Strain Name:
Stock Number:
Citation ID:
Other Names:
R2266 (G1), C57BL/6J-MtgxR2266Btlr
Major Collection:

Gene Information

Name: cadherin 1
Synonyms: E-cadherin, Ecad, UM, uvomorulin, L-CAM, E-cad
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 8
NCBI: 12550
Homologene: 20917
Name: N-terminal Xaa-Pro-Lys N-methyltransferase 1
Synonyms: 2610205E22Rik, Mettl11a
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 2
NCBI: 66617
Homologene: 5439
Name: proline-rich coiled-coil 1
Synonyms: 2310058D16Rik, 9430085A19Rik, 3110038B19Rik, 1190002C06Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 18
NCBI: 73137
VEGA: 18
Homologene: 12491
Name: coiled-coil domain containing 12
Synonyms: 2700094L05Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 9
NCBI: 72654
Homologene: 41751
Name: 5'-3' exoribonuclease 1
Synonyms: mXrn1, Dhm2
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 9
NCBI: 24127
Homologene: 5894
Name: vacuolar protein sorting 13C
Synonyms: C230055H22Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 9
NCBI: 320528
Homologene: 41188
Name: agrin
Synonyms: NMF380, Agrin, nmf380
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 4
NCBI: 11603
Homologene: 27907
Name: non-SMC condensin II complex, subunit G2
Synonyms: 5830426I05Rik, Mtb, Luzp5, mCAP-G2
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 12
NCBI: 76044
VEGA: 12
Homologene: 9820
Name: zinc finger protein 280D
Synonyms: Suhw4
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 9
NCBI: 235469
Homologene: 17151
Name: protein phosphatase 1, regulatory subunit 12A
Synonyms: 1200015F06Rik, Mypt1, D10Ertd625e, 5730577I22Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 10
NCBI: 17931
VEGA: 10
Homologene: 1855
Name: tyrosyl-tRNA synthetase
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 4
NCBI: 107271
Homologene: 2730
Name: solute carrier family 10 (sodium/bile acid cotransporter family), member 7
Synonyms: 2410193C02Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 8
NCBI: 76775
Homologene: 81628
Name: RuvB-like protein 1
Synonyms: Pontin52, 2510009G06Rik, Tip49a
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 6
NCBI: 56505
Homologene: 37839
Name: rotatin
Synonyms: 4921538A15Rik, C530033I08Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 18
NCBI: 246102
VEGA: 18
Homologene: 65275
Name: transcription factor 4
Synonyms: SEF-2, ITF-2, MITF-2B, MITF-2A, ME2, E2.2, TFE, E2-2, SEF2-1, ASP-I2, ITF-2b, 5730422P05Rik, bHLHb19
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 18
NCBI: 21413
Homologene: 2407
Name: diacylglycerol kinase, delta
Synonyms: DGKdelta, dgkd-2
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 1
NCBI: 227333
Homologene: 100054
Name: TBC1 domain family, member 14
Synonyms: 2810413P16Rik, D5Ertd110e
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 5
NCBI: 100855
Homologene: 10809
Name: Ecm29 proteasome adaptor and scaffold
Synonyms: AI314180
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 4
NCBI: 230249
Homologene: 6056
Name: solute carrier family 41, member 3
Synonyms: SLC41A1-L2, 1010001P06Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 6
NCBI: 71699
Homologene: 23052
Name: glutamate receptor, ionotropic, delta 2 (Grid2) interacting protein 1
Synonyms: delphilin
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 5
NCBI: 170935
Homologene: 15781
Name: roundabout guidance receptor 1
Synonyms: DUTT1
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 16
NCBI: 19876
Homologene: 2206
Name: apolipoprotein B
Synonyms: apob-100, apob-48
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 12
NCBI: 238055
Homologene: 328
Name: lysine demethylase and nuclear receptor corepressor
Synonyms: N, ba, rh, rh-bmh, bldy
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 14
NCBI: 15460
Homologene: 3774
Name: protein tyrosine phosphatase, receptor type, M
Synonyms: RPTPmu
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 17
NCBI: 19274
VEGA: 17
Homologene: 37694
Name: glypican 6
Synonyms: 6720429C22Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 14
NCBI: 23888
Homologene: 55922
Name: cysteine and histidine-rich domain (CHORD)-containing, zinc-binding protein 1
Synonyms: 1110001O09Rik, Chp-1, morgana
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 9
NCBI: 66917
