Strain Name:
C57BL/6J-MtgxR2273Btlr/Mmmh
Stock Number:
040273-MU
Citation ID:
RRID:MMRRC_040273-MU
Other Names:
R2273 (G1), C57BL/6J-MtgxR2273Btlr
Major Collection:

Gene Information

Tyrp1
Name: tyrosinase-related protein 1
Synonyms: Tyrp, isa, TRP-1, TRP1, Oca3
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 4
NCBI: 22178
Homologene: 464
Arhgef7
Name: Rho guanine nucleotide exchange factor (GEF7)
Synonyms: Cool, PIX, Pak interacting exchange factor, p85SPR, betaPix-c, betaPix-b, cool-1, betaPix
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 8
NCBI: 54126
Homologene: 2895
Fn1
Name: fibronectin 1
Synonyms: Fn-1, Fn
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 1
NCBI: 14268
HGNC: HGNC:3778
Homologene: 1533
Vldlr
Name: very low density lipoprotein receptor
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 19
NCBI: 22359
Homologene: 443
Kcnc1
Name: potassium voltage gated channel, Shaw-related subfamily, member 1
Synonyms: Kv3.1, KV4, NGK2, KShIIIB, Kcr2-1, Shaw, C230009H10Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 7
NCBI: 16502
HGNC: HGNC:6233
Homologene: 68134
Cacna1g
Name: calcium channel, voltage-dependent, T type, alpha 1G subunit
Synonyms: a1G, Cav3.1d
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 11
NCBI: 12291
HGNC: HGNC:1394
Homologene: 22544
Tjp2
Name: tight junction protein 2
Synonyms: ZO-2
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 19
NCBI: 21873
VEGA: 19
Homologene: 3541
Ciapin1
Name: cytokine induced apoptosis inhibitor 1
Synonyms: anamorsin, 2810413N20Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 8
NCBI: 109006
Homologene: 10658
Atl3
Name: atlastin GTPase 3
Synonyms: 4633402C03Rik, 5730596K20Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 19
NCBI: 109168
VEGA: 19
Homologene: 9149
Map1b
Name: microtubule-associated protein 1B
Synonyms: MAP5, Mtap-5, Mtap5, LC1, Mtap1b
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 13
NCBI: 17755
VEGA: 13
HGNC: HGNC:6836
Homologene: 38111
Cdr2
Name: cerebellar degeneration-related 2
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 7
NCBI: 12585
HGNC: HGNC:1799
Homologene: 7262
Atp6v1h
Name: ATPase, H+ transporting, lysosomal V1 subunit H
Synonyms: 0710001F19Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 1
NCBI: 108664
Homologene: 7139
Usp1
Name: ubiquitin specific peptidase 1
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 4
NCBI: 230484
Homologene: 2528
Kifap3
Name: kinesin-associated protein 3
Synonyms: KAP3
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 1
NCBI: 16579
Homologene: 7799
Cdc42bpb
Name: CDC42 binding protein kinase beta
Synonyms: DMPK-like
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 12
NCBI: 217866
VEGA: 12
HGNC: HGNC:1738
Homologene: 55945
Ptpn2
Name: protein tyrosine phosphatase, non-receptor type 2
Synonyms: Ptpt, TC-PTP
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 18
NCBI: 19255
HGNC: HGNC:9650
Homologene: 7497
Setx
Name: senataxin
Synonyms: A930037J23Rik, Als4
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 2
NCBI: 269254
HGNC: HGNC:445
Homologene: 41003
Ddx5
Name: DEAD box helicase 5
Synonyms: p68, Hlr1, 2600009A06Rik, DEAD (Asp-Glu-Ala-Asp) box polypeptide 5
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 11
NCBI: 13207
HGNC: HGNC:2746
Homologene: 6797
Ank3
Name: ankyrin 3, epithelial
Synonyms: Ank-3, Ankyrin-3, AnkG, 2900054D09Rik, Ankyrin-G
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 10
NCBI: 11735
HGNC: HGNC:494
