Loading Mouse GIF
Loading...

Strain Name:
C57BL/6J-MtgxR2270Btlr/Mmmh
Stock Number:
040270-MU
Citation ID:
RRID:MMRRC_040270-MU
Other Names:
R2270 (G1), C57BL/6J-MtgxR2270Btlr
Major Collection:

Strain Information

Ap4e1
Name: adaptor-related protein complex AP-4, epsilon 1
Synonyms: 2310033A20Rik
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 108011
HGNC: HGNC:573
Homologene: 22397
Chat
Name: choline O-acetyltransferase
Synonyms: B230380D24Rik
Type: Gene
Species: Mouse
Chromosome: 14
NCBI: 12647
VEGA: 14
HGNC: HGNC:1912
Homologene: 40693
Slc1a2
Name: solute carrier family 1 (glial high affinity glutamate transporter), member 2
Synonyms: GLT1, MGLT1, Eaat2, 1700091C19Rik, GLT-1, 2900019G14Rik
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 20511
Homologene: 3075
Ddc
Name: dopa decarboxylase
Synonyms: aromatic L-amino acid decarboxylase, Aadc
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 13195
HGNC: HGNC:2719
Homologene: 618
Phf12
Name: PHD finger protein 12
Synonyms: PF1, 2410142K10Rik
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 268448
Homologene: 10841
Usp7
Name: ubiquitin specific peptidase 7
Synonyms: 2210010O09Rik
Type: Gene
Species: Mouse
Chromosome: 16
NCBI: 252870
Homologene: 2592
Ndufv1
Name: NADH:ubiquinone oxidoreductase core subunit V1
Synonyms: 24 kDa (FP)
Type: Gene
Species: Mouse
Chromosome: 19
NCBI: 17995
HGNC: HGNC:7716
Homologene: 5151
Genetic Alterations
ENU-induced transitions at the following base pair locations (GRCm38):
  • A to T, chromosome 1 at 162,477,789 bp
  • C to T, chromosome 1 at 183,334,259 bp
  • T to A, chromosome 1 at 185,283,542 bp
  • T to C, chromosome 2 at 23,175,220 bp
  • T to C, chromosome 2 at 76,948,364 bp
  • T to G, chromosome 2 at 102,735,994 bp
  • T to C, chromosome 2 at 127,047,163 bp
  • T to A, chromosome 2 at 139,757,373 bp
  • A to T, chromosome 2 at 165,143,847 bp
  • A to G, chromosome 3 at 35,810,134 bp
  • T to A, chromosome 4 at 41,724,744 bp
  • A to G, chromosome 4 at 63,321,415 bp
  • A to C, chromosome 4 at 70,266,678 bp
  • T to C, chromosome 4 at 150,477,380 bp
  • T to C, chromosome 5 at 8,121,108 bp
  • T to G, chromosome 5 at 30,116,974 bp
  • G to T, chromosome 5 at 32,293,242 bp
  • T to A, chromosome 5 at 43,979,330 bp
  • A to G, chromosome 5 at 125,037,955 bp
  • A to G, chromosome 5 at 150,400,924 bp
  • T to A, chromosome 6 at 127,607,298 bp
  • T to C, chromosome 6 at 146,565,621 bp
  • T to C, chromosome 6 at 146,822,114 bp
  • T to A, chromosome 7 at 4,758,187 bp
  • T to C, chromosome 7 at 6,189,555 bp
  • A to G, chromosome 7 at 45,088,651 bp
  • CAAAAA to CAAAA, chromosome 8 at 84,716,247 bp
  • T to C, chromosome 8 at 84,965,419 bp
  • A to G, chromosome 9 at 14,815,174 bp
  • T to A, chromosome 9 at 20,171,409 bp
  • A to G, chromosome 9 at 36,719,686 bp
  • CAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGA to CAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGA, chromosome 9 at 119,160,716 bp
  • T to C, chromosome 10 at 58,455,927 bp
  • C to A, chromosome 10 at 88,551,407 bp
  • C to A, chromosome 10 at 128,482,280 bp
  • C to A, chromosome 11 at 3,969,524 bp
  • A to T, chromosome 11 at 8,836,197 bp
  • A to T, chromosome 11 at 11,418,272 bp
  • T to C, chromosome 11 at 11,835,764 bp
  • A to T, chromosome 11 at 51,644,305 bp
  • G to T, chromosome 11 at 77,984,175 bp
  • C to T, chromosome 11 at 83,069,935 bp
  • A to G, chromosome 11 at 100,756,853 bp
  • T to C, chromosome 11 at 102,864,781 bp
  • G to A, chromosome 11 at 105,348,431 bp
  • A to T, chromosome 12 at 84,009,981 bp
  • A to C, chromosome 12 at 113,144,866 bp
  • A to T, chromosome 13 at 67,592,233 bp
  • T to C, chromosome 14 at 32,454,581 bp
  • G to T, chromosome 14 at 50,486,037 bp
  • A to G, chromosome 14 at 55,634,100 bp
  • T to C, chromosome 14 at 75,332,147 bp
  • C to A, chromosome 14 at 80,011,875 bp
  • A to T, chromosome 14 at 121,479,994 bp
  • T to C, chromosome 16 at 8,698,469 bp
  • A to G, chromosome 16 at 15,654,817 bp
  • T to C, chromosome 16 at 31,956,951 bp
  • T to C, chromosome 17 at 35,149,536 bp
  • T to C, chromosome 17 at 57,003,462 bp
  • G to T, chromosome 18 at 74,733,925 bp
  • C to A, chromosome 19 at 4,008,347 bp
  • A to G, chromosome 19 at 6,061,231 bp
  • T to C, chromosome 19 at 18,703,370 bp
  • A to G, chromosome 19 at 30,578,631 bp
  • T to A, chromosome 19 at 34,510,890 bp
  • G to A, chromosome 19 at 57,077,431 bp
  • G to A, chromosome X at 151,856,463 bp
  • T to A, chromosome X at 152,790,570 bp
Genotype Determination
Phenotype
G1 male heterozygous mice are viable and fertile. The G1 mice were not characterized prior to archiving.
Strain GQC Summary
Gene Specific Genotyping:

