Strain Name:
C57BL/6J-MtgxR2365Btlr/Mmmh
Stock Number:
040346-MU
Citation ID:
RRID:MMRRC_040346-MU
Other Names:
R2365 (G1), C57BL/6J-MtgxR2365Btlr
Major Collection:

Strain Information

Slc6a5
Name: solute carrier family 6 (neurotransmitter transporter, glycine), member 5
Synonyms: Glyt2
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 104245
Homologene: 37901
Slc1a2
Name: solute carrier family 1 (glial high affinity glutamate transporter), member 2
Synonyms: 1700091C19Rik, 2900019G14Rik, Eaat2, GLT-1, GLT1, MGLT1
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 20511
Homologene: 3075
Kera
Name: keratocan
Synonyms: CNA2, SLRR2B
Type: Gene
Species: Mouse
Chromosome: 10
NCBI: 16545
VEGA: 10
HGNC: HGNC:6309
Homologene: 5106
Ptprk
Name: protein tyrosine phosphatase receptor type K
Synonyms: RPTPkappa, PTPk
Type: Gene
Species: Mouse
Chromosome: 10
NCBI: 19272
VEGA: 10
HGNC: HGNC:9674
Homologene: 55693
Cnot7
Name: CCR4-NOT transcription complex, subunit 7
Synonyms: Caf1
Type: Gene
Species: Mouse
Chromosome: 8
NCBI: 18983
Homologene: 49011
Fbxl17
Name: F-box and leucine-rich repeat protein 17
Synonyms: C130023C01Rik, 6330576B01Rik, Fbxo13, Fbx13
Type: Gene
Species: Mouse
Chromosome: 17
NCBI: 50758
Homologene: 79859
Pon1
Name: paraoxonase 1
Synonyms: Pon
Type: Gene
Species: Mouse
Chromosome: 6
NCBI: 18979
HGNC: HGNC:9204
Homologene: 68058
Mff
Name: mitochondrial fission factor
Synonyms: 5230400G24Rik
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 75734
Homologene: 87000
Vars1
Name: valyl-tRNA synthetase 1
Synonyms: D17H6S56E, G7a, Vars2, Vars, Bat-6, Bat6
Type: Gene
Species: Mouse
Chromosome: 17
NCBI: 22321
Homologene: 4587
Neo1
Name: neogenin
Synonyms: Igdcc2, 2610028H22Rik, D930014N22Rik
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 18007
VEGA: 9
HGNC: HGNC:7754
Homologene: 1870
Dcc
Name: deleted in colorectal carcinoma
Synonyms: Igdcc1, C030036D22Rik
Type: Gene
Species: Mouse
Chromosome: 18
NCBI: 13176
HGNC: HGNC:2701
Homologene: 21081
Erc1
Name: ELKS/RAB6-interacting/CAST family member 1
Synonyms: RAB6IP2B, RAB6IP2A, Rab6ip2, 9630025C19Rik, 5033405M01Rik, Elks1, B430107L16Rik
Type: Gene
Species: Mouse
Chromosome: 6
NCBI: 111173
Homologene: 14229
Vps13d
Name: vacuolar protein sorting 13D
Type: Gene
Species: Mouse
Chromosome: 4
NCBI: 230895
Homologene: 15583
Zbtb18
Name: zinc finger and BTB domain containing 18
Synonyms: Zfp238, RP58
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 30928
Homologene: 21276
Atp13a5
Name: ATPase type 13A5
Synonyms: C630015F21Rik
Type: Gene
Species: Mouse
Chromosome: 16
NCBI: 268878
Homologene: 77451
Tmem98
Name: transmembrane protein 98
Synonyms: Rwhs, 6530411B15Rik
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 103743
Homologene: 9185
Gipc2
Name: GIPC PDZ domain containing family, member 2
Synonyms: 2200002N01Rik, Semcap2
Type: Gene
Species: Mouse
Chromosome: 3
NCBI: 54120
Homologene: 22994
Sall3
Name: spalt like transcription factor 3
Synonyms: Salt, Spalt, Msal, Msal-1, B130022O04Rik
Type: Gene
Species: Mouse
Chromosome: 18
NCBI: 20689
VEGA: 18
Homologene: 18142
Ttn
Name: titin
Synonyms: shru, L56, mdm, connectin, D330041I19Rik, 2310057K23Rik, 2310074I15Rik, 2310036G12Rik, D830007G01Rik, 1100001C23Rik
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 22138