Homologene: 56908
Slc12a3
Name: solute carrier family 12, member 3
Synonyms: NCC, TSC
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 8
NCBI: 20497
Homologene: 287
Mier2
Name: MIER family member 2
Synonyms: 2700087H15Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 10
NCBI: 70427
Homologene: 18941
Ackr1
Name: atypical chemokine receptor 1 (Duffy blood group)
Synonyms: CCBP1, FY, CD234, ESTM35, Dfy, Darc
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 1
NCBI: 13349
HGNC: HGNC:4035
Homologene: 48067
Lrig1
Name: leucine-rich repeats and immunoglobulin-like domains 1
Synonyms: LIG-1, Img
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 6
NCBI: 16206
Homologene: 7380
Rph3a
Name: rabphilin 3A
Synonyms: 2900002P20Rik, Doc2 family
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 5
NCBI: 19894
Homologene: 7921
Tsr1
Name: TSR1 20S rRNA accumulation
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 11
NCBI: 104662
Homologene: 5576
Cecr2
Name: CECR2, histone acetyl-lysine reader
Synonyms: 2810409N01Rik, 2610101O16Rik, Gtl4, cat eye syndrome chromosome region, candidate 2
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 6
NCBI: 330409
HGNC: HGNC:1840
Homologene: 64662
Vps13b
Name: vacuolar protein sorting 13B
Synonyms: 1810042B05Rik, Coh1, C330002D13Rik, 2310042E16Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 15
NCBI: 666173
VEGA: 15
HGNC: HGNC:2183
Homologene: 49516
Ubr3
Name: ubiquitin protein ligase E3 component n-recognin 3
Synonyms: 4833421P10Rik, A130030D10Rik, 1110059H15Rik, Zfp650
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 2
NCBI: 68795
Homologene: 52092
Crim1
Name: cysteine rich transmembrane BMP regulator 1 (chordin like)
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 17
NCBI: 50766
VEGA: 17
HGNC: HGNC:2359
Homologene: 9510
Cpxm2
Name: carboxypeptidase X 2 (M14 family)
Synonyms: 4632435C11Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 7
NCBI: 55987
Homologene: 69259
Abcf3
Name: ATP-binding cassette, sub-family F (GCN20), member 3
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 16
NCBI: 27406
HGNC: HGNC:72
Homologene: 22784
Usp42
Name: ubiquitin specific peptidase 42
Synonyms: 3110031A07Rik, 2410140K03Rik, D5Ertd591e, A630018G05Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 5
NCBI: 76800
Homologene: 35425
Rrm2b
Name: ribonucleotide reductase M2 B (TP53 inducible)
Synonyms: p53R2
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 15
NCBI: 382985
Homologene: 56723
Dock8
Name: dedicator of cytokinesis 8
Synonyms: 1200017A24Rik, 5830472H07Rik, A130095G14Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 19
NCBI: 76088
VEGA: 19
Homologene: 52414
Col9a2
Name: collagen, type IX, alpha 2
Synonyms: Col9a-2
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 4
NCBI: 12840
HGNC: HGNC:2218
Homologene: 37535
Pcdhb4
Name: protocadherin beta 4
Synonyms: Pcdhb5A, PcdhbD
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 18
NCBI: 93875
Homologene: 62176
Fat3
Name: FAT atypical cadherin 3
Synonyms: LOC234973, LOC382129, D430038H04Rik, 9430076A06Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 9
NCBI: 270120
VEGA: 9
Homologene: 82252
Hivep2
Name: human immunodeficiency virus type I enhancer binding protein 2
Synonyms: MIBP1, Schnurri-2, Shn-2, Gm20114
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 10
NCBI: 15273
HGNC: HGNC:4921
Homologene: 4900
Zhx2
Name: zinc fingers and homeoboxes 2
Synonyms: Raf, Afr-1, Afr1
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 15
