Loading Mouse GIF
Loading...

Strain Name:
C57BL/6J-MtgxR2365Btlr/Mmmh
Stock Number:
040346-MU
Citation ID:
RRID:MMRRC_040346-MU
Other Names:
R2365 (G1), C57BL/6J-MtgxR2365Btlr
Major Collection:

Strain Information

Slc6a5
Name: solute carrier family 6 (neurotransmitter transporter, glycine), member 5
Synonyms: Glyt2
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 104245
Homologene: 37901
Slc1a2
Name: solute carrier family 1 (glial high affinity glutamate transporter), member 2
Synonyms: GLT1, MGLT1, Eaat2, 1700091C19Rik, GLT-1, 2900019G14Rik
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 20511
Homologene: 3075
Kera
Name: keratocan
Synonyms: SLRR2B, CNA2
Type: Gene
Species: Mouse
Chromosome: 10
NCBI: 16545
VEGA: 10
HGNC: HGNC:6309
Homologene: 5106
Ptprk
Name: protein tyrosine phosphatase receptor type K
Synonyms: PTPk, RPTPkappa
Type: Gene
Species: Mouse
Chromosome: 10
NCBI: 19272
VEGA: 10
HGNC: HGNC:9674
Homologene: 55693
Cnot7
Name: CCR4-NOT transcription complex, subunit 7
Synonyms: Caf1
Type: Gene
Species: Mouse
Chromosome: 8
NCBI: 18983
Homologene: 49011
Fbxl17
Name: F-box and leucine-rich repeat protein 17
Synonyms: Fbx13, C130023C01Rik, 6330576B01Rik, Fbxo13
Type: Gene
Species: Mouse
Chromosome: 17
NCBI: 50758
Homologene: 79859
Pon1
Name: paraoxonase 1
Synonyms: Pon
Type: Gene
Species: Mouse
Chromosome: 6
NCBI: 18979
HGNC: HGNC:9204
Homologene: 68058
Genetic Alterations
ENU-induced transitions at the following base pair locations (GRCm38):
  • T to C, chromosome 1 at 45,924,713 bp
  • T to C, chromosome 1 at 82,735,471 bp
  • T to C, chromosome 1 at 169,964,440 bp
  • A to T, chromosome 1 at 177,448,157 bp
  • C to A, chromosome 1 at 188,378,991 bp
  • C to T, chromosome 2 at 11,493,902 bp
  • A to G, chromosome 2 at 54,854,697 bp
  • A to G, chromosome 2 at 76,790,994 bp
  • T to A, chromosome 2 at 102,748,453 bp
  • A to G, chromosome 2 at 160,327,210 bp
  • A to G, chromosome 3 at 38,980,419 bp
  • A to G, chromosome 3 at 152,128,194 bp
  • C to T, chromosome 4 at 118,934,033 bp
  • T to C, chromosome 4 at 145,087,324 bp
  • G to A, chromosome 5 at 143,947,035 bp
  • A to G, chromosome 6 at 5,171,746 bp
  • A to G, chromosome 6 at 38,340,233 bp
  • C to T, chromosome 6 at 87,383,525 bp
  • A to G, chromosome 6 at 119,575,695 bp
  • T to A, chromosome 7 at 38,519,401 bp
  • T to C, chromosome 7 at 49,946,536 bp
  • A to T, chromosome 7 at 103,310,173 bp
  • T to C, chromosome 7 at 125,219,457 bp
  • CTTATTTATTTATTTATTTATTTATTTATTTATTTATTTATTTATTTATTTATTTATTTATTTATTTATTTATTTATTT to CTTATTTATTTATTTATTTATTTATTTATTTATTTATTTATTTATTTATTTATTTATTTATTTATTTATTTATTTATTTATTT, chromosome 8 at 40,500,668 bp
  • G to A, chromosome 9 at 15,998,271 bp
  • A to G, chromosome 9 at 58,956,003 bp
  • A to G, chromosome 10 at 22,705,886 bp
  • T to C, chromosome 10 at 28,591,873 bp
  • A to G, chromosome 10 at 97,608,943 bp
  • A to T, chromosome 11 at 80,815,685 bp
  • A to G, chromosome 13 at 21,983,784 bp
  • T to G, chromosome 13 at 54,718,088 bp
  • T to A, chromosome 16 at 29,251,256 bp
  • G to A, chromosome 17 at 34,736,058 bp
  • A to G, chromosome 17 at 35,015,452 bp
  • A to G, chromosome 17 at 63,471,552 bp
  • A to G, chromosome 18 at 32,014,331 bp
  • A to G, chromosome 18 at 71,384,238 bp
  • G to C, chromosome 18 at 80,971,792 bp
  • A to G, chromosome 19 at 8,619,397 bp
  • G to T, chromosome X at 37,582,019 bp
Genotype Determination
Phenotype
G1 male heterozygous mice are viable and fertile. The G1 mice were not characterized prior to archiving.
Strain GQC Summary
Gene Specific Genotyping:

To request gene-specific and other genotyping services for a strain, please contact the distribution MMRRC Center for more information.

