Strain Name:
C57BL/6J-MtgxR2423Btlr/Mmmh
Stock Number:
040385-MU
Citation ID:
RRID:MMRRC_040385-MU
Other Names:
R2423 (G1), C57BL/6J-MtgxR2423Btlr
Major Collection:

Strain Information

Tle4
Name: transducin-like enhancer of split 4
Synonyms: ESTM13, ESTM14, 5730411M05Rik, Grg4, Bce1
Type: Gene
Species: Mouse
Chromosome: 19
NCBI: 21888
VEGA: 19
Homologene: 38259
Vldlr
Name: very low density lipoprotein receptor
Type: Gene
Species: Mouse
Chromosome: 19
NCBI: 22359
Homologene: 443
Upf1
Name: UPF1 RNA helicase and ATPase
Synonyms: PNORF-1, B430202H16Rik, Rent1
Type: Gene
Species: Mouse
Chromosome: 8
NCBI: 19704
HGNC: HGNC:9962
Homologene: 2185
Mga
Name: MAX gene associated
Synonyms: C130042M01Rik, Mad5, D030062C11Rik, Mga
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 29808
Homologene: 49351
Tmem248
Name: transmembrane protein 248
Synonyms: G430067H08Rik, 0610007L01Rik, A930023A16Rik
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 71667
Homologene: 9951
Srek1
Name: splicing regulatory glutamine/lysine-rich protein 1
Synonyms: SRrp86, SRrp508, AL118220, Sfrs12
Type: Gene
Species: Mouse
Chromosome: 13
NCBI: 218543
Homologene: 10581
Trip12
Name: thyroid hormone receptor interactor 12
Synonyms: Gtl6, 1110036I07Rik, 6720416K24Rik
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 14897
Homologene: 44226
Vps8
Name: VPS8 CORVET complex subunit
Type: Gene
Species: Mouse
Chromosome: 16
NCBI: 209018
Homologene: 44592
Ap5z1
Name: adaptor-related protein complex 5, zeta 1 subunit
Synonyms: C330006K01Rik
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 231855
Homologene: 18213
Neto2
Name: neuropilin (NRP) and tolloid (TLL)-like 2
Synonyms: 5530601C23Rik
Type: Gene
Species: Mouse
Chromosome: 8
NCBI: 74513
Homologene: 32387
Rbl2
Name: RB transcriptional corepressor like 2
Synonyms: p130, retinoblastoma-like 2, Rb2
Type: Gene
Species: Mouse
Chromosome: 8
NCBI: 19651
HGNC: HGNC:9894
Homologene: 4098
F11r
Name: F11 receptor
Synonyms: BV11 antigen, Ly106, JAM-1, ESTM33, Jcam1, JAM-A
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 16456
Homologene: 14255
Tapt1
Name: transmembrane anterior posterior transformation 1
Synonyms: 4932414K18Rik
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 231225
Homologene: 80206
Plxna2
Name: plexin A2
Synonyms: PlexA2, 2810428A13Rik, OCT, Plxn2
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 18845
HGNC: HGNC:9100
Homologene: 56427
Plcd4
Name: phospholipase C, delta 4
Synonyms: 4921507K24Rik
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 18802
HGNC: HGNC:9062
Homologene: 88782
Uba7
Name: ubiquitin-like modifier activating enzyme 7
Synonyms: Ube1l, 1300004C08Rik
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 74153
Homologene: 2502
Cyp1a2
Name: cytochrome P450, family 1, subfamily a, polypeptide 2
Synonyms: P450-3, CP12, aromatic compound inducible
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 13077
VEGA: 9
HGNC: HGNC:2596
Homologene: 68082
Deup1
Name: deuterosome assembly protein 1
Synonyms: Ccdc67, 4933401K09Rik
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 234964
Homologene: 18760
Gjd4
Name: gap junction protein, delta 4
Synonyms: connexin 39, 9430022F06Rik, Cx39
Type: Gene
Species: Mouse
Chromosome: 18
NCBI: 225152
VEGA: 18
Homologene: 17692
Sspo
Name: SCO-spondin
Synonyms: C79529