Homologene: 130650
Zc3hav1
Name: zinc finger CCCH type, antiviral 1
Synonyms: 1200014N16Rik, 9130009D18Rik, 9830115L13Rik, ZAP, 2900058M19Rik
Type: Gene
Species: Mouse
Chromosome: 6
NCBI: 78781
Homologene: 10585
Fat3
Name: FAT atypical cadherin 3
Synonyms: D430038H04Rik, LOC234973, LOC382129, 9430076A06Rik
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 270120
VEGA: 9
Homologene: 82252
Ush2a
Name: usherin
Synonyms: MUSH2A, LOC269160, Ush2a, A930037M10Rik, A930011D15Rik, LOC381317, Ushrn
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 22283
Homologene: 66151
Fat4
Name: FAT atypical cadherin 4
Synonyms: 6030410K14Rik
Type: Gene
Species: Mouse
Chromosome: 3
NCBI: 329628
Homologene: 14377
Myo7b
Name: myosin VIIB
Type: Gene
Species: Mouse
Chromosome: 18
NCBI: 17922
HGNC: HGNC:7607
Homologene: 81947
Cdhr2
Name: cadherin-related family member 2
Synonyms: Pcdh24, LOC268663
Type: Gene
Species: Mouse
Chromosome: 13
NCBI: 268663
Homologene: 134510
C4b
Name: complement C4B (Chido blood group)
Synonyms: Ss, C4
Type: Gene
Species: Mouse
Chromosome: 17
NCBI: 12268
Homologene: 36030
Rsph10b
Name: radial spoke head 10 homolog B (Chlamydomonas)
Synonyms: 4930526H21Rik, Rsph10b2
Type: Gene
Species: Mouse
Chromosome: 5
Homologene: 18321
Galnt13
Name: polypeptide N-acetylgalactosaminyltransferase 13
Synonyms: pp-GalNAc-T13
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 271786
Homologene: 62167
Tbpl1
Name: TATA box binding protein-like 1
Synonyms: TRF2, TRP, TLF, Tlp
Type: Gene
Species: Mouse
Chromosome: 10
NCBI: 237336
Homologene: 3577
Or10ak7
Name: olfactory receptor family 10 subfamily AK member 7
Synonyms: MOR259-13, GA_x6K02T2QD9B-18602750-18603691, Olfr1519, MOR259-1, Olfr1328, MOR259-1
Type: Gene
Species: Mouse
Chromosome: 4
NCBI: 258394
Homologene: 121524
Hsd17b7
Name: hydroxysteroid (17-beta) dehydrogenase 7
Synonyms: ERG27
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 15490
HGNC: HGNC:5215
Homologene: 40728
Slc40a1
Name: solute carrier family 40 (iron-regulated transporter), member 1
Synonyms: Dusg, IREG1, FPN1, ferroportin1, Pcm, Slc11a3, metal transporting protein 1, Ol5, MTP1
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 53945
Homologene: 40959
Pom121l2
Name: POM121 transmembrane nucleoporin like 2
Synonyms: LOC195236
Type: Gene
Species: Mouse
Chromosome: 13
NCBI: 195236
Homologene: 123536
Or52e19
Name: olfactory receptor family 52 subfamily E member 19
Synonyms: ENSMUSG00000073953, Olfr596-ps1, Gm15117, GA_x6K02T2PBJ9-6019769-6019943, Olfr596
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 100041187
Homologene: 121535
Pfkfb3
Name: 6-phosphofructo-2-kinase/fructose-2,6-biphosphatase 3
Synonyms: uPFK-2, E330010H22Rik
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 170768
HGNC: HGNC:8874
Homologene: 88708
Slc22a6
Name: solute carrier family 22 (organic anion transporter), member 6
Synonyms: NKT, mOat1, Oat1, Orctl1
Type: Gene
Species: Mouse
Chromosome: 19
NCBI: 18399
VEGA: 19
Homologene: 16813
Gm5591
Name: predicted gene 5591
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 434171
Homologene: 80005
Gkn3
Name: gastrokine 3
Synonyms: 1190003M12Rik
Type: Gene
Species: Mouse
Chromosome: 6
NCBI: 68888
Homologene: 87422
Gm6252
Name: predicted gene 6252
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 19