NCBI: 387609
Homologene: 8968
Mrc1
Name: mannose receptor, C type 1
Synonyms: CD206, MR
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 2
NCBI: 17533
HGNC: HGNC:7228
Homologene: 37622
Lrrc7
Name: leucine rich repeat containing 7
Synonyms: densin
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 3
NCBI: 242274
Homologene: 10817
Farp2
Name: FERM, RhoGEF and pleckstrin domain protein 2
Synonyms: Fir, D030026M03Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 1
NCBI: 227377
Homologene: 8877
Atp11b
Name: ATPase, class VI, type 11B
Synonyms: 1110019I14Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 3
NCBI: 76295
Homologene: 32919
Odad2
Name: outer dynein arm docking complex subunit 2
Synonyms: 4930463I21Rik, Armc4, b2b227.1Clo, b2b643Clo
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 18
NCBI: 74934
VEGA: 18
Homologene: 9992
Gpr158
Name: G protein-coupled receptor 158
Synonyms: 5330427M13Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 2
NCBI: 241263
Homologene: 19381
Olfr998
Name: olfactory receptor 998
Synonyms: GA_x6K02T2Q125-47069356-47070300, MOR175-5
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 2
NCBI: 258428
Homologene: 74236
Abca5
Name: ATP-binding cassette, sub-family A (ABC1), member 5
Synonyms: ABC13, B930033A02Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 11
NCBI: 217265
HGNC: HGNC:35
Homologene: 10263
Vmn2r94
Name: vomeronasal 2, receptor 94
Synonyms: EG665227
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 17
NCBI: 665227
Homologene: 129751
Adamts18
Name: a disintegrin-like and metallopeptidase (reprolysin type) with thrombospondin type 1 motif, 18
Synonyms: E130314N14Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 8
NCBI: 208936
Homologene: 65241
Dnlz
Name: DNL-type zinc finger
Synonyms: 1110034G11Rik, D2Bwg1335e
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 2
NCBI: 52838
Homologene: 36864
Tmcc3
Name: transmembrane and coiled coil domains 3
Synonyms: C630016B22Rik, LOC380656, A230066D03Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 10
NCBI: 319880
Homologene: 10792
Olfr314
Name: olfactory receptor 314
Synonyms: GA_x6K02T2NKPP-622179-621244, MOR278-2
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 11
NCBI: 257917
Homologene: 133891
Itgav
Name: integrin alpha V
Synonyms: vitronectin receptor alpha polypeptide (VNRA), CD51, alphav-integrin, 1110004F14Rik, 2610028E01Rik, D430040G12Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 2
NCBI: 16410
HGNC: HGNC:6150
Homologene: 20510
Olfr1170
Name: olfactory receptor 1170
Synonyms: GA_x6K02T2Q125-49709783-49708833, MOR174-12
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 2
NCBI: 258525
Homologene: 138307
F11
Name: coagulation factor XI
Synonyms: plasma thromboplastin antecedent, FXI, Cf11, 1600027G01Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 8
NCBI: 109821
HGNC: HGNC:3529
Homologene: 86654
Slc46a1
Name: solute carrier family 46, member 1
Synonyms: 1110002C08Rik, D11Ertd18e, HCP1, heme carrier protein 1, PCFT
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 11
NCBI: 52466
Homologene: 41693
Sned1
Name: sushi, nidogen and EGF-like domains 1
Synonyms: 6720455I24Rik, Snep, D430044C15Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 1
NCBI: 208777
Homologene: 14708
Cfh
Name: complement component factor h
Synonyms: Sas-1, Mud-1, Sas1
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 1
NCBI: 12628
HGNC: HGNC:4883
Homologene: 20086
Sult1d1
