Loading Mouse GIF
Loading...

Strain Name:
C57BL/6J-MtgxR2266Btlr/Mmmh
Stock Number:
040266-MU
Citation ID:
RRID:MMRRC_040266-MU
Other Names:
R2266 (G1), C57BL/6J-MtgxR2266Btlr
Major Collection:

Strain Information

Cdh1
Name: cadherin 1
Synonyms: E-cadherin, Ecad, UM, uvomorulin, L-CAM, E-cad
Type: Gene
Species: Mouse
Chromosome: 8
NCBI: 12550
HGNC: HGNC:1748
Homologene: 20917
Ntmt1
Name: N-terminal Xaa-Pro-Lys N-methyltransferase 1
Synonyms: 2610205E22Rik, Mettl11a
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 66617
Homologene: 5439
Prrc1
Name: proline-rich coiled-coil 1
Synonyms: 2310058D16Rik, 9430085A19Rik, 3110038B19Rik, 1190002C06Rik
Type: Gene
Species: Mouse
Chromosome: 18
NCBI: 73137
VEGA: 18
Homologene: 12491
Ccdc12
Name: coiled-coil domain containing 12
Synonyms: 2700094L05Rik
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 72654
Homologene: 41751
Xrn1
Name: 5'-3' exoribonuclease 1
Synonyms: mXrn1, Dhm2
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 24127
Homologene: 5894
Vps13c
Name: vacuolar protein sorting 13C
Synonyms: C230055H22Rik
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 320528
VEGA: 9
Homologene: 41188
Agrn
Name: agrin
Synonyms: NMF380, Agrin, nmf380
Type: Gene
Species: Mouse
Chromosome: 4
NCBI: 11603
HGNC: HGNC:329
Homologene: 27907
Genetic Alterations
ENU-induced transitions at the following base pair locations (GRCm38):
  • A to T, chromosome 1 at 24,028,797 bp
  • A to G, chromosome 1 at 87,927,818 bp
  • G to C, chromosome 1 at 164,151,844 bp
  • T to A, chromosome 1 at 182,975,035 bp
  • C to A, chromosome 2 at 30,820,460 bp
  • T to A, chromosome 2 at 57,112,006 bp
  • A to G, chromosome 2 at 125,673,424 bp
  • T to C, chromosome 2 at 155,976,170 bp
  • T to C, chromosome 3 at 59,115,571 bp
  • T to C, chromosome 3 at 59,210,028 bp
  • T to A, chromosome 3 at 60,037,316 bp
  • C to A, chromosome 3 at 100,061,866 bp
  • G to A, chromosome 3 at 104,021,066 bp
  • A to T, chromosome 3 at 108,199,404 bp
  • A to G, chromosome 3 at 108,365,001 bp
  • T to C, chromosome 3 at 116,673,636 bp
  • A to T, chromosome 4 at 16,152,011 bp
  • A to T, chromosome 4 at 58,830,332 bp
  • T to A, chromosome 4 at 129,216,832 bp
  • T to C, chromosome 4 at 154,993,004 bp
  • C to T, chromosome 4 at 156,179,218 bp
  • A to G, chromosome 5 at 36,543,217 bp
  • A to G, chromosome 5 at 72,165,422 bp
  • T to A, chromosome 5 at 73,481,275 bp
  • T to C, chromosome 5 at 114,255,601 bp
  • G to C, chromosome 5 at 116,051,458 bp
  • C to T, chromosome 5 at 143,386,092 bp