NCBI: 621699
VEGA: 19
Gm826
Name: predicted gene 826
Synonyms: Gm46773, LOC329554
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 329554
Rhox3f
Name: reproductive homeobox 3F
Synonyms: OTTMUSG00000017155
Type: Gene
Species: Mus musculus (mouse)
Chromosome: X
NCBI: 621852
Homologene: 83502
Genetic Alterations
ENU-induced transitions at the following base pair locations (GRCm38):
  • T to C, chromosome 1 at 45,924,713 bp
  • T to C, chromosome 1 at 82,735,471 bp
  • T to C, chromosome 1 at 169,964,440 bp
  • A to T, chromosome 1 at 177,448,157 bp
  • C to A, chromosome 1 at 188,378,991 bp
  • C to T, chromosome 2 at 11,493,902 bp
  • A to G, chromosome 2 at 54,854,697 bp
  • A to G, chromosome 2 at 76,790,994 bp
  • T to A, chromosome 2 at 102,748,453 bp
  • A to G, chromosome 2 at 160,327,210 bp
  • A to G, chromosome 3 at 38,980,419 bp
  • A to G, chromosome 3 at 152,128,194 bp
  • C to T, chromosome 4 at 118,934,033 bp
  • T to C, chromosome 4 at 145,087,324 bp
  • G to A, chromosome 5 at 143,947,035 bp
  • A to G, chromosome 6 at 5,171,746 bp
  • A to G, chromosome 6 at 38,340,233 bp
  • C to T, chromosome 6 at 87,383,525 bp
  • A to G, chromosome 6 at 119,575,695 bp
  • T to A, chromosome 7 at 38,519,401 bp
  • T to C, chromosome 7 at 49,946,536 bp
  • A to T, chromosome 7 at 103,310,173 bp
  • T to C, chromosome 7 at 125,219,457 bp
  • CTTATTTATTTATTTATTTATTTATTTATTTATTTATTTATTTATTTATTTATTTATTTATTTATTTATTTATTTATTT to CTTATTTATTTATTTATTTATTTATTTATTTATTTATTTATTTATTTATTTATTTATTTATTTATTTATTTATTTATTTATTT, chromosome 8 at 40,500,668 bp
  • G to A, chromosome 9 at 15,998,271 bp
  • A to G, chromosome 9 at 58,956,003 bp
  • A to G, chromosome 10 at 22,705,886 bp
  • T to C, chromosome 10 at 28,591,873 bp
  • A to G, chromosome 10 at 97,608,943 bp
  • A to T, chromosome 11 at 80,815,685 bp
  • A to G, chromosome 13 at 21,983,784 bp
  • T to G, chromosome 13 at 54,718,088 bp
  • T to A, chromosome 16 at 29,251,256 bp
  • G to A, chromosome 17 at 34,736,058 bp
  • A to G, chromosome 17 at 35,015,452 bp
  • A to G, chromosome 17 at 63,471,552 bp
  • A to G, chromosome 18 at 32,014,331 bp
  • A to G, chromosome 18 at 71,384,238 bp
  • G to C, chromosome 18 at 80,971,792 bp
  • A to G, chromosome 19 at 8,619,397 bp
  • G to T, chromosome X at 37,582,019 bp
Genotype Determination
Phenotype
G1 male heterozygous mice are viable and fertile. The G1 mice were not characterized prior to archiving.
Strain Development
C57BL/6J mice were injected with ENU, resulting in G0 mice that were bred back to C57BL/6J. Sperm was archived from G1 male mice that produced viable G2 mice.
Suggested Control Mice
Wild-type littermates or C57BL/6J mice
MMRRC Genetic QC Summary
The MMRRC Centers have developed a genetic QC pipeline using MiniMUGA array genotyping to provide additional information on strain backgrounds for MMRRC congenic and inbred strains. For more information on when data may be available, or to request genotyping for a strain of interest, please contact mmrrc@missouri.edu. Older strains may not have this information.
Donor
Bruce Beutler, M.D., University of Texas Southwestern Medical Center.
Primary Reference
MUTAGENETIX record for R2365 (G1). B. Beutler and colleagues, Center for the Genetics of Host Defense, UT Southwestern, Dallas, TX.

