Loading Mouse GIF
Loading...

Strain Name:
C57BL/6J-MtgxR2270Btlr/Mmmh
Stock Number:
040270-MU
Citation ID:
RRID:MMRRC_040270-MU
Other Names:
R2270 (G1), C57BL/6J-MtgxR2270Btlr
Major Collection:

Strain Information

Ap4e1
Name: adaptor-related protein complex AP-4, epsilon 1
Synonyms: 2310033A20Rik
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 108011
HGNC: HGNC:573
Homologene: 22397
Chat
Name: choline O-acetyltransferase
Synonyms: B230380D24Rik
Type: Gene
Species: Mouse
Chromosome: 14
NCBI: 12647
VEGA: 14
HGNC: HGNC:1912
Homologene: 40693
Slc1a2
Name: solute carrier family 1 (glial high affinity glutamate transporter), member 2
Synonyms: GLT1, MGLT1, Eaat2, 1700091C19Rik, GLT-1, 2900019G14Rik
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 20511
Homologene: 3075
Ddc
Name: dopa decarboxylase
Synonyms: aromatic L-amino acid decarboxylase, Aadc
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 13195
HGNC: HGNC:2719
Homologene: 618
Phf12
Name: PHD finger protein 12
Synonyms: PF1, 2410142K10Rik
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 268448
Homologene: 10841
Usp7
Name: ubiquitin specific peptidase 7
Synonyms: 2210010O09Rik
Type: Gene
Species: Mouse
Chromosome: 16
NCBI: 252870
Homologene: 2592
Ndufv1
Name: NADH:ubiquinone oxidoreductase core subunit V1
Synonyms: 24 kDa (FP)
Type: Gene
Species: Mouse
Chromosome: 19
NCBI: 17995
HGNC: HGNC:7716
Homologene: 5151
Prkdc
Name: protein kinase, DNA activated, catalytic polypeptide
Synonyms: DNA-PKcs, slip, DNAPDcs, XRCC7, DNA-PK, DOXNPH, dxnph
Type: Gene
Species: Mouse
Chromosome: 16
NCBI: 19090
HGNC: HGNC:9413
Homologene: 5037
Rab3gap2
Name: RAB3 GTPase activating protein subunit 2
Synonyms: 1110059F07Rik
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 98732
Homologene: 40842
Fry
Name: FRY microtubule binding protein
Synonyms: cg003, 9330186A19Rik
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 320365
Homologene: 113770
Zc3h13
Name: zinc finger CCCH type containing 13
Synonyms: C87618, 4930570G11Rik, 2600010B19Rik, 3110050K21Rik
Type: Gene
Species: Mouse
Chromosome: 14
NCBI: 67302
VEGA: 14
Cdk5rap2
Name: CDK5 regulatory subunit associated protein 2
Synonyms: 2900018K03Rik, an
Type: Gene
Species: Mouse
Chromosome: 4
NCBI: 214444
Homologene: 49533
Rere
Name: arginine glutamic acid dipeptide (RE) repeats
Synonyms: 1110033A15Rik, atrophin-2, Atr2, eyem03Jus, eyes3
Type: Gene
Species: Mouse
Chromosome: 4
NCBI: 68703
HGNC: HGNC:9965
Homologene: 8101
Carnmt1
Name: carnosine N-methyltransferase 1
Synonyms: 2410127L17Rik
Type: Gene
Species: Mouse
Chromosome: 19
NCBI: 67383
VEGA: 19
Homologene: 6806
Eftud2
Name: elongation factor Tu GTP binding domain containing 2
Synonyms: U5-116kD, 116kDa, Snrp116
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 20624
Homologene: 3133
Prrc2a
Name: proline-rich coiled-coil 2A
Synonyms: G2, Bat-2, D17H6S51E, Wbp12, 3110039B05Rik, Bat2
Type: Gene
Species: Mouse
Chromosome: 17
NCBI: 53761
Homologene: 10567
Ncor2
Name: nuclear receptor co-repressor 2
Synonyms: SMRTe, SMRT
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 20602
HGNC: HGNC:7673
Homologene: 31370
Chek1
Name: checkpoint kinase 1
Synonyms: Chk1
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 12649
HGNC: HGNC:1925
Homologene: 975
Huwe1
Name: HECT, UBA and WWE domain containing 1
Synonyms: Ib772, 5430439H10Rik, LOC382250, Ureb1, C430014N20Rik, Mule, Arf-bp1
Type: Gene
Species: Mouse
Chromosome: X
NCBI: 59026
Homologene: 45994
Gtf2f1
Name: general transcription factor IIF, polypeptide 1
Synonyms: 2810405L04Rik
Type: Gene
Species: Mouse
Chromosome: 17
NCBI: 98053
VEGA: 17
HGNC: HGNC:4652
Homologene: 1585
Rnaseh2a
Name: ribonuclease H2, large subunit