Background Genetic Quality:

The MMRRC has developed a Genetic Quality Control pipeline using the MiniMUGA array to provide additional information to identify and validate genetic backgrounds of MMRRC strains. For more information on whether genetic background data is available, please contact MMRRC_GeneticQC@med.unc.edu. Note: that MiniMUGA genetic background data is not available on all strains, but can be ordered if desired.

Suggested Control Mice
Littermates of all relevant genotypes.
Donor
Bruce Beutler, M.D., University of Texas Southwestern Medical Center.
Primary Reference
MUTAGENETIX record for R2365 (G1). B. Beutler and colleagues, Center for the Genetics of Host Defense, UT Southwestern, Dallas, TX.
Strain Development
C57BL/6J mice were injected with ENU, resulting in G0 mice that were bred back to C57BL/6J. Sperm was archived from G1 male mice that produced viable G2 mice.


Disclaimer: If MMRRC Strain Genetic Quality Control (GQC; based on MiniMUGA genotyping and analysis) has been completed for this strain, the information might differ from the genetic background information provided by the submitter. MiniMUGA genetic analysis is done on a strain’s tissue samples taken when archived by or ordered from the assigned MMRRC Center.

Colony and Husbandry Information

Colony Surveillance Program and Current Health Reports

Mice recovered from a cryo-archive will have health surveillance performed on recipient females. Health reports will be provided prior to shipment. If you require additional health status information, please email mmrrc@missouri.edu.
Coat Color
Black
MMRRC Breeding System
Random intra-strain mating
Breeding Scheme(s)
When maintaining a live colony, heterozygous mice may be bred together, bred with wild-type siblings, or bred with C57BL/6J inbred mice.
Overall Breeding Performance
Undetermined; during development, mating was done with heterozygous males; viability, fertility and other breeding statistics for heterozygous females and homozygotes are unverified, but presumably would be similar to the C57BL/6J background strain
Average litter size
Undetermined
Recommended wean age
3 weeks

Order Information

Limited quantities of breeder mice (recovered litter) are available from a cryoarchive; recovered litter usually available to ship in 3 to 4 months.

Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

Distribution of this strain requires submission of the MMRRC Conditions of Use (COU). A link to the COU web form will be provided via email after an order has been placed; the form should be completed then or the email forwarded to your institutional official for completion.

The donor or their institution limits the distribution to non-profit institutions only.

Additional charges may apply for any special requests. Shipping costs are in addition to the basic distribution/resuscitation fees. Information on shipping costs and any additional charges will be provided by the supplying MMRRC facility.

Click button to Request this one strain. (Use the MMRRC Catalog Search to request more than one strain.)
MMRRC Item # Description Distribution Fee / Unit (US $)
*Shipping & Handling not included*
Units Notes
040346-MU-RESUS Litter recovered from cryo-archive $5,475.00 / Non-Profit Litter Recovered litter4; additional fees for any special requests.
Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

Some MMRRC strains were submitted by the donor as cryopreserved germplasm, and because these strains were not cryopreserved by the MMRRC, we have not assessed the quality, nor genotype, of this material. Our expertise in reviving mice from various qualities of frozen sperm and embryos, using methods like IVF and ICSI, gives us confidence in successful recoveries in most cases. However, due to the uncertain quality of these samples, we'll limit revival attempts to two per order. Additional attempts are available for a fee, on top of standard charges, if requested. It's important to note that some strains may lack the expected mutation, so we can't assure successful order fulfillment until we attempt to revive the strain.

1 The distribution fee covers the expense of rederiving mice from a live mouse; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

2 An aliquot contains a sufficient number of embryos (in one or more vials or straws and based on the transfer success rate of the MMRRC facility) to transfer into one to three recipients. The MMRRC makes no guarantee concerning embryo transfer success experienced in the recipient investigator's laboratory. Neither gender nor genotype ratios are guaranteed.

3 An aliquot is one straw or vial with sufficient sperm to recover at least one litter of mice, as per provided protocols, when performed at the MMRRC facility. The MMRRC makes no guarantee concerning the success of these procedures when performed outside the MMRRC facilities.

4 The distribution fee covers the expense of resuscitating mice from the cryo-archive; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

To request material from the MMRRC: Please fill out our on-line request form (accessible from the catalog search results page, or click the Request this Strain button in the fees section). If you have questions or need assistance completing this form, you may call Customer Service at (800) 910-2291 (in USA or Canada) or (530) 757-5710 (international calls). Before you call, please have with you: the MMRRC item number, quantity needed, Bill-to and Ship-to contact information.