Name: sulfotransferase family 1D, member 1
Synonyms: tyrosine-ester sulfotransferase, 5033411P13Rik, Sultn
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 5
NCBI: 53315
Homologene: 124464
Zc3h6
Name: zinc finger CCCH type containing 6
Synonyms: 4631426G04Rik, 4833425H18Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 2
NCBI: 78751
Homologene: 35328
D7Ertd443e
Name: DNA segment, Chr 7, ERATO Doi 443, expressed
Synonyms: 4933400E14Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 7
NCBI: 71007
Homologene: 18998
Marchf1
Name: membrane associated ring-CH-type finger 1
Synonyms: 2900024D24Rik, March1
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 8
NCBI: 72925
Homologene: 113749
Ift88
Name: intraflagellar transport 88
Synonyms: Tg737, Oak Ridge polycystic kidneys, polaris, orpk, fxo, IFT88, TgN737Rpw, Tg737Rpw, Ttc10
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 14
NCBI: 21821
Homologene: 4761
Bco1
Name: beta-carotene oxygenase 1
Synonyms: beta-CD, Bcdo, Bcdo1, betaCMOOX, Cmoi, Bcmo1
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 8
NCBI: 63857
Homologene: 41172
Gm11568
Name: predicted gene 11568
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 11
NCBI: 432600
Iqck
Name: IQ motif containing K
Synonyms: A230094G09Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 7
NCBI: 434232
Homologene: 45162
Ly9
Name: lymphocyte antigen 9
Synonyms: T100, Lgp100, CD229, SLAMF3
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 1
NCBI: 17085
HGNC: HGNC:6730
Homologene: 1759
Fdxacb1
Name: ferredoxin-fold anticodon binding domain containing 1
Synonyms: D630004A14Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 9
NCBI: 382137
Homologene: 19813
Vmn1r232
Name: vomeronasal 1 receptor 232
Synonyms: V1re4
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 17
NCBI: 171227
Homologene: 121611
AC124724.1
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 19
Prxl2b
Name: peroxiredoxin like 2B
Synonyms: PM/PGFS, 2810405K02Rik, Fam213b
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 4
NCBI: 66469
Homologene: 11976
2300003K06Rik
Name: RIKEN cDNA 2300003K06 gene
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 11
NCBI: 100502865
Slfn9
Name: schlafen 9
Synonyms: 9830137M10Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 11
NCBI: 237886
Homologene: 45432
Nt5c1a
Name: 5'-nucleotidase, cytosolic IA
Synonyms: Cn1a, LOC230718
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 4
NCBI: 230718
Homologene: 57173
Hoxd1
Name: homeobox D1
Synonyms: Hox-4.9
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 2
NCBI: 15429
HGNC: HGNC:5132
Homologene: 7772
Olfr781
Name: olfactory receptor 781
Synonyms: GA_x6K02T2PULF-11013616-11014551, MOR114-6
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 10
NCBI: 258723
Homologene: 37000
Nrarp
Name: Notch-regulated ankyrin repeat protein
Synonyms: 2700054M22Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 2
NCBI: 67122
Homologene: 32649
Genetic Alterations
ENU-induced transitions at the following base pair locations (GRCm38):
  • T to A, chromosome 1 at 5,117,476 bp
  • C to T, chromosome 1 at 71,613,943 bp
  • T to A, chromosome 1 at 93,281,642 bp
  • A to T, chromosome 1 at 93,528,789 bp
  • C to T, chromosome 1 at 140,102,825 bp
  • T to A, chromosome 1 at 163,868,758 bp
  • A to G, chromosome 1 at 171,594,195 bp
  • T to C, chromosome 1 at 173,332,485 bp
  • G to A, chromosome 2 at 14,325,372 bp
  • A to T, chromosome 2 at 21,826,863 bp
