBI: 229782
Homologene: 40826
Name: olfactory receptor family 2 subfamily M member 12
Synonyms: MOR279-2, GA_x54KRFPKG5P-15738260-15737319, Olfr164
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 16
NCBI: 258443
Homologene: 51725
Name: pejvakin
Synonyms: LOC381375, Dfnb59, pejvakin
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 2
NCBI: 381375
Homologene: 19773
Name: IMP4, U3 small nucleolar ribonucleoprotein
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 1
NCBI: 27993
Homologene: 68891
Genetic Alterations
ENU-induced transitions at the following base pair locations (GRCm38):
  • T to C, chromosome 1 at 11,972,104 bp
  • T to A, chromosome 1 at 34,443,847 bp
  • C to A, chromosome 1 at 58,081,520 bp
  • T to A, chromosome 1 at 182,975,035 bp
  • T to C, chromosome 1 at 190,950,213 bp
  • C to A, chromosome 2 at 30,820,460 bp
  • T to A, chromosome 2 at 57,112,006 bp
  • T to C, chromosome 2 at 72,482,490 bp
  • T to G, chromosome 2 at 76,657,453 bp
  • T to C, chromosome 2 at 86,456,214 bp
  • A to G, chromosome 2 at 111,293,179 bp
  • A to T, chromosome 2 at 122,108,307 bp
  • T to C, chromosome 2 at 127,363,871 bp
  • G to T, chromosome 2 at 127,465,061 bp
  • T to A, chromosome 2 at 181,354,368 bp
  • T to C, chromosome 3 at 52,345,912 bp
  • T to C, chromosome 3 at 59,115,571 bp
  • T to C, chromosome 3 at 59,210,028 bp
  • T to A, chromosome 3 at 60,037,316 bp
  • C to A, chromosome 3 at 100,061,866 bp
  • G to A, chromosome 3 at 104,021,066 bp
  • A to G, chromosome 3 at 108,365,001 bp
  • T to C, chromosome 3 at 116,673,636 bp
  • A to G, chromosome 3 at 135,261,636 bp
  • G to A, chromosome 4 at 42,980,833 bp
  • A to G, chromosome 4 at 81,383,391 bp
  • T to C, chromosome 4 at 106,720,927 bp
  • A to T, chromosome 4 at 118,893,874 bp
  • C to A, chromosome 4 at 130,052,918 bp
  • T to C, chromosome 4 at 131,897,682 bp
  • T to C, chromosome 4 at 154,993,004 bp
  • C to T, chromosome 4 at 156,179,218 bp
  • A to G, chromosome 5 at 112,782,673 bp
  • T to C, chromosome 5 at 122,351,342 bp
  • T to C, chromosome 5 at 151,586,662 bp
  • T to A, chromosome 6 at 30,660,916 bp
  • T to G, chromosome 6 at 68,161,422 bp
  • T to A, chromosome 6 at 132,803,225 bp
  • T to C, chromosome 7 at 44,104,439 bp
  • G to A, chromosome 7 at 103,052,137 bp
  • T to C, chromosome 7 at 104,670,860 bp
  • A to T, chromosome 7 at 107,784,575 bp
  • A to G, chromosome 7 at 120,431,160 bp
  • A to G, chromosome 7 at 127,306,701 bp
  • T to A, chromosome 8 at 22,065,614 bp
  • T to A, chromosome 8 at 40,680,071 bp
  • T to C, chromosome 8 at 41,312,144 bp
  • T to C, chromosome 9 at 67,920,947 bp
  • C to A, chromosome 9 at 72,301,770 bp
  • A to G, chromosome 9 at 77,650,158 bp
  • G to A, chromosome 9 at 99,579,410 bp
  • C to A, chromosome 9 at 106,941,326 bp
  • C to A, chromosome 9 at 108,812,216 bp
  • C to T, chromosome 9 at 109,383,994 bp
  • G to T, chromosome 9 at 119,959,008 bp
  • T to C, chromosome 10 at 24,091,372 bp
  • T to A, chromosome 10 at 26,992,936 bp
  • T to A, chromosome 10 at 51,491,537 bp
  • T to A, chromosome 10 at 108,240,878 bp
  • T to A, chromosome 10 at 127,082,428 bp
  • T to C, chromosome 11 at 59,827,890 bp
  • T to C, chromosome 11 at 74,085,463 bp
  • G to A, chromosome 11 at 105,348,431 bp
  • G to A, chromosome 11 at 106,033,817 bp
  • T to C, chromosome 12 at 8,015,475 bp
  • T to A, chromosome 12 at 38,190,108 bp
  • T to C, chromosome 12 at 51,893,745 bp
  • T to A, chromosome 12 at 73,344,784 bp
  • T to G, chromosome 12 at 76,406,188 bp
  • A to G, chromosome 12 at 105,592,225 bp
  • T to C, chromosome 13 at 61,539,542 bp
  • A to G, chromosome 13 at 73,682,167 bp
  • A to G, chromosome 13 at 112,621,276 bp
  • T to C, chromosome 14 at 103,262,749 bp
  • A to G, chromosome 14 at 123,596,663 bp
  • A to T, chromosome 15 at 9,057,113 bp
  • A to G, chromosome 16 at 19,286,555 bp
  • T to C, chromosome 16 at 91,616,312 bp
  • GAGACCAACGAGCAGCTGATGCTTCAGA to GAGA, chromosome 17 at 52,725,906 bp
  • A to T, chromosome 18 at 37,497,683 bp
  • A to G, chromosome 19 at 41,931,418 bp
  • A to G, chromosome X at 18,423,687 bp
  • A to G, chromosome X at 136,525,035 bp
  • T to C, chromosome X at 151,572,601 bp
Genotype Determination
G1 male heterozygous mice are viable and fertile. The G1 mice were not characterized prior to archiving.
Strain Development
C57BL/6J mice were injected with ENU, resulting in G0 mice that were bred back to C57BL/6J. Sperm was archived from G1 male mice that produced viable G2 mice.
Suggested Control Mice
Wild-type littermates or C57BL/6J mice
Bruce Beutler, M.D., University of Texas Southwestern Medical Center.
Primary Reference
MUTAGENETIX record for R2265 (G1). B. Beutler and colleagues, Center for the Genetics of Host Defense, UT Southwestern, Dallas, TX.