Synonyms: 2400006P09Rik
Type: Gene
Species: Mouse
Chromosome: 8
NCBI: 69724
Homologene: 4664
Crip2
Name: cysteine rich protein 2
Synonyms: Crp, 0610010I23Rik, Hlp, ESP1, CRP4
Type: Gene
Species: Mouse
Chromosome: 12
NCBI: 68337
HGNC: HGNC:2361
Homologene: 133917
Slfn2
Name: schlafen 2
Synonyms: Shlf2
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 20556
Homologene: 133205
Olfm4
Name: olfactomedin 4
Synonyms: LOC239192, LOC380924, GC1, OlfD, GW112, pPD4
Type: Gene
Species: Mouse
Chromosome: 14
NCBI: 380924
VEGA: 14
Homologene: 4684
Yme1l1
Name: YME1-like 1 (S. cerevisiae)
Synonyms: Ftsh, ATP-dependent metalloprotease FtsH1
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 27377
Homologene: 31996
Pes1
Name: pescadillo ribosomal biogenesis factor 1
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 64934
HGNC: HGNC:8848
Homologene: 5984
Ncbp2
Name: nuclear cap binding protein subunit 2
Synonyms: 20kDa
Type: Gene
Species: Mouse
Chromosome: 16
NCBI: 68092
Homologene: 56377
Pkd1l1
Name: polycystic kidney disease 1 like 1
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 171395
Homologene: 51376
Prkg1
Name: protein kinase, cGMP-dependent, type I
Synonyms: Prkgr1b, Prkg1b
Type: Gene
Species: Mouse
Chromosome: 19
NCBI: 19091
HGNC: HGNC:9414
Homologene: 55964
Smarcc2
Name: SWI/SNF related, matrix associated, actin dependent regulator of chromatin, subfamily c, member 2
Synonyms: 5930405J04Rik
Type: Gene
Species: Mouse
Chromosome: 10
NCBI: 68094
VEGA: 10
Homologene: 2312
Ttn
Name: titin
Synonyms: connectin, L56, mdm, 1100001C23Rik, D830007G01Rik, 2310036G12Rik, 2310074I15Rik, 2310057K23Rik, D330041I19Rik, shru
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 22138
Homologene: 130650
Col27a1
Name: collagen, type XXVII, alpha 1
Synonyms: 5730512J02Rik
Type: Gene
Species: Mouse
Chromosome: 4
NCBI: 373864
Homologene: 69400
Plb1
Name: phospholipase B1
Synonyms: 4632413E21Rik, 4930433E17Rik, 4930539A06Rik
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 665270
Homologene: 82108
Kcnh4
Name: potassium voltage-gated channel, subfamily H (eag-related), member 4
Synonyms: BEC2
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 380728
HGNC: HGNC:6253
Homologene: 8180
Atp11b
Name: ATPase, class VI, type 11B
Synonyms: 1110019I14Rik
Type: Gene
Species: Mouse
Chromosome: 3
NCBI: 76295
Homologene: 32919
Mre11a
Name: MRE11A homolog A, double strand break repair nuclease
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 17535
HGNC: HGNC:7230
Homologene: 4083
Bmal2
Name: basic helix-loop-helix ARNT like 2
Synonyms: 4632430A05Rik, MOP9, bHLHe6, Arntl2
Type: Gene
Species: Mouse
Chromosome: 6
NCBI: 272322
Homologene: 10609
Dnm3
Name: dynamin 3
Synonyms: B230343F03Rik, 9630020E24Rik
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 103967
Homologene: 22906
Lipa
Name: lysosomal acid lipase A
Synonyms: Lal, Lip-1, Lip1
Type: Gene
Species: Mouse
Chromosome: 19
NCBI: 16889
VEGA: 19
HGNC: HGNC:6617
Homologene: 37277
4933424B01Rik
Name:
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 6
Or11g25
Name: olfactory receptor family 11 subfamily G member 25
Synonyms: GA_x6K02T2PMLR-6197851-6198786, MOR106-10, MOR106-15, Olfr741
Type: Gene
Species: Mouse
Chromosome: 14
NCBI: 258233
Acot1
Name: acyl-CoA thioesterase 1
Synonyms: D12Ucla1, CTE-1, ACH2, CTE-I, Cte1
Type: Gene
Species: Mouse
Chromosome: 12
NCBI: 26897
VEGA: 12
Homologene: 22686
Ablim1
Name: actin-binding LIM protein 1
Synonyms: Limab1, 4833406P10Rik, abLIM-S, abLIM-M, abLIM-L, 2610209L21Rik, 9330196J19Rik, 2210411C18Rik
Type: Gene
Species: Mouse
Chromosome: 19
NCBI: 226251
HGNC: HGNC:78
Homologene: 40994
Mybpc1
Name: myosin binding protein C, slow-type
Synonyms: Slow-type C-protein, 8030451F13Rik