  • T to C, chromosome 5 at 151,586,662 bp
  • G to T, chromosome 6 at 66,776,449 bp
  • T to A, chromosome 6 at 88,479,112 bp
  • G to A, chromosome 6 at 90,640,871 bp
  • A to G, chromosome 6 at 129,585,630 bp
  • A to G, chromosome 6 at 130,269,301 bp
  • T to C, chromosome 7 at 3,233,945 bp
  • G to A, chromosome 7 at 7,182,808 bp
  • T to C, chromosome 7 at 28,120,682 bp
  • A to G, chromosome 8 at 4,250,506 bp
  • A to T, chromosome 8 at 10,007,306 bp
  • T to C, chromosome 8 at 24,535,252 bp
  • G to A, chromosome 8 at 78,509,635 bp
  • A to T, chromosome 8 at 104,740,190 bp
  • G to A, chromosome 8 at 106,662,003 bp
  • A to G, chromosome 8 at 110,728,730 bp
  • T to C, chromosome 9 at 18,295,291 bp
  • A to T, chromosome 9 at 62,273,552 bp
  • T to C, chromosome 9 at 67,920,947 bp
  • C to A, chromosome 9 at 72,301,770 bp
  • A to G, chromosome 9 at 96,006,712 bp
  • T to C, chromosome 9 at 107,513,280 bp
  • T to A, chromosome 9 at 108,115,124 bp
  • T to A, chromosome 9 at 110,708,535 bp
  • T to G, chromosome 10 at 24,874,601 bp
  • T to C, chromosome 10 at 26,986,797 bp
  • T to A, chromosome 10 at 108,240,878 bp
  • T to A, chromosome 11 at 5,144,331 bp
  • G to A, chromosome 11 at 105,348,431 bp
  • G to A, chromosome 11 at 116,767,847 bp
  • A to T, chromosome 11 at 117,156,488 bp
  • T to A, chromosome 11 at 120,720,345 bp
  • T to C, chromosome 12 at 8,015,475 bp
  • A to G, chromosome 12 at 116,429,676 bp
  • T to C, chromosome 13 at 23,542,992 bp
  • T to C, chromosome 13 at 61,539,542 bp
  • A to G, chromosome 13 at 73,682,167 bp
  • A to G, chromosome 13 at 100,283,559 bp
  • A to T, chromosome 14 at 70,558,107 bp
  • A to T, chromosome 14 at 117,888,520 bp
  • A to G, chromosome 15 at 76,668,620 bp
  • A to T, chromosome 15 at 89,373,808 bp
  • C to A, chromosome 16 at 37,062,153 bp
  • T to A, chromosome 16 at 72,978,772 bp
  • T to C, chromosome 16 at 91,616,312 bp
  • GAGACCAACGAGCAGCTGATGCTTCAGA to GAGA, chromosome 17 at 52,725,906 bp
  • A to T, chromosome 17 at 66,725,851 bp
  • G to T, chromosome 18 at 57,381,646 bp
  • G to A, chromosome 18 at 69,657,964 bp
  • C to T, chromosome 18 at 76,965,170 bp
  • A to G, chromosome 18 at 89,064,171 bp
  • A to G, chromosome 19 at 9,558,488 bp
  • A to T, chromosome 19 at 23,303,903 bp
  • A to G, chromosome X at 18,423,687 bp
Genotype Determination
Phenotype
G1 male heterozygous mice are viable and fertile. The G1 mice were not characterized prior to archiving.
Strain GQC Summary
Gene Specific Genotyping:

To request gene-specific and other genotyping services for a strain, please contact the distribution MMRRC Center for more information.

Background Genetic Quality:

The MMRRC has developed a Genetic Quality Control pipeline using the MiniMUGA array to provide additional information to identify and validate genetic backgrounds of MMRRC strains. For more information on whether genetic background data is available, please contact MMRRC_GeneticQC@med.unc.edu. Note: that MiniMUGA genetic background data is not available on all strains, but can be ordered if desired.

Suggested Control Mice
Littermates of all relevant genotypes.
Donor
Bruce Beutler, M.D., University of Texas Southwestern Medical Center.
Primary Reference
MUTAGENETIX record for R2266 (G1). B. Beutler and colleagues, Center for the Genetics of Host Defense, UT Southwestern, Dallas, TX.
Strain Development
C57BL/6J mice were injected with ENU, resulting in G0 mice that were bred back to C57BL/6J. Sperm was archived from G1 male mice that produced viable G2 mice.


Disclaimer: If MMRRC Strain Genetic Quality Control (GQC; based on MiniMUGA genotyping and analysis) has been completed for this strain, the information might differ from the genetic background information provided by the submitter. MiniMUGA genetic analysis is done on a strain’s tissue samples taken when archived by or ordered from the assigned MMRRC Center.

Colony and Husbandry Information

Colony Surveillance Program and Current Health Reports

Mice recovered from a cryo-archive will have health surveillance performed on recipient females. Health reports will be provided prior to shipment. If you require additional health status information, please email mmrrc@missouri.edu.
Coat Color
Black
MMRRC Breeding System
Random intra-strain mating
Breeding Scheme(s)
When maintaining a live colony, heterozygous mice may be bred together, bred with wild-type siblings, or bred with C57BL/6J inbred mice.
Overall Breeding Performance
Undetermined; during development, mating was done with heterozygous males; viability, fertility and other breeding statistics for heterozygous females and homozygotes are unverified, but presumably would be similar to the C57BL/6J background strain
Average litter size
Undetermined
Recommended wean age
3 weeks

Order Information

Limited quantities of breeder mice (recovered litter) are available from a cryoarchive; recovered litter usually available to ship in 3 to 4 months.

Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

Distribution of this strain requires submission of the MMRRC Conditions of Use (COU). A link to the COU web form will be provided via email after an order has been placed; the form should be completed then or the email forwarded to your institutional official for completion.

The donor or their institution limits the distribution to non-profit institutions only.

Additional charges may apply for any special requests. Shipping costs are in addition to the basic distribution/resuscitation fees. Information on shipping costs and any additional charges will be provided by the supplying MMRRC facility.

Click button to Request this one strain. (Use the MMRRC Catalog Search to request more than one strain.)
MMRRC Item # Description Distribution Fee / Unit (US $)
*Shipping & Handling not included*
Units Notes
040266-MU-RESUS Litter recovered from cryo-archive $5,475.00 / Non-Profit Litter Recovered litter4; additional fees for any special requests.
Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

Some MMRRC strains were submitted by the donor as cryopreserved germplasm, and because these strains were not cryopreserved by the MMRRC, we have not assessed the quality, nor genotype, of this material. Our expertise in reviving mice from various qualities of frozen sperm and embryos, using methods like IVF and ICSI, gives us confidence in successful recoveries in most cases. However, due to the uncertain quality of these samples, we'll limit revival attempts to two per order. Additional attempts are available for a fee, on top of standard charges, if requested. It's important to note that some strains may lack the expected mutation, so we can't assure successful order fulfillment until we attempt to revive the strain.

1 The distribution fee covers the expense of rederiving mice from a live mouse; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

2 An aliquot contains a sufficient number of embryos (in one or more vials or straws and based on the transfer success rate of the MMRRC facility) to transfer into one to three recipients. The MMRRC makes no guarantee concerning embryo transfer success experienced in the recipient investigator's laboratory. Neither gender nor genotype ratios are guaranteed.

3 An aliquot is one straw or vial with sufficient sperm to recover at least one litter of mice, as per provided protocols, when performed at the MMRRC facility. The MMRRC makes no guarantee concerning the success of these procedures when performed outside the MMRRC facilities.

4 The distribution fee covers the expense of resuscitating mice from the cryo-archive; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

To request material from the MMRRC: Please fill out our on-line request form (accessible from the catalog search results page, or click the Request this Strain button in the fees section). If you have questions or need assistance completing this form, you may call Customer Service at (800) 910-2291 (in USA or Canada) or (530) 757-5710 (international calls). Before you call, please have with you: the MMRRC item number, quantity needed, Bill-to and Ship-to contact information.