Loading Mouse GIF
Loading...

Strain Name:
C57BL/6J-MtgxR2312Btlr/Mmmh
Stock Number:
040311-MU
Citation ID:
RRID:MMRRC_040311-MU
Other Names:
R2312 (G1), C57BL/6J-MtgxR2312Btlr
Major Collection:

Strain Information

Tyrp1
Name: tyrosinase-related protein 1
Synonyms: Tyrp, isa, TRP-1, TRP1, Oca3
Type: Gene
Species: Mouse
Chromosome: 4
NCBI: 22178
Homologene: 464
Sptbn1
Name: spectrin beta, non-erythrocytic 1
Synonyms: beta fodrin, Spnb-2, spectrin G, brain spectrin, elf3, elf1, 9930031C03Rik, non-erythrocytic, Spnb2
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 20742
Homologene: 2354
Gldc
Name: glycine decarboxylase
Synonyms: D19Wsu57e, D030049L12Rik, b2b2679Clo
Type: Gene
Species: Mouse
Chromosome: 19
NCBI: 104174
VEGA: 19
HGNC: HGNC:4313
Homologene: 141
Jmjd1c
Name: jumonji domain containing 1C
Synonyms: TRIP8, 5430433L24Rik, D630035I23Rik
Type: Gene
Species: Mouse
Chromosome: 10
NCBI: 108829
Homologene: 3129
Fancd2
Name: Fanconi anemia, complementation group D2
Synonyms: 2410150O07Rik
Type: Gene
Species: Mouse
Chromosome: 6
NCBI: 211651
HGNC: HGNC:3585
Homologene: 13212
Ulk1
Name: unc-51 like kinase 1
Synonyms: Unc51.1
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 22241
Homologene: 2640
Trappc9
Name: trafficking protein particle complex 9
Synonyms: 4632408O18Rik, 2900005P22Rik, Nibp, TRS130, 1810044A24Rik
Type: Gene
Species: Mouse
Chromosome: 15
NCBI: 76510
VEGA: 15
Homologene: 81931
Genetic Alterations
ENU-induced transitions at the following base pair locations (GRCm38):
  • A to G, chromosome 1 at 58,935,782 bp
  • A to T, chromosome 1 at 65,926,558 bp
  • C to A, chromosome 1 at 74,803,430 bp
  • A to T, chromosome 1 at 79,802,853 bp
  • A to G, chromosome 1 at 93,006,809 bp
  • C to T, chromosome 2 at 145,860,446 bp
  • T to A, chromosome 2 at 167,451,276 bp
  • A to G, chromosome 3 at 33,807,835 bp
  • A to T, chromosome 3 at 75,085,558 bp
  • A to G, chromosome 3 at 83,837,540 bp
  • A to G, chromosome 3 at 88,536,478 bp
  • A to C, chromosome 4 at 58,487,168 bp
  • A to G, chromosome 4 at 65,950,305 bp
  • G to A, chromosome 4 at 80,837,564 bp
  • A to G, chromosome 4 at 108,890,494 bp
  • T to C, chromosome 4 at 113,238,142 bp
  • A to G, chromosome 5 at 24,324,954 bp
  • C to T, chromosome 5 at 110,789,357 bp
  • T to C, chromosome 5 at 144,173,626 bp
  • T to C, chromosome 5 at 147,683,811 bp
  • G to A, chromosome 6 at 4,518,822 bp
  • T to C, chromosome 6 at 87,981,148 bp
  • A to G, chromosome 6 at 113,533,874 bp
  • T to C, chromosome 7 at 27,351,683 bp
  • T to C, chromosome 7 at 27,516,626 bp
  • A to G, chromosome 7 at 103,086,426 bp
  • C to A, chromosome 9 at 66,508,281 bp
  • A to G, chromosome 9 at 75,586,184 bp
  • C to G, chromosome 9 at 86,521,442 bp
  • T to C, chromosome 9 at 107,557,550 bp
  • G to A, chromosome 9 at 107,995,287 bp
  • A to T, chromosome 10 at 4,427,466 bp
  • A to G, chromosome 10 at 23,106,264 bp
  • A to T, chromosome 10 at 67,238,850 bp
  • C to A, chromosome 10 at 69,270,463 bp
  • G to A, chromosome 10 at 76,226,255 bp
  • C to A, chromosome 10 at 77,918,964 bp
  • A to G, chromosome 10 at 89,781,133 bp
  • GATCTATCTATCTATCTATCTATCTATCTATCTATCTATCTATCTATCTATCTATCT to GATCTATCTATCTATCTATCTATCTATCTATCTATCTATCTATCTATCTATCTATCTATCT, chromosome 10 at 95,793,779 bp
  • T to C, chromosome 11 at 3,532,869 bp
  • T to C, chromosome 11 at 30,154,249 bp
  • T to A, chromosome 11 at 50,087,463 bp
  • T to A, chromosome 11 at 70,436,388 bp
  • A to T, chromosome 11 at 80,863,211 bp
  • T to A, chromosome 11 at 98,554,779 bp
  • G to T, chromosome 13 at 11,738,242 bp
  • A to G, chromosome 13 at 13,500,493 bp
  • A to G, chromosome 13 at 23,183,977 bp
  • G to T, chromosome 13 at 60,757,353 bp
  • A to C, chromosome 14 at 44,859,162 bp
  • G to A, chromosome 15 at 73,025,967 bp
  • T to C, chromosome 15 at 85,263,348 bp
  • T to A, chromosome 15 at 98,125,575 bp
  • T to A, chromosome 17 at 22,603,115 bp
  • C to A, chromosome 17 at 25,859,925 bp
  • T to A, chromosome 17 at 34,032,129 bp
  • G to A, chromosome 17 at 84,773,258 bp
  • A to G, chromosome 18 at 37,342,197 bp
  • C to A, chromosome 19 at 6,985,427 bp
  • A to T, chromosome 19 at 30,100,826 bp
Genotype Determination
Phenotype
G1 male heterozygous mice are viable and fertile. The G1 mice were not characterized prior to archiving.
Strain GQC Summary
Gene Specific Genotyping:

