Strain Name:
C57BL/6J-MtgxR2266Btlr/Mmmh
Stock Number:
040266-MU
Citation ID:
RRID:MMRRC_040266-MU
Other Names:
R2266 (G1), C57BL/6J-MtgxR2266Btlr
Major Collection:

Strain Information

Cdh1
Name: cadherin 1
Synonyms: E-cad, uvomorulin, L-CAM, E-cadherin, Ecad, UM
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 8
NCBI: 12550
HGNC: HGNC:1748
Homologene: 20917
Ntmt1
Name: N-terminal Xaa-Pro-Lys N-methyltransferase 1
Synonyms: 2610205E22Rik, Mettl11a
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 2
NCBI: 66617
Homologene: 5439
Prrc1
Name: proline-rich coiled-coil 1
Synonyms: 3110038B19Rik, 9430085A19Rik, 2310058D16Rik, 1190002C06Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 18
NCBI: 73137
VEGA: 18
Homologene: 12491
Ccdc12
Name: coiled-coil domain containing 12
Synonyms: 2700094L05Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 9
NCBI: 72654
Homologene: 41751
Xrn1
Name: 5'-3' exoribonuclease 1
Synonyms: mXrn1, Dhm2
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 9
NCBI: 24127
Homologene: 5894
Vps13c
Name: vacuolar protein sorting 13C
Synonyms: C230055H22Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 9
NCBI: 320528
VEGA: 9
Homologene: 41188
Agrn
Name: agrin
Synonyms: Agrin, nmf380, NMF380
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 4
NCBI: 11603
HGNC: HGNC:329
Homologene: 27907
Ncapg2
Name: non-SMC condensin II complex, subunit G2
Synonyms: 5830426I05Rik, Luzp5, Mtb, mCAP-G2
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 12
NCBI: 76044
VEGA: 12
Homologene: 9820
Zfp280d
Name: zinc finger protein 280D
Synonyms: Suhw4
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 9
NCBI: 235469
Homologene: 17151
Ppp1r12a
Name: protein phosphatase 1, regulatory subunit 12A
Synonyms: 5730577I22Rik, D10Ertd625e, Mypt1, 1200015F06Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 10
NCBI: 17931
VEGA: 10
HGNC: HGNC:7618
Homologene: 1855
Yars1
Name: tyrosyl-tRNA synthetase 1
Synonyms: Yars
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 4
NCBI: 107271
Homologene: 2730
Slc10a7
Name: solute carrier family 10 (sodium/bile acid cotransporter family), member 7
Synonyms: 2410193C02Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 8
NCBI: 76775
Homologene: 81628
Ruvbl1
Name: RuvB-like AAA ATPase 1
Synonyms: Pontin52, Tip49a, 2510009G06Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 6
NCBI: 56505
Homologene: 37839
Rttn
Name: rotatin
Synonyms: C530033I08Rik, 4921538A15Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 18
NCBI: 246102
VEGA: 18
Homologene: 65275
Tcf4
Name: transcription factor 4
Synonyms: E2-2, TFE, ITF-2, MITF-2A, bHLHb19, ITF-2b, ASP-I2, SEF2-1, ME2, E2.2, SEF-2, 5730422P05Rik, MITF-2B
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 18
NCBI: 21413
Homologene: 2407
Dgkd
Name: diacylglycerol kinase, delta
Synonyms: DGKdelta, dgkd-2
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 1
NCBI: 227333
HGNC: HGNC:2851
Homologene: 100054
Tbc1d14
Name: TBC1 domain family, member 14
Synonyms: D5Ertd110e, 2810413P16Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 5
NCBI: 100855
Homologene: 10809
Ecpas
Name: Ecm29 proteasome adaptor and scaffold
Synonyms: AI314180
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 4
NCBI: 230249
Homologene: 6056
Slc41a3
Name: solute carrier family 41, member 3
Synonyms: SLC41A1-L2, 1010001P06Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 6
NCBI: 71699
Homologene: 23052
Grid2ip
Name: glutamate receptor, ionotropic, delta 2 (Grid2) interacting protein 1
Synonyms: delphilin
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 5
NCBI: 170935
Homologene: 15781
Robo1
Name: roundabout guidance receptor 1
Synonyms: DUTT1
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 16