Type: Gene
Species: Mouse
Chromosome: 10
NCBI: 109272
HGNC: HGNC:7549
Homologene: 1846
Or8b12i
Name: olfactory receptor family 8 subfamily B member 12I
Synonyms: GA_x6K02T2PVTD-13912679-13911744, MOR141-1, Olfr870
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 57251
Homologene: 138319
Cracr2a
Name: calcium release activated channel regulator 2A
Synonyms: LOC381812, LOC243645, Efcab4b
Type: Gene
Species: Mouse
Chromosome: 6
NCBI: 381812
Homologene: 41883
Adam22
Name: a disintegrin and metallopeptidase domain 22
Synonyms: MDC2, 2900022I03Rik
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 11496
HGNC: HGNC:201
Homologene: 37898
Garin5b
Name: golgi associated RAB2 interactor family member 5B
Synonyms: 4930401F20Rik, Fam71e2
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 243822
Homologene: 89225
Garem2
Name: GRB2 associated regulator of MAPK1 subtype 2
Synonyms: LOC242915, Fam59b, Gareml
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 242915
Homologene: 19063
Ism1
Name: isthmin 1, angiogenesis inhibitor
Synonyms: 5430433G21Rik
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 319909
Homologene: 19061
Mrc2
Name: mannose receptor, C type 2
Synonyms: novel lectin, Endo180, uPARAP
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 17534
Homologene: 4408
Ipo4
Name: importin 4
Synonyms: 8430408O15Rik
Type: Gene
Species: Mouse
Chromosome: 14
NCBI: 75751
Homologene: 5835
Rcn3
Name: reticulocalbin 3, EF-hand calcium binding domain
Synonyms: 6030455P07Rik, RLP49, D7Ertd671e, D530026G20Rik
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 52377
Homologene: 10775
Zfp444
Name: zinc finger protein 444
Synonyms: 2810031J10Rik, 6230401O10Rik
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 72667
Homologene: 10139
Arid3c
Name: AT-rich interaction domain 3C
Synonyms: OTTMUSG00000006683
Type: Gene
Species: Mouse
Chromosome: 4
NCBI: 550619
Homologene: 72499
Cdh22
Name: cadherin 22
Synonyms: PB-cadherin
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 104010
Homologene: 23148
Gm10608
Name: predicted gene 10608
Synonyms: EG546165
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 546165
VEGA: 9
CAAA01083517.1
Name:
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 1
Fgfbp1
Name: fibroblast growth factor binding protein 1
Synonyms: FGF-BP
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 14181
Homologene: 3766
Znhit2
Name: zinc finger, HIT domain containing 2
Synonyms: ORF6, Znhit2-ps
Type: Gene
Species: Mouse
Chromosome: 19
NCBI: 29805
HGNC: HGNC:1177
Homologene: 8477
N4bp3
Name: NEDD4 binding protein 3
Synonyms: C330016O10Rik
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 212706
Homologene: 17124
Slc15a1
Name: solute carrier family 15 (oligopeptide transporter), member 1
Synonyms: PECT1, PEPT1
Type: Gene
Species: Mouse
Chromosome: 14
NCBI: 56643
VEGA: 14
Homologene: 38006
Zpbp
Name: zona pellucida binding protein
Synonyms: Sp38, 4930486K01Rik
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 53604
Homologene: 5092
Gpr143
Name: G protein-coupled receptor 143
Synonyms: Oa1
Type: Gene
Species: Mouse
Chromosome: X
NCBI: 18241
Homologene: 230
Zfp729b
Name: zinc finger protein 729b
Synonyms: AA987161
Type: Gene
Species: Mouse
Chromosome: 13
NCBI: 100416706
Homologene: 133713
Genetic Alterations
ENU-induced transitions at the following base pair locations (GRCm38):
  • A to T, chromosome 1 at 162,477,789 bp
  • C to T, chromosome 1 at 183,334,259 bp
  • T to A, chromosome 1 at 185,283,542 bp
  • T to C, chromosome 2 at 23,175,220 bp
  • T to C, chromosome 2 at 76,948,364 bp
  • T to G, chromosome 2 at 102,735,994 bp
  • T to C, chromosome 2 at 127,047,163 bp
  • T to A, chromosome 2 at 139,757,373 bp