  • T to C, chromosome 2 at 25,181,409 bp
  • A to T, chromosome 2 at 26,351,471 bp
  • GTGGCT to GT, chromosome 2 at 29,154,061 bp
  • T to C, chromosome 2 at 70,016,341 bp
  • A to G, chromosome 2 at 74,764,157 bp
  • A to G, chromosome 2 at 83,783,801 bp
  • G to T, chromosome 2 at 85,590,588 bp
  • A to G, chromosome 2 at 88,224,823 bp
  • T to C, chromosome 2 at 129,014,709 bp
  • A to G, chromosome 3 at 35,828,613 bp
  • A to G, chromosome 3 at 158,187,059 bp
  • A to T, chromosome 4 at 80,837,534 bp
  • T to C, chromosome 4 at 98,929,842 bp
  • C to G, chromosome 4 at 121,054,258 bp
  • T to C, chromosome 4 at 123,216,080 bp
  • A to G, chromosome 4 at 154,898,683 bp
  • T to G, chromosome 5 at 87,556,028 bp
  • C to T, chromosome 5 at 120,973,304 bp
  • T to G, chromosome 5 at 143,721,629 bp
  • A to T, chromosome 6 at 94,608,143 bp
  • C to T, chromosome 6 at 120,756,741 bp
  • A to G, chromosome 7 at 46,427,802 bp
  • G to A, chromosome 7 at 118,899,657 bp
  • A to T, chromosome 7 at 120,958,509 bp
  • TGCAGCAGCAGCAGCAGCAG to TGCAGCAGCAGCAGCAG, chromosome 7 at 132,059,852 bp
  • A to G, chromosome 7 at 134,270,201 bp
  • T to A, chromosome 8 at 11,815,010 bp
  • T to C, chromosome 8 at 45,252,147 bp
  • T to A, chromosome 8 at 66,387,499 bp
  • T to A, chromosome 8 at 94,333,287 bp
  • A to T, chromosome 8 at 94,831,787 bp
  • T to C, chromosome 8 at 113,738,787 bp
  • G to A, chromosome 8 at 117,108,783 bp
  • T to C, chromosome 9 at 15,915,262 bp
  • A to G, chromosome 9 at 50,772,021 bp
  • T to C, chromosome 10 at 14,132,443 bp
  • T to A, chromosome 10 at 69,950,942 bp
  • T to C, chromosome 10 at 79,544,534 bp
  • G to A, chromosome 10 at 94,578,915 bp
  • T to C, chromosome 10 at 129,333,457 bp
  • T to C, chromosome 11 at 58,786,666 bp
  • A to T, chromosome 11 at 74,904,827 bp
  • T to G, chromosome 11 at 78,466,423 bp
  • A to C, chromosome 11 at 82,984,542 bp
  • T to A, chromosome 11 at 94,415,936 bp
  • A to T, chromosome 11 at 99,837,841 bp
  • A to G, chromosome 11 at 99,858,244 bp
  • A to T, chromosome 11 at 106,782,461 bp
  • A to T, chromosome 11 at 110,275,281 bp
  • C to T, chromosome 12 at 111,302,167 bp
  • A to C, chromosome 13 at 99,432,084 bp
  • A to G, chromosome 14 at 57,488,936 bp
  • A to G, chromosome 15 at 35,674,956 bp
  • T to A, chromosome 15 at 37,945,051 bp
  • A to G, chromosome 15 at 57,823,169 bp
  • T to C, chromosome 16 at 20,552,540 bp
  • T to A, chromosome 17 at 18,257,331 bp
  • A to G, chromosome 17 at 20,914,203 bp
  • T to C, chromosome 17 at 78,355,179 bp
  • C to A, chromosome 18 at 7,223,676 bp
  • C to T, chromosome 18 at 37,308,926 bp
  • T to G, chromosome 18 at 67,677,802 bp
  • T to C, chromosome 19 at 7,521,215 bp
  • G to T, chromosome 19 at 24,112,807 bp
  • A to G, chromosome 19 at 25,183,637 bp
  • A to T, chromosome 19 at 27,248,015 bp
  • T to A, chromosome 19 at 47,157,547 bp
Genotype Determination
Phenotype
G1 male heterozygous mice are viable and fertile. The G1 mice were not characterized prior to archiving.
Strain Development
C57BL/6J mice were injected with ENU, resulting in G0 mice that were bred back to C57BL/6J. Sperm was archived from G1 male mice that produced viable G2 mice.
Suggested Control Mice
Wild-type littermates or C57BL/6J mice
Donor
Bruce Beutler, M.D., University of Texas Southwestern Medical Center.
Primary Reference
MUTAGENETIX record for R2273 (G1). B. Beutler and colleagues, Center for the Genetics of Host Defense, UT Southwestern, Dallas, TX.