NCBI: 19876
Homologene: 2206
Apob
Name: apolipoprotein B
Synonyms: apob-48, apob-100
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 12
NCBI: 238055
HGNC: HGNC:603
Homologene: 328
Hr
Name: lysine demethylase and nuclear receptor corepressor
Synonyms: N, rh-bmh, bldy, rh, ba
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 14
NCBI: 15460
HGNC: HGNC:5172
Homologene: 3774
Ptprm
Name: protein tyrosine phosphatase receptor type M
Synonyms: RPTPmu
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 17
NCBI: 19274
VEGA: 17
HGNC: HGNC:9675
Homologene: 37694
Gpc6
Name: glypican 6
Synonyms: 6720429C22Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 14
NCBI: 23888
HGNC: HGNC:4454
Homologene: 55922
Chordc1
Name: cysteine and histidine-rich domain (CHORD)-containing, zinc-binding protein 1
Synonyms: Chp-1, 1110001O09Rik, morgana
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 9
NCBI: 66917
VEGA: 9
Homologene: 8111
Fam135a
Name: family with sequence similarity 135, member A
Synonyms: 4921533L14Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 1
NCBI: 68187
Homologene: 32665
Med23
Name: mediator complex subunit 23
Synonyms: X83317, Crsp3, Sur2, sno, ESTM7, 3000002A17Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 10
NCBI: 70208
HGNC: HGNC:2372
Homologene: 3552
Magi3
Name: membrane associated guanylate kinase, WW and PDZ domain containing 3
Synonyms: 6530407C02Rik, 4732496O19Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 3
NCBI: 99470
Homologene: 26431
Nr4a2
Name: nuclear receptor subfamily 4, group A, member 2
Synonyms: HZF-3, RNR-1, Nurr1
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 2
NCBI: 18227
HGNC: HGNC:7981
Homologene: 4509
Tnfsf13b
Name: tumor necrosis factor (ligand) superfamily, member 13b
Synonyms: TALL-1, BAFF, D8Ertd387e, zTNF4, BLyS
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 8
NCBI: 24099
Homologene: 48443
Cacna2d2
Name: calcium channel, voltage-dependent, alpha 2/delta subunit 2
Synonyms: a2d2
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 9
NCBI: 56808
HGNC: HGNC:1400
Homologene: 4400
Lama2
Name: laminin, alpha 2
Synonyms: mer, merosin
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 10
NCBI: 16773
HGNC: HGNC:6482
Homologene: 37306
Zfp418
Name: zinc finger protein 418
Synonyms: A230102I05Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 7
NCBI: 232854
Homologene: 119890
Foxn4
Name: forkhead box N4
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 5
NCBI: 116810
Homologene: 17526
Ces2a
Name: carboxylesterase 2A
Synonyms: Ces6, 9130231C15Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 8
NCBI: 102022
HGNC: HGNC:1864
Homologene: 136396
Sec14l1
Name: SEC14-like lipid binding 1
Synonyms: 2810012L19Rik, 1200017E04Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 11
NCBI: 74136
Homologene: 37719
Polq
Name: polymerase (DNA directed), theta
Synonyms: A430110D14Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 16
NCBI: 77782
HGNC: HGNC:9186
Homologene: 32727
Hdhd2
Name: haloacid dehalogenase-like hydrolase domain containing 2
Synonyms: 0610039H12Rik, 3110052N05Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 18
NCBI: 76987
Homologene: 12667
Emid1
Name: EMI domain containing 1
Synonyms: CO-5, Emu1
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 11
NCBI: 140703
Homologene: 135639
Naip6
Name: NLR family, apoptosis inhibitory protein 6
Synonyms: Naip-rs4, Naip-rs4A, Birc1f
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 13
NCBI: 17952
HGNC: HGNC:7634
Homologene: 113589
Nlrp12
Name: NLR family, pyrin domain containing 12
Synonyms: Nalp12
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 7
NCBI: 378425
Homologene: 16972
Ripk2