Colony and Husbandry Information

Colony Surveillance Program and Current Health Reports

Mice recovered from a cryo-archive will have health surveillance performed on recipient females. Health reports will be provided prior to shipment. If you require additional health status information, please email mmrrc@missouri.edu.
Coat Color
Black
MMRRC Breeding System
Random intra-strain mating
Breeding Scheme(s)
When maintaining a live colony, heterozygous mice may be bred together, bred with wild-type siblings, or bred with C57BL/6J inbred mice.
Overall Breeding Performance
Undetermined; during development, mating was done with heterozygous males; viability, fertility and other breeding statistics for heterozygous females and homozygotes are unverified, but presumably would be similar to the C57BL/6J background strain
Average litter size
Undetermined
Recommended wean age
3 weeks

Order Request Information

Limited quantities of breeder mice (recovered litter) are available from a cryoarchive; recovered litter usually available to ship in 3 to 4 months.

Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

Distribution of this strain requires submission of the MMRRC Conditions of Use (COU). A link to the COU web form will be provided via email after an order has been placed; the form should be completed then or the email forwarded to your institutional official for completion.

The donor or their institution limits the distribution to non-profit institutions only.

Additional charges may apply for any special requests. Shipping costs are in addition to the basic distribution/resuscitation fees. Information on shipping costs and any additional charges will be provided by the supplying MMRRC facility.

Click button to Request this one strain. (Use the MMRRC Catalog Search to request more than one strain.)
MMRRC Item # Description Distribution Fee / Unit (US $)
*Shipping & Handling not included*
Units Notes
040346-MU-RESUS Litter recovered from cryo-archive $5,475.00 / Non-Profit Litter Recovered litter4; additional fees for any special requests.
Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

Some MMRRC strains were submitted by the donor as cryopreserved germplasm, and because these strains were not cryopreserved by the MMRRC, we have not assessed the quality, nor genotype, of this material. Our expertise in reviving mice from various qualities of frozen sperm and embryos, using methods like IVF and ICSI, gives us confidence in successful recoveries in most cases. However, due to the uncertain quality of these samples, we'll limit revival attempts to two per order. Additional attempts are available for a fee, on top of standard charges, if requested. It's important to note that some strains may lack the expected mutation, so we can't assure successful order fulfillment until we attempt to revive the strain.

1 The distribution fee covers the expense of rederiving mice from a live mouse; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

2 An aliquot contains a sufficient number of embryos (in one or more vials or straws and based on the transfer success rate of the MMRRC facility) to transfer into one to three recipients. The MMRRC makes no guarantee concerning embryo transfer success experienced in the recipient investigator's laboratory. Neither gender nor genotype ratios are guaranteed.

3 An aliquot is one straw or vial with sufficient sperm to recover at least one litter of mice, as per provided protocols, when performed at the MMRRC facility. The MMRRC makes no guarantee concerning the success of these procedures when performed outside the MMRRC facilities.

4 The distribution fee covers the expense of resuscitating mice from the cryo-archive; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

To request material from the MMRRC: Please fill out our on-line request form (accessible from the catalog search results page, or click the Request this Strain button in the fees section). If you have questions or need assistance completing this form, you may call Customer Service at (800) 910-2291 (in USA or Canada) or (530) 757-5710 (international calls). Before you call, please have with you: the MMRRC item number, quantity needed, Bill-to and Ship-to contact information.