Colony and Husbandry Information

Colony Surveillance Program and Current Health Reports

Mice recovered from a cryo-archive will have health surveillance performed on recipient females. Health reports will be provided prior to shipment. If you require additional health status information, please email mmrrc@missouri.edu .
Coat Color
Black
MMRRC Breeding System
Random intra-strain mating
Breeding Scheme(s)
When maintaining a live colony, heterozygous mice may be bred together, bred with wild-type siblings, or bred with C57BL/6J inbred mice.
Overall Breeding Performance
Undetermined; during development, mating was done with heterozygous males; viability, fertility and other breeding statistics for heterozygous females and homozygotes are unverified, but presumably would be similar to the C57BL/6J background strain
Average litter size
Undetermined
Recommended wean age
3 weeks

Order Request Information

Limited quantities of breeder mice (recovered litter) are available from a cryoarchive; recovered litter usually available to ship in 3 to 4 months.

Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

Distribution of this strain requires submission of the MMRRC Conditions of Use (COU). A link to the COU web form will be provided via email after an order has been placed; the form should be completed then or the email forwarded to your institutional official for completion.

The donor or their institution limits the distribution to non-profit institutions only.

Additional charges may apply for any special requests. Shipping costs are in addition to the basic distribution/resuscitation fees. Information on shipping costs and any additional charges will be provided by the supplying MMRRC facility.

Click button to Request this one strain. (Use the MMRRC Catalog Search to request more than one strain.)
MMRRC Item # Description Distribution Fee / Unit (US $) Units Notes
040273-MU-RESUS Litter recovered from cryo-archive $5,475.00 / Non-Profit Litter Recovered litter4; additional fees for any special requests.
Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

Some MMRRC strains were submitted by the donor as cryopreserved germplasm, and because these strains were not cryopreserved by the MMRRC, we have not assessed the quality of this material. We have extensive experience with recovery of mice from cryopreserved sperm and embryos of varying quality, including using techniques such as IVF and ICSI, and are confident that we will have success in most, if not all, cases. However, because of the unknown quality of these frozen samples, we will restrict recovery efforts to two attempts for each order. Subsequent attempts can be performed on a fee-for-service basis, in addition to the standard fees, upon request.

1 The distribution fee covers the expense of rederiving mice from a live mouse; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

2 An aliquot contains a sufficient number of embryos (in one or more vials or straws and based on the transfer success rate of the MMRRC facility) to transfer into one to three recipients. The MMRRC makes no guarantee concerning embryo transfer success experienced in the recipient investigator's laboratory. Neither gender nor genotype ratios are guaranteed.

3 An aliquot is one straw or vial with sufficient sperm to recover at least one litter of mice, as per provided protocols, when performed at the MMRRC facility. The MMRRC makes no guarantee concerning the success of these procedures when performed outside the MMRRC facilities.

4 The distribution fee covers the expense of resuscitating mice from the cryo-archive; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

To request material from the MMRRC: Please fill out our on-line request form (accessible from the catalog search results page, or click the Request this Strain button in the fees section). If you have questions or need assistance completing this form, you may call Customer Service at (800) 910-2291 (in USA or Canada) or (530) 757-5710 (international calls). Before you call, please have with you: the MMRRC item number, quantity needed, Bill-to and Ship-to contact information.