Name: receptor (TNFRSF)-interacting serine-threonine kinase 2
Synonyms: RIP2, D4Bwg0615e, CARD3, 2210420D18Rik, RICK, CARDIAK, CCK
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 4
NCBI: 192656
Homologene: 37856
Bsn
Name: bassoon
Synonyms: presynaptic cytomatrix protein
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 9
NCBI: 12217
HGNC: HGNC:1117
Homologene: 31161
Mamdc2
Name: MAM domain containing 2
Synonyms: 1200015L10Rik, mamcan
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 19
NCBI: 71738
VEGA: 19
Homologene: 17722
Vmn2r18
Name: vomeronasal 2, receptor 18
Synonyms: EG632671
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 5
NCBI: 632671
P2ry14
Name: purinergic receptor P2Y, G-protein coupled, 14
Synonyms: A330108O13Rik, P2Y14, Gpr105
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 3
NCBI: 140795
Homologene: 15769
Spag17
Name: sperm associated antigen 17
Synonyms: PF6, 4931427F14Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 3
NCBI: 74362
Homologene: 52601
Slc6a19
Name: solute carrier family 6 (neurotransmitter transporter), member 19
Synonyms: B0AT1, 4632401C08Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 13
NCBI: 74338
Homologene: 52819
Foxh1
Name: forkhead box H1
Synonyms: Fast2
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 15
NCBI: 14106
VEGA: 15
HGNC: HGNC:3814
Homologene: 2914
Plch2
Name: phospholipase C, eta 2
Synonyms: PLCeta2, Plcl4, A930027K05Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 4
NCBI: 269615
Homologene: 85172
St6galnac1
Name: ST6 (alpha-N-acetyl-neuraminyl-2,3-beta-galactosyl-1,3)-N-acetylgalactosaminide alpha-2,6-sialyltransferase 1
Synonyms: Siat7a, ST6GalNAc I
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 11
NCBI: 20445
Homologene: 7937
Mybphl
Name: myosin binding protein H-like
Synonyms: 1110037P11Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 3
NCBI: 68753
Homologene: 19221
Stxbp3-ps
Name: syntaxin-binding protein 3, pseudogene
Synonyms: Stxbp3b, Munc18c(L)
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 19
NCBI: 619371
Mrc2
Name: mannose receptor, C type 2
Synonyms: uPARAP, Endo180, novel lectin
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 11
NCBI: 17534
Homologene: 4408
Fcgbp
Name: Fc fragment of IgG binding protein
Synonyms: A430096B05Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 7
NCBI: 215384
Homologene: 68369
Kcnh8
Name: potassium voltage-gated channel, subfamily H (eag-related), member 8
Synonyms: ELK1, Kv12.1, C130090D05Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 17
NCBI: 211468
Homologene: 14332
Klra10
Name: killer cell lectin-like receptor subfamily A, member 10
Synonyms: Ly49i2, Ly49J
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 6
NCBI: 16628
Homologene: 110821
P2ry13
Name: purinergic receptor P2Y, G-protein coupled 13
Synonyms: Gpr86, SP174, 2010001L06Rik, P2Y13
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 3
NCBI: 74191
HGNC: HGNC:4537
Homologene: 12543
Cep250
Name: centrosomal protein 250
Synonyms: Cep2, Inmp, B230210E21Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 2
NCBI: 16328
HGNC: HGNC:1859
Homologene: 38286
Aadac
Name: arylacetamide deacetylase
Synonyms: Aada, 5033417E09Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 3
NCBI: 67758
HGNC: HGNC:17
Homologene: 37436
Lrrc45
Name: leucine rich repeat containing 45
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 11
NCBI: 217366
Homologene: 17019
Ido2
Name: indoleamine 2,3-dioxygenase 2
Synonyms: C230043N17Rik, Indol1, Ido2
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 8
NCBI: 209176
Homologene: 48830
Tlr5
Name: toll-like receptor 5
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 1
NCBI: 53791
Homologene: 20698