To request gene-specific and other genotyping services for a strain, please contact the distribution MMRRC Center for more information.

Background Genetic Quality:

The MMRRC has developed a Genetic Quality Control pipeline using the MiniMUGA array to provide additional information to identify and validate genetic backgrounds of MMRRC strains. For more information on whether genetic background data is available, please contact MMRRC_GeneticQC@med.unc.edu. Note: that MiniMUGA genetic background data is not available on all strains, but can be ordered if desired.

Suggested Control Mice
Littermates of all relevant genotypes.
Submitter
Bruce Beutler, M.D., University of Texas Southwestern Medical Center.
Primary Reference
MUTAGENETIX record for R2312 (G1). B. Beutler and colleagues, Center for the Genetics of Host Defense, UT Southwestern, Dallas, TX.
Strain Development
C57BL/6J mice were injected with ENU, resulting in G0 mice that were bred back to C57BL/6J. Sperm was archived from G1 male mice that produced viable G2 mice.


Disclaimer: If MMRRC Strain Genetic Quality Control (GQC; based on MiniMUGA genotyping and analysis) has been completed for this strain, the information might differ from the genetic background information provided by the submitter. MiniMUGA genetic analysis is done on a strain’s tissue samples taken when archived by or ordered from the assigned MMRRC Center.

Colony and Husbandry Information

Colony Surveillance Program and Current Health Reports

Mice recovered from a cryo-archive will have health surveillance performed on recipient females. Health reports will be provided prior to shipment. If you require additional health status information, please email mmrrc@missouri.edu.
Coat Color
Black
MMRRC Breeding System
Random intra-strain mating
Breeding Scheme(s)
When maintaining a live colony, heterozygous mice may be bred together, bred with wild-type siblings, or bred with C57BL/6J inbred mice.
Overall Breeding Performance
Undetermined; during development, mating was done with heterozygous males; viability, fertility and other breeding statistics for heterozygous females and homozygotes are unverified, but presumably would be similar to the C57BL/6J background strain
Average litter size
Undetermined
Recommended wean age
3 weeks

Order Information

Limited quantities of breeder mice (recovered litter) are available from a cryoarchive; recovered litter usually available to ship in 3 to 4 months.

Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

Distribution of this strain requires submission of the MMRRC Conditions of Use (COU). A link to the COU web form will be provided via email after an order has been placed; the form should be completed then or the email forwarded to your institutional official for completion.

The submitter or their institution limits the distribution to non-profit institutions only.

Additional charges may apply for any special requests. Shipping costs are in addition to the basic distribution/resuscitation fees. Information on shipping costs and any additional charges will be provided by the supplying MMRRC facility.

Click button to Request this one strain. (Use the MMRRC Catalog Search to request more than one strain.)
MMRRC Item # Description Distribution Fee / Unit (US $)
*Shipping & Handling not included*
Units Notes
040311-MU-RESUS Litter recovered from cryo-archive $5,475.00 / Non-Profit Litter Recovered litter4; additional fees for any special requests.
Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

Some MMRRC strains were submitted by the submitter as cryopreserved germplasm, and because these strains were not cryopreserved by the MMRRC, we have not assessed the quality, nor genotype, of this material. Our expertise in reviving mice from various qualities of frozen sperm and embryos, using methods like IVF and ICSI, gives us confidence in successful recoveries in most cases. However, due to the uncertain quality of these samples, we'll limit revival attempts to two per order. Additional attempts are available for a fee, on top of standard charges, if requested. It's important to note that some strains may lack the expected mutation, so we can't assure successful order fulfillment until we attempt to revive the strain.

1 The distribution fee covers the expense of rederiving mice from a live mouse; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

2 An aliquot contains a sufficient number of embryos (in one or more vials or straws and based on the transfer success rate of the MMRRC facility) to transfer into one to three recipients. The MMRRC makes no guarantee concerning embryo transfer success experienced in the recipient investigator's laboratory. Neither gender nor genotype ratios are guaranteed.

3 An aliquot is one straw or vial with sufficient sperm to recover at least one litter of mice, as per provided protocols, when performed at the MMRRC facility. The MMRRC makes no guarantee concerning the success of these procedures when performed outside the MMRRC facilities.

4 The distribution fee covers the expense of resuscitating mice from the cryo-archive; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

To request material from the MMRRC: Please fill out our on-line request form (accessible from the catalog search results page, or click the Request this Strain button in the fees section). If you have questions or need assistance completing this form, you may call Customer Service at (800) 910-2291 (in USA or Canada) or (530) 757-5710 (international calls). Before you call, please have with you: the MMRRC item number, quantity needed, Bill-to and Ship-to contact information.