Colony and Husbandry Information

Colony Surveillance Program and Current Health Reports

Mice recovered from a cryo-archive will have health surveillance performed on recipient females. Health reports will be provided prior to shipment. If you require additional health status information, please email .
Coat Color
MMRRC Breeding System
Random intra-strain mating
Breeding Scheme(s)
When maintaining a live colony, heterozygous mice may be bred together, bred with wild-type siblings, or bred with C57BL/6J inbred mice.
Overall Breeding Performance
Undetermined; during development, mating was done with heterozygous males; viability, fertility and other breeding statistics for heterozygous females and homozygotes are unverified, but presumably would be similar to the C57BL/6J background strain
Average litter size
Recommended wean age
3 weeks

Order Request Information

Limited quantities of breeder mice (recovered litter) are available from a cryoarchive; recovered litter usually available to ship in 3 to 4 months.

Cryopreserved material may be available upon request, please inquire to for more information.

Distribution of this strain requires submission of the MMRRC Conditions of Use (COU). A link to the COU web form will be provided via email after an order has been placed; the form should be completed then or the email forwarded to your institutional official for completion.

The donor or their institution limits the distribution to non-profit institutions only.

Additional charges may apply for any special requests. Shipping costs are in addition to the basic distribution/resuscitation fees. Information on shipping costs and any additional charges will be provided by the supplying MMRRC facility.

Click button to Request this one strain. (Use the MMRRC Catalog Search to request more than one strain.)
MMRRC Item # Description Distribution Fee / Unit (US $)
*Shipping & Handling not included*
Units Notes
040265-MU-RESUS Litter recovered from cryo-archive $5,475.00 / Non-Profit Litter Recovered litter4; additional fees for any special requests.
Cryopreserved material may be available upon request, please inquire to for more information.

Some MMRRC strains were submitted by the donor as cryopreserved germplasm, and because these strains were not cryopreserved by the MMRRC, we have not assessed the quality of this material. We have extensive experience with recovery of mice from cryopreserved sperm and embryos of varying quality, including using techniques such as IVF and ICSI, and are confident that we will have success in most, if not all, cases. However, because of the unknown quality of these frozen samples, we will restrict recovery efforts to two attempts for each order. Subsequent attempts can be performed on a fee-for-service basis, in addition to the standard fees, upon request.

1 The distribution fee covers the expense of rederiving mice from a live mouse; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

2 An aliquot contains a sufficient number of embryos (in one or more vials or straws and based on the transfer success rate of the MMRRC facility) to transfer into one to three recipients. The MMRRC makes no guarantee concerning embryo transfer success experienced in the recipient investigator's laboratory. Neither gender nor genotype ratios are guaranteed.

3 An aliquot is one straw or vial with sufficient sperm to recover at least one litter of mice, as per provided protocols, when performed at the MMRRC facility. The MMRRC makes no guarantee concerning the success of these procedures when performed outside the MMRRC facilities.

4 The distribution fee covers the expense of resuscitating mice from the cryo-archive; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

To request material from the MMRRC: Please fill out our on-line request form (accessible from the catalog search results page, or click the Request this Strain button in the fees section). If you have questions or need assistance completing this form, you may call Customer Service at (800) 910-2291 (in USA or Canada) or (530) 757-5710 (international calls). Before you call, please have with you: the MMRRC item number, quantity needed, Bill-to and Ship-to contact information.