Vmn1r38
Name: vomeronasal 1 receptor 38
Synonyms: V1rc13
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 6
NCBI: 171186
Homologene: 110800
Tgfbr3l
Name: transforming growth factor, beta receptor III-like
Synonyms: Gm14378, LOC100039590
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 8
NCBI: 100044509
Homologene: 130375
Klre1
Name: killer cell lectin-like receptor family E member 1
Synonyms: NKG2I, Klre-1
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 6
NCBI: 243655
Homologene: 17794
Ctsm
Name: cathepsin M
Synonyms: 1600027J17Rik, Catm, Cat M
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 13
NCBI: 64139
VEGA: 13
HGNC: HGNC:2537
Homologene: 75181
Mtss2
Name: MTSS I-BAR domain containing 2
Synonyms: Mtss1l, ABBA
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 8
NCBI: 244654
Homologene: 70926
Dipk2b
Name: divergent protein kinase domain 2B
Synonyms: 4930578C19Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: X
NCBI: 75905
Homologene: 23469
Cyb561d1
Name: cytochrome b-561 domain containing 1
Synonyms: 1600010M23Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 3
NCBI: 72023
Homologene: 45651
Spesp1
Name: sperm equatorial segment protein 1
Synonyms: 4921508E09Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 9
NCBI: 66712
VEGA: 9
Homologene: 49838
Tymp
Name: thymidine phosphorylase
Synonyms: Pdgfec, PD-ECGF, gliostatin, Ecgf1, 2900072D10Rik, PDECGF
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 15
NCBI: 72962
VEGA: 15
HGNC: HGNC:3148
Homologene: 1474
Eid1
Name: EP300 interacting inhibitor of differentiation 1
Synonyms: ORF12, Cri1, 2610002K20Rik, EID-1
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 2
NCBI: 58521
HGNC: HGNC:1191
Homologene: 49376
Tmem233
Name: transmembrane protein 233
Synonyms: Gm13843
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 5
NCBI: 545798
Homologene: 54444
Dcun1d4
Name: DCN1, defective in cullin neddylation 1, domain containing 4 (S. cerevisiae)
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 5
NCBI: 100737
Homologene: 22867
Dnajc28
Name: DnaJ heat shock protein family (Hsp40) member C28
Synonyms: ORF28
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 16
NCBI: 246738
HGNC: HGNC:1297
Homologene: 9869
Slc35a3
Name: solute carrier family 35 (UDP-N-acetylglucosamine (UDP-GlcNAc) transporter), member 3
Synonyms: 2310050P13Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 3
NCBI: 229782
Homologene: 40826
Commd8
Name: COMM domain containing 8
Synonyms: IMAGE:1958590, D5Buc26e
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 5
NCBI: 27784
Homologene: 9873
Gm16548
Name: predicted gene 16548
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 1
NCBI: 100503816
H2bc9
Name: H2B clustered histone 9
Synonyms: Hist1h2bh
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 13
NCBI: 319182
HGNC: HGNC:4755
Homologene: 138447
Genetic Alterations
ENU-induced transitions at the following base pair locations (GRCm38):
  • A to T, chromosome 1 at 24,028,797 bp
  • A to G, chromosome 1 at 87,927,818 bp
  • G to C, chromosome 1 at 164,151,844 bp
  • T to A, chromosome 1 at 182,975,035 bp
  • C to A, chromosome 2 at 30,820,460 bp
  • T to A, chromosome 2 at 57,112,006 bp
  • A to G, chromosome 2 at 125,673,424 bp
  • T to C, chromosome 2 at 155,976,170 bp
  • T to C, chromosome 3 at 59,115,571 bp
  • T to C, chromosome 3 at 59,210,028 bp
  • T to A, chromosome 3 at 60,037,316 bp
  • C to A, chromosome 3 at 100,061,866 bp
  • G to A, chromosome 3 at 104,021,066 bp
  • A to T, chromosome 3 at 108,199,404 bp
  • A to G, chromosome 3 at 108,365,001 bp
  • T to C, chromosome 3 at 116,673,636 bp
  • A to T, chromosome 4 at 16,152,011 bp
  • A to T, chromosome 4 at 58,830,332 bp