  • A to T, chromosome 2 at 165,143,847 bp
  • A to G, chromosome 3 at 35,810,134 bp
  • T to A, chromosome 4 at 41,724,744 bp
  • A to G, chromosome 4 at 63,321,415 bp
  • A to C, chromosome 4 at 70,266,678 bp
  • T to C, chromosome 4 at 150,477,380 bp
  • T to C, chromosome 5 at 8,121,108 bp
  • T to G, chromosome 5 at 30,116,974 bp
  • G to T, chromosome 5 at 32,293,242 bp
  • T to A, chromosome 5 at 43,979,330 bp
  • A to G, chromosome 5 at 125,037,955 bp
  • A to G, chromosome 5 at 150,400,924 bp
  • T to A, chromosome 6 at 127,607,298 bp
  • T to C, chromosome 6 at 146,565,621 bp
  • T to C, chromosome 6 at 146,822,114 bp
  • T to A, chromosome 7 at 4,758,187 bp
  • T to C, chromosome 7 at 6,189,555 bp
  • A to G, chromosome 7 at 45,088,651 bp
  • CAAAAA to CAAAA, chromosome 8 at 84,716,247 bp
  • T to C, chromosome 8 at 84,965,419 bp
  • A to G, chromosome 9 at 14,815,174 bp
  • T to A, chromosome 9 at 20,171,409 bp
  • A to G, chromosome 9 at 36,719,686 bp
  • CAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGA to CAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGA, chromosome 9 at 119,160,716 bp
  • T to C, chromosome 10 at 58,455,927 bp
  • C to A, chromosome 10 at 88,551,407 bp
  • C to A, chromosome 10 at 128,482,280 bp
  • C to A, chromosome 11 at 3,969,524 bp
  • A to T, chromosome 11 at 8,836,197 bp
  • A to T, chromosome 11 at 11,418,272 bp
  • T to C, chromosome 11 at 11,835,764 bp
  • A to T, chromosome 11 at 51,644,305 bp
  • G to T, chromosome 11 at 77,984,175 bp
  • C to T, chromosome 11 at 83,069,935 bp
  • A to G, chromosome 11 at 100,756,853 bp
  • T to C, chromosome 11 at 102,864,781 bp
  • G to A, chromosome 11 at 105,348,431 bp
  • A to T, chromosome 12 at 84,009,981 bp
  • A to C, chromosome 12 at 113,144,866 bp
  • A to T, chromosome 13 at 67,592,233 bp
  • T to C, chromosome 14 at 32,454,581 bp
  • G to T, chromosome 14 at 50,486,037 bp
  • A to G, chromosome 14 at 55,634,100 bp
  • T to C, chromosome 14 at 75,332,147 bp
  • C to A, chromosome 14 at 80,011,875 bp
  • A to T, chromosome 14 at 121,479,994 bp
  • T to C, chromosome 16 at 8,698,469 bp
  • A to G, chromosome 16 at 15,654,817 bp
  • T to C, chromosome 16 at 31,956,951 bp
  • T to C, chromosome 17 at 35,149,536 bp
  • T to C, chromosome 17 at 57,003,462 bp
  • G to T, chromosome 18 at 74,733,925 bp
  • C to A, chromosome 19 at 4,008,347 bp
  • A to G, chromosome 19 at 6,061,231 bp
  • T to C, chromosome 19 at 18,703,370 bp
  • A to G, chromosome 19 at 30,578,631 bp
  • T to A, chromosome 19 at 34,510,890 bp
  • G to A, chromosome 19 at 57,077,431 bp
  • G to A, chromosome X at 151,856,463 bp
  • T to A, chromosome X at 152,790,570 bp
Genotype Determination
Phenotype
G1 male heterozygous mice are viable and fertile. The G1 mice were not characterized prior to archiving.
Strain Development
C57BL/6J mice were injected with ENU, resulting in G0 mice that were bred back to C57BL/6J. Sperm was archived from G1 male mice that produced viable G2 mice.
Suggested Control Mice
Wild-type littermates or C57BL/6J mice
MMRRC Genetic QC Summary
The MMRRC Centers have developed a genetic QC pipeline using MiniMUGA array genotyping to provide additional information on strain backgrounds for MMRRC congenic and inbred strains. For more information on when data may be available, or to request genotyping for a strain of interest, please contact mmrrc@missouri.edu. Older strains may not have this information.
Donor
Bruce Beutler, M.D., University of Texas Southwestern Medical Center.
Primary Reference
MUTAGENETIX record for R2270 (G1). B. Beutler and colleagues, Center for the Genetics of Host Defense, UT Southwestern, Dallas, TX.