Homologene: 8111
Name: family with sequence similarity 135, member A
Synonyms: 4921533L14Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 1
NCBI: 68187
Homologene: 32665
Name: mediator complex subunit 23
Synonyms: ESTM7, 3000002A17Rik, X83317, Crsp3, Sur2, sno
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 10
NCBI: 70208
Homologene: 3552
Name: membrane associated guanylate kinase, WW and PDZ domain containing 3
Synonyms: 4732496O19Rik, 6530407C02Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 3
NCBI: 99470
Homologene: 26431
Name: nuclear receptor subfamily 4, group A, member 2
Synonyms: HZF-3, RNR-1, Nurr1
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 2
NCBI: 18227
Homologene: 4509
Name: tumor necrosis factor (ligand) superfamily, member 13b
Synonyms: BAFF, zTNF4, BLyS, TALL-1, D8Ertd387e
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 8
NCBI: 24099
Homologene: 48443
Name: calcium channel, voltage-dependent, alpha 2/delta subunit 2
Synonyms: a2d2
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 9
NCBI: 56808
Homologene: 4400
Name: laminin, alpha 2
Synonyms: merosin, mer
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 10
NCBI: 16773
Homologene: 37306
Name: zinc finger protein 418
Synonyms: A230102I05Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 7
NCBI: 232854
Homologene: 119890
Name: forkhead box N4
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 5
NCBI: 116810
Homologene: 17526
Name: carboxylesterase 2A
Synonyms: 9130231C15Rik, Ces6
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 8
NCBI: 102022
Homologene: 136396
Name: SEC14-like lipid binding 1
Synonyms: 1200017E04Rik, 2810012L19Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 11
NCBI: 74136
Homologene: 37719
Name: polymerase (DNA directed), theta
Synonyms: A430110D14Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 16
NCBI: 77782
Homologene: 32727
Name: haloacid dehalogenase-like hydrolase domain containing 2
Synonyms: 0610039H12Rik, 3110052N05Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 18
NCBI: 76987
Homologene: 12667
Name: EMI domain containing 1
Synonyms: CO-5, Emu1
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 11
NCBI: 140703
Homologene: 135639
Name: NLR family, apoptosis inhibitory protein 6
Synonyms: Naip-rs4A, Naip-rs4, Birc1f
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 13
NCBI: 17952
Homologene: 113589
Name: NLR family, pyrin domain containing 12
Synonyms: Nalp12
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 7
NCBI: 378425
Homologene: 16972
Name: receptor (TNFRSF)-interacting serine-threonine kinase 2
Synonyms: CCK, CARDIAK, RIP2, RICK, CARD3, D4Bwg0615e, 2210420D18Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 4
NCBI: 192656
Homologene: 37856
Name: bassoon
Synonyms: presynaptic cytomatrix protein
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 9
NCBI: 12217
Homologene: 31161
Name: MAM domain containing 2
Synonyms: 1200015L10Rik, mamcan
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 19
NCBI: 71738
VEGA: 19
Homologene: 17722
Name: vomeronasal 2, receptor 18
Synonyms: EG632671
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 5
NCBI: 632671
Name: purinergic receptor P2Y, G-protein coupled, 14
Synonyms: A330108O13Rik, P2Y14, Gpr105
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 3
NCBI: 140795
Homologene: 15769
Name: sperm associated antigen 17
Synonyms: 4931427F14Rik, PF6
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 3
NCBI: 74362
Homologene: 52601
Name: solute carrier family 6 (neurotransmitter transporter), member 19
Synonyms: B0AT1, 4632401C08Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 13
NCBI: 74338
Homologene: 52819
Name: forkhead box H1
Synonyms: Fast2
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 15
NCBI: 14106
VEGA: 15
Homologene: 2914
Name: phospholipase C, eta 2
Synonyms: PLCeta2, A930027K05Rik, Plcl4
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 4
NCBI: 269615
Homologene: 85172
Name: ST6 (alpha-N-acetyl-neuraminyl-2,3-beta-galactosyl-1,3)-N-acetylgalactosaminide alpha-2,6-sialyltransferase 1
Synonyms: ST6GalNAc I, Siat7a
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 11
NCBI: 20445
Homologene: 7937
Name: myosin binding protein H-like
Synonyms: 1110037P11Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 3