  • T to A, chromosome 4 at 129,216,832 bp
  • T to C, chromosome 4 at 154,993,004 bp
  • C to T, chromosome 4 at 156,179,218 bp
  • A to G, chromosome 5 at 36,543,217 bp
  • A to G, chromosome 5 at 72,165,422 bp
  • T to A, chromosome 5 at 73,481,275 bp
  • T to C, chromosome 5 at 114,255,601 bp
  • G to C, chromosome 5 at 116,051,458 bp
  • C to T, chromosome 5 at 143,386,092 bp
  • T to C, chromosome 5 at 151,586,662 bp
  • G to T, chromosome 6 at 66,776,449 bp
  • T to A, chromosome 6 at 88,479,112 bp
  • G to A, chromosome 6 at 90,640,871 bp
  • A to G, chromosome 6 at 129,585,630 bp
  • A to G, chromosome 6 at 130,269,301 bp
  • T to C, chromosome 7 at 3,233,945 bp
  • G to A, chromosome 7 at 7,182,808 bp
  • T to C, chromosome 7 at 28,120,682 bp
  • A to G, chromosome 8 at 4,250,506 bp
  • A to T, chromosome 8 at 10,007,306 bp
  • T to C, chromosome 8 at 24,535,252 bp
  • G to A, chromosome 8 at 78,509,635 bp
  • A to T, chromosome 8 at 104,740,190 bp
  • G to A, chromosome 8 at 106,662,003 bp
  • A to G, chromosome 8 at 110,728,730 bp
  • T to C, chromosome 9 at 18,295,291 bp
  • A to T, chromosome 9 at 62,273,552 bp
  • T to C, chromosome 9 at 67,920,947 bp
  • C to A, chromosome 9 at 72,301,770 bp
  • A to G, chromosome 9 at 96,006,712 bp
  • T to C, chromosome 9 at 107,513,280 bp
  • T to A, chromosome 9 at 108,115,124 bp
  • T to A, chromosome 9 at 110,708,535 bp
  • T to G, chromosome 10 at 24,874,601 bp
  • T to C, chromosome 10 at 26,986,797 bp
  • T to A, chromosome 10 at 108,240,878 bp
  • T to A, chromosome 11 at 5,144,331 bp
  • G to A, chromosome 11 at 105,348,431 bp
  • G to A, chromosome 11 at 116,767,847 bp
  • A to T, chromosome 11 at 117,156,488 bp
  • T to A, chromosome 11 at 120,720,345 bp
  • T to C, chromosome 12 at 8,015,475 bp
  • A to G, chromosome 12 at 116,429,676 bp
  • T to C, chromosome 13 at 23,542,992 bp
  • T to C, chromosome 13 at 61,539,542 bp
  • A to G, chromosome 13 at 73,682,167 bp
  • A to G, chromosome 13 at 100,283,559 bp
  • A to T, chromosome 14 at 70,558,107 bp
  • A to T, chromosome 14 at 117,888,520 bp
  • A to G, chromosome 15 at 76,668,620 bp
  • A to T, chromosome 15 at 89,373,808 bp
  • C to A, chromosome 16 at 37,062,153 bp
  • T to A, chromosome 16 at 72,978,772 bp
  • T to C, chromosome 16 at 91,616,312 bp
  • GAGACCAACGAGCAGCTGATGCTTCAGA to GAGA, chromosome 17 at 52,725,906 bp
  • A to T, chromosome 17 at 66,725,851 bp
  • G to T, chromosome 18 at 57,381,646 bp
  • G to A, chromosome 18 at 69,657,964 bp
  • C to T, chromosome 18 at 76,965,170 bp
  • A to G, chromosome 18 at 89,064,171 bp
  • A to G, chromosome 19 at 9,558,488 bp
  • A to T, chromosome 19 at 23,303,903 bp
  • A to G, chromosome X at 18,423,687 bp
Genotype Determination
Phenotype
G1 male heterozygous mice are viable and fertile. The G1 mice were not characterized prior to archiving.
Strain Development
C57BL/6J mice were injected with ENU, resulting in G0 mice that were bred back to C57BL/6J. Sperm was archived from G1 male mice that produced viable G2 mice.
Suggested Control Mice
Wild-type littermates or C57BL/6J mice
MMRRC Genetic QC Summary
The MMRRC Centers have developed a genetic QC pipeline using MiniMUGA array genotyping to provide additional information on strain backgrounds for MMRRC congenic and inbred strains. For more information on when data may be available, or to request genotyping for a strain of interest, please contact mmrrc@missouri.edu. Older strains may not have this information.
Donor
Bruce Beutler, M.D., University of Texas Southwestern Medical Center.
Primary Reference
MUTAGENETIX record for R2266 (G1). B. Beutler and colleagues, Center for the Genetics of Host Defense, UT Southwestern, Dallas, TX.