Colony and Husbandry Information

Colony Surveillance Program and Current Health Reports

Mice recovered from a cryo-archive will have health surveillance performed on recipient females. Health reports will be provided prior to shipment. If you require additional health status information, please email mmrrc@missouri.edu.
Coat Color
Black
MMRRC Breeding System
Random intra-strain mating
Breeding Scheme(s)
When maintaining a live colony, heterozygous mice may be bred together, bred with wild-type siblings, or bred with C57BL/6J inbred mice.
Overall Breeding Performance
Undetermined; during development, mating was done with heterozygous males; viability, fertility and other breeding statistics for heterozygous females and homozygotes are unverified, but presumably would be similar to the C57BL/6J background strain
Average litter size
Undetermined
Recommended wean age
3 weeks

Order Request Information

Limited quantities of breeder mice (recovered litter) are available from a cryoarchive; recovered litter usually available to ship in 3 to 4 months.

Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

Distribution of this strain requires submission of the MMRRC Conditions of Use (COU). A link to the COU web form will be provided via email after an order has been placed; the form should be completed then or the email forwarded to your institutional official for completion.

The donor or their institution limits the distribution to non-profit institutions only.

Additional charges may apply for any special requests. Shipping costs are in addition to the basic distribution/resuscitation fees. Information on shipping costs and any additional charges will be provided by the supplying MMRRC facility.

Click button to Request this one strain. (Use the MMRRC Catalog Search to request more than one strain.)
MMRRC Item # Description Distribution Fee / Unit (US $)
*Shipping & Handling not included*
Units Notes
040270-MU-RESUS Litter recovered from cryo-archive $5,475.00 / Non-Profit Litter Recovered litter4; additional fees for any special requests.
Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

Some MMRRC strains were submitted by the donor as cryopreserved germplasm, and because these strains were not cryopreserved by the MMRRC, we have not assessed the quality, nor genotype, of this material. Our expertise in reviving mice from various qualities of frozen sperm and embryos, using methods like IVF and ICSI, gives us confidence in successful recoveries in most cases. However, due to the uncertain quality of these samples, we'll limit revival attempts to two per order. Additional attempts are available for a fee, on top of standard charges, if requested. It's important to note that some strains may lack the expected mutation, so we can't assure successful order fulfillment until we attempt to revive the strain.

1 The distribution fee covers the expense of rederiving mice from a live mouse; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

2 An aliquot contains a sufficient number of embryos (in one or more vials or straws and based on the transfer success rate of the MMRRC facility) to transfer into one to three recipients. The MMRRC makes no guarantee concerning embryo transfer success experienced in the recipient investigator's laboratory. Neither gender nor genotype ratios are guaranteed.

3 An aliquot is one straw or vial with sufficient sperm to recover at least one litter of mice, as per provided protocols, when performed at the MMRRC facility. The MMRRC makes no guarantee concerning the success of these procedures when performed outside the MMRRC facilities.

4 The distribution fee covers the expense of resuscitating mice from the cryo-archive; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

To request material from the MMRRC: Please fill out our on-line request form (accessible from the catalog search results page, or click the Request this Strain button in the fees section). If you have questions or need assistance completing this form, you may call Customer Service at (800) 910-2291 (in USA or Canada) or (530) 757-5710 (international calls). Before you call, please have with you: the MMRRC item number, quantity needed, Bill-to and Ship-to contact information.