NCBI: 68753
Homologene: 19221
Name: syntaxin-binding protein 3, pseudogene
Synonyms: Munc18c(L), Stxbp3b
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 19
NCBI: 619371
Name: mannose receptor, C type 2
Synonyms: novel lectin, Endo180, uPARAP
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 11
NCBI: 17534
Homologene: 4408
Name: Fc fragment of IgG binding protein
Synonyms: A430096B05Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 7
NCBI: 215384
Homologene: 68369
Name: potassium voltage-gated channel, subfamily H (eag-related), member 8
Synonyms: Kv12.1, ELK1, C130090D05Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 17
NCBI: 211468
Homologene: 14332
Name: killer cell lectin-like receptor subfamily A, member 10
Synonyms: Ly49J, Ly49i2
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 6
NCBI: 16628
Homologene: 110821
Name: purinergic receptor P2Y, G-protein coupled 13
Synonyms: 2010001L06Rik, P2Y13, SP174, Gpr86
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 3
NCBI: 74191
Homologene: 12543
Name: centrosomal protein 250
Synonyms: Inmp, B230210E21Rik, Cep2
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 2
NCBI: 16328
Homologene: 38286
Name: arylacetamide deacetylase
Synonyms: 5033417E09Rik, Aada
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 3
NCBI: 67758
Homologene: 37436
Name: leucine rich repeat containing 45
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 11
NCBI: 217366
Homologene: 17019
Name: indoleamine 2,3-dioxygenase 2
Synonyms: C230043N17Rik, Ido2, Indol1
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 8
NCBI: 209176
Homologene: 48830
Name: toll-like receptor 5
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 1
NCBI: 53791
Homologene: 20698
Name: vomeronasal 1 receptor 38
Synonyms: V1rc13
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 6
NCBI: 171186
Homologene: 110800
Name: transforming growth factor, beta receptor III-like
Synonyms: LOC100039590, Gm14378
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 8
NCBI: 100044509
Homologene: 130375
Name: killer cell lectin-like receptor family E member 1
Synonyms: Klre-1, NKG2I
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 6
NCBI: 243655
Homologene: 17794
Name: cathepsin M
Synonyms: Cat M, Catm, 1600027J17Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 13
NCBI: 64139
VEGA: 13
Homologene: 75181
Name: MTSS I-BAR domain containing 2
Synonyms: ABBA, Mtss1l
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 8
NCBI: 244654
Homologene: 70926
Name: divergent protein kinase domain 2B
Synonyms: 4930578C19Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: X
NCBI: 75905
Homologene: 23469
Name: cytochrome b-561 domain containing 1
Synonyms: 1600010M23Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 3
NCBI: 72023
Homologene: 45651
Name: sperm equatorial segment protein 1
Synonyms: 4921508E09Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 9
NCBI: 66712
Homologene: 49838
Name: thymidine phosphorylase
Synonyms: PDECGF, PD-ECGF, gliostatin, Pdgfec, 2900072D10Rik, Ecgf1
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 15
NCBI: 72962
VEGA: 15
Homologene: 1474
Name: EP300 interacting inhibitor of differentiation 1
Synonyms: 2610002K20Rik, EID-1, ORF12, Cri1
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 2
NCBI: 58521
Homologene: 49376
Name: transmembrane protein 233
Synonyms: Gm13843
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 5
NCBI: 545798
Homologene: 54444
Name: DCN1, defective in cullin neddylation 1, domain containing 4 (S. cerevisiae)
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 5
NCBI: 100737
Homologene: 22867
Name: DnaJ heat shock protein family (Hsp40) member C28
Synonyms: ORF28
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 16
NCBI: 246738
Homologene: 9869
Name: solute carrier family 35 (UDP-N-acetylglucosamine (UDP-GlcNAc) transporter), member 3
Synonyms: 2310050P13Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 3
NCBI: 229782
Homologene: 40826
Name: COMM domain containing 8
Synonyms: IMAGE:1958590, D5Buc26e
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 5
NCBI: 27784
Homologene: 9873
Name: predicted gene 16548
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 1
NCBI: 100503816