To request gene-specific and other genotyping services for a strain, please contact the distribution MMRRC Center for more information.

Background Genetic Quality:

The MMRRC has developed a Genetic Quality Control pipeline using the MiniMUGA array to provide additional information to identify and validate genetic backgrounds of MMRRC strains. For more information on whether genetic background data is available, please contact MMRRC_GeneticQC@med.unc.edu. Note: that MiniMUGA genetic background data is not available on all strains, but can be ordered if desired.

Suggested Control Mice
Littermates of all relevant genotypes.
Donor
Bruce Beutler, M.D., University of Texas Southwestern Medical Center.
Primary Reference
MUTAGENETIX record for R2270 (G1). B. Beutler and colleagues, Center for the Genetics of Host Defense, UT Southwestern, Dallas, TX.
Strain Development
C57BL/6J mice were injected with ENU, resulting in G0 mice that were bred back to C57BL/6J. Sperm was archived from G1 male mice that produced viable G2 mice.


Disclaimer: If MMRRC Strain Genetic Quality Control (GQC; based on MiniMUGA genotyping and analysis) has been completed for this strain, the information might differ from the genetic background information provided by the submitter. MiniMUGA genetic analysis is done on a strain’s tissue samples taken when archived by or ordered from the assigned MMRRC Center.

Colony and Husbandry Information

Colony Surveillance Program and Current Health Reports

Mice recovered from a cryo-archive will have health surveillance performed on recipient females. Health reports will be provided prior to shipment. If you require additional health status information, please email mmrrc@missouri.edu.
Coat Color
Black
MMRRC Breeding System
Random intra-strain mating
Breeding Scheme(s)
When maintaining a live colony, heterozygous mice may be bred together, bred with wild-type siblings, or bred with C57BL/6J inbred mice.
Overall Breeding Performance
Undetermined; during development, mating was done with heterozygous males; viability, fertility and other breeding statistics for heterozygous females and homozygotes are unverified, but presumably would be similar to the C57BL/6J background strain
Average litter size
Undetermined
Recommended wean age
3 weeks

Order Information

Limited quantities of breeder mice (recovered litter) are available from a cryoarchive; recovered litter usually available to ship in 3 to 4 months.

Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

Distribution of this strain requires submission of the MMRRC Conditions of Use (COU). A link to the COU web form will be provided via email after an order has been placed; the form should be completed then or the email forwarded to your institutional official for completion.

The donor or their institution limits the distribution to non-profit institutions only.

Additional charges may apply for any special requests. Shipping costs are in addition to the basic distribution/resuscitation fees. Information on shipping costs and any additional charges will be provided by the supplying MMRRC facility.

Click button to Request this one strain. (Use the MMRRC Catalog Search to request more than one strain.)
MMRRC Item # Description Distribution Fee / Unit (US $)
*Shipping & Handling not included*
Units Notes
040270-MU-RESUS Litter recovered from cryo-archive $5,475.00 / Non-Profit Litter Recovered litter4; additional fees for any special requests.
Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

Some MMRRC strains were submitted by the donor as cryopreserved germplasm, and because these strains were not cryopreserved by the MMRRC, we have not assessed the quality, nor genotype, of this material. Our expertise in reviving mice from various qualities of frozen sperm and embryos, using methods like IVF and ICSI, gives us confidence in successful recoveries in most cases. However, due to the uncertain quality of these samples, we'll limit revival attempts to two per order. Additional attempts are available for a fee, on top of standard charges, if requested. It's important to note that some strains may lack the expected mutation, so we can't assure successful order fulfillment until we attempt to revive the strain.

1 The distribution fee covers the expense of rederiving mice from a live mouse; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

2 An aliquot contains a sufficient number of embryos (in one or more vials or straws and based on the transfer success rate of the MMRRC facility) to transfer into one to three recipients. The MMRRC makes no guarantee concerning embryo transfer success experienced in the recipient investigator's laboratory. Neither gender nor genotype ratios are guaranteed.

3 An aliquot is one straw or vial with sufficient sperm to recover at least one litter of mice, as per provided protocols, when performed at the MMRRC facility. The MMRRC makes no guarantee concerning the success of these procedures when performed outside the MMRRC facilities.

4 The distribution fee covers the expense of resuscitating mice from the cryo-archive; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

To request material from the MMRRC: Please fill out our on-line request form (accessible from the catalog search results page, or click the Request this Strain button in the fees section). If you have questions or need assistance completing this form, you may call Customer Service at (800) 910-2291 (in USA or Canada) or (530) 757-5710 (international calls). Before you call, please have with you: the MMRRC item number, quantity needed, Bill-to and Ship-to contact information.