Colony and Husbandry Information

Colony Surveillance Program and Current Health Reports

Mice recovered from a cryo-archive will have health surveillance performed on recipient females. Health reports will be provided prior to shipment. If you require additional health status information, please email mmrrc@missouri.edu .
Coat Color
Black
MMRRC Breeding System
Random intra-strain mating
Breeding Scheme(s)
When maintaining a live colony, heterozygous mice may be bred together, bred with wild-type siblings, or bred with C57BL/6J inbred mice.
Overall Breeding Performance
Undetermined; during development, mating was done with heterozygous males; viability, fertility and other breeding statistics for heterozygous females and homozygotes are unverified, but presumably would be similar to the C57BL/6J background strain
Average litter size
Undetermined
Recommended wean age
3 weeks

Order Request Information

Limited quantities of breeder mice (recovered litter) are available from a cryoarchive; recovered litter usually available to ship in 3 to 4 months.

Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

Distribution of this strain requires submission of the MMRRC Conditions of Use (COU). A link to the COU web form will be provided via email after an order has been placed; the form should be completed then or the email forwarded to your institutional official for completion.

The donor or their institution limits the distribution to non-profit institutions only.

Additional charges may apply for any special requests. Shipping costs are in addition to the basic distribution/resuscitation fees. Information on shipping costs and any additional charges will be provided by the supplying MMRRC facility.

Click button to Request this one strain. (Use the MMRRC Catalog Search to request more than one strain.)
MMRRC Item # Description Distribution Fee / Unit (US $)
*Shipping & Handling not included*
Units Notes
040266-MU-RESUS Litter recovered from cryo-archive $5,475.00 / Non-Profit Litter Recovered litter4; additional fees for any special requests.
Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

Some MMRRC strains were submitted by the donor as cryopreserved germplasm, and because these strains were not cryopreserved by the MMRRC, we have not assessed the quality of this material. We have extensive experience with recovery of mice from cryopreserved sperm and embryos of varying quality, including using techniques such as IVF and ICSI, and are confident that we will have success in most, if not all, cases. However, because of the unknown quality of these frozen samples, we will restrict recovery efforts to two attempts for each order. Subsequent attempts can be performed on a fee-for-service basis, in addition to the standard fees, upon request.

1 The distribution fee covers the expense of rederiving mice from a live mouse; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

2 An aliquot contains a sufficient number of embryos (in one or more vials or straws and based on the transfer success rate of the MMRRC facility) to transfer into one to three recipients. The MMRRC makes no guarantee concerning embryo transfer success experienced in the recipient investigator's laboratory. Neither gender nor genotype ratios are guaranteed.

3 An aliquot is one straw or vial with sufficient sperm to recover at least one litter of mice, as per provided protocols, when performed at the MMRRC facility. The MMRRC makes no guarantee concerning the success of these procedures when performed outside the MMRRC facilities.

4 The distribution fee covers the expense of resuscitating mice from the cryo-archive; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

To request material from the MMRRC: Please fill out our on-line request form (accessible from the catalog search results page, or click the Request this Strain button in the fees section). If you have questions or need assistance completing this form, you may call Customer Service at (800) 910-2291 (in USA or Canada) or (530) 757-5710 (international calls). Before you call, please have with you: the MMRRC item number, quantity needed, Bill-to and Ship-to contact information.