Name: H2B clustered histone 9
Synonyms: Hist1h2bh
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 13
NCBI: 319182
Homologene: 138447
Genetic Alterations
ENU-induced transitions at the following base pair locations (GRCm38):
  • A to T, chromosome 1 at 24,028,797 bp
  • A to G, chromosome 1 at 87,927,818 bp
  • G to C, chromosome 1 at 164,151,844 bp
  • T to A, chromosome 1 at 182,975,035 bp
  • C to A, chromosome 2 at 30,820,460 bp
  • T to A, chromosome 2 at 57,112,006 bp
  • A to G, chromosome 2 at 125,673,424 bp
  • T to C, chromosome 2 at 155,976,170 bp
  • T to C, chromosome 3 at 59,115,571 bp
  • T to C, chromosome 3 at 59,210,028 bp
  • T to A, chromosome 3 at 60,037,316 bp
  • C to A, chromosome 3 at 100,061,866 bp
  • G to A, chromosome 3 at 104,021,066 bp
  • A to T, chromosome 3 at 108,199,404 bp
  • A to G, chromosome 3 at 108,365,001 bp
  • T to C, chromosome 3 at 116,673,636 bp
  • A to T, chromosome 4 at 16,152,011 bp
  • A to T, chromosome 4 at 58,830,332 bp
  • T to A, chromosome 4 at 129,216,832 bp
  • T to C, chromosome 4 at 154,993,004 bp
  • C to T, chromosome 4 at 156,179,218 bp
  • A to G, chromosome 5 at 36,543,217 bp
  • A to G, chromosome 5 at 72,165,422 bp
  • T to A, chromosome 5 at 73,481,275 bp
  • T to C, chromosome 5 at 114,255,601 bp
  • G to C, chromosome 5 at 116,051,458 bp
  • C to T, chromosome 5 at 143,386,092 bp
  • T to C, chromosome 5 at 151,586,662 bp
  • G to T, chromosome 6 at 66,776,449 bp
  • T to A, chromosome 6 at 88,479,112 bp
  • G to A, chromosome 6 at 90,640,871 bp
  • A to G, chromosome 6 at 129,585,630 bp
  • A to G, chromosome 6 at 130,269,301 bp
  • T to C, chromosome 7 at 3,233,945 bp
  • G to A, chromosome 7 at 7,182,808 bp
  • T to C, chromosome 7 at 28,120,682 bp
  • A to G, chromosome 8 at 4,250,506 bp
  • A to T, chromosome 8 at 10,007,306 bp
  • T to C, chromosome 8 at 24,535,252 bp
  • G to A, chromosome 8 at 78,509,635 bp
  • A to T, chromosome 8 at 104,740,190 bp
  • G to A, chromosome 8 at 106,662,003 bp
  • A to G, chromosome 8 at 110,728,730 bp
  • T to C, chromosome 9 at 18,295,291 bp
  • A to T, chromosome 9 at 62,273,552 bp
  • T to C, chromosome 9 at 67,920,947 bp
  • C to A, chromosome 9 at 72,301,770 bp
  • A to G, chromosome 9 at 96,006,712 bp
  • T to C, chromosome 9 at 107,513,280 bp
  • T to A, chromosome 9 at 108,115,124 bp
  • T to A, chromosome 9 at 110,708,535 bp
  • T to G, chromosome 10 at 24,874,601 bp
  • T to C, chromosome 10 at 26,986,797 bp
  • T to A, chromosome 10 at 108,240,878 bp
  • T to A, chromosome 11 at 5,144,331 bp
  • G to A, chromosome 11 at 105,348,431 bp
  • G to A, chromosome 11 at 116,767,847 bp
  • A to T, chromosome 11 at 117,156,488 bp
  • T to A, chromosome 11 at 120,720,345 bp
  • T to C, chromosome 12 at 8,015,475 bp
  • A to G, chromosome 12 at 116,429,676 bp
  • T to C, chromosome 13 at 23,542,992 bp
  • T to C, chromosome 13 at 61,539,542 bp
  • A to G, chromosome 13 at 73,682,167 bp
  • A to G, chromosome 13 at 100,283,559 bp
  • A to T, chromosome 14 at 70,558,107 bp
  • A to T, chromosome 14 at 117,888,520 bp
  • A to G, chromosome 15 at 76,668,620 bp
  • A to T, chromosome 15 at 89,373,808 bp
  • C to A, chromosome 16 at 37,062,153 bp
  • T to A, chromosome 16 at 72,978,772 bp
  • T to C, chromosome 16 at 91,616,312 bp
  • GAGACCAACGAGCAGCTGATGCTTCAGA to GAGA, chromosome 17 at 52,725,906 bp
  • A to T, chromosome 17 at 66,725,851 bp
  • G to T, chromosome 18 at 57,381,646 bp
  • G to A, chromosome 18 at 69,657,964 bp
  • C to T, chromosome 18 at 76,965,170 bp
  • A to G, chromosome 18 at 89,064,171 bp
  • A to G, chromosome 19 at 9,558,488 bp
  • A to T, chromosome 19 at 23,303,903 bp
  • A to G, chromosome X at 18,423,687 bp
Genotype Determination
G1 male heterozygous mice are viable and fertile. The G1 mice were not characterized prior to archiving.
Strain Development
C57BL/6J mice were injected with ENU, resulting in G0 mice that were bred back to C57BL/6J. Sperm was archived from G1 male mice that produced viable G2 mice.
Suggested Control Mice
Wild-type littermates or C57BL/6J mice
Bruce Beutler, M.D., University of Texas Southwestern Medical Center.
Primary Reference
MUTAGENETIX record for R2266 (G1). B. Beutler and colleagues, Center for the Genetics of Host Defense, UT Southwestern, Dallas, TX.

Colony and Husbandry Information

Colony Surveillance Program and Current Health Reports

Mice recovered from a cryo-archive will have health surveillance performed on recipient females. Health reports will be provided prior to shipment. If you require additional health status information, please email .
Coat Color
MMRRC Breeding System
Random intra-strain mating
Breeding Scheme(s)
When maintaining a live colony, heterozygous mice may be bred together, bred with wild-type siblings, or bred with C57BL/6J inbred mice.
Overall Breeding Performance
Undetermined; during development, mating was done with heterozygous males; viability, fertility and other breeding statistics for heterozygous females and homozygotes are unverified, but presumably would be similar to the C57BL/6J background strain
Average litter size
Recommended wean age
3 weeks

Order Request Information

Limited quantities of breeder mice (recovered litter) are available from a cryoarchive; recovered litter usually available to ship in 3 to 4 months.

Cryopreserved material may be available upon request, please inquire to for more information.

Distribution of this strain requires submission of the MMRRC Conditions of Use (COU). A link to the COU web form will be provided via email after an order has been placed; the form should be completed then or the email forwarded to your institutional official for completion.

The donor or their institution limits the distribution to non-profit institutions only.

Additional charges may apply for any special requests. Shipping costs are in addition to the basic distribution/resuscitation fees. Information on shipping costs and any additional charges will be provided by the supplying MMRRC facility.

Click button to Request this one strain. (Use the MMRRC Catalog Search to request more than one strain.)
MMRRC Item # Description Distribution Fee / Unit (US $)
*Shipping & Handling not included*
Units Notes
040266-MU-RESUS Litter recovered from cryo-archive $5,475.00 / Non-Profit Litter Recovered litter4; additional fees for any special requests.
Cryopreserved material may be available upon request, please inquire to for more information.

Some MMRRC strains were submitted by the donor as cryopreserved germplasm, and because these strains were not cryopreserved by the MMRRC, we have not assessed the quality of this material. We have extensive experience with recovery of mice from cryopreserved sperm and embryos of varying quality, including using techniques such as IVF and ICSI, and are confident that we will have success in most, if not all, cases. However, because of the unknown quality of these frozen samples, we will restrict recovery efforts to two attempts for each order. Subsequent attempts can be performed on a fee-for-service basis, in addition to the standard fees, upon request.

1 The distribution fee covers the expense of rederiving mice from a live mouse; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

2 An aliquot contains a sufficient number of embryos (in one or more vials or straws and based on the transfer success rate of the MMRRC facility) to transfer into one to three recipients. The MMRRC makes no guarantee concerning embryo transfer success experienced in the recipient investigator's laboratory. Neither gender nor genotype ratios are guaranteed.

3 An aliquot is one straw or vial with sufficient sperm to recover at least one litter of mice, as per provided protocols, when performed at the MMRRC facility. The MMRRC makes no guarantee concerning the success of these procedures when performed outside the MMRRC facilities.

4 The distribution fee covers the expense of resuscitating mice from the cryo-archive; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

To request material from the MMRRC: Please fill out our on-line request form (accessible from the catalog search results page, or click the Request this Strain button in the fees section). If you have questions or need assistance completing this form, you may call Customer Service at (800) 910-2291 (in USA or Canada) or (530) 757-5710 (international calls). Before you call, please have with you: the MMRRC item number, quantity needed, Bill-to and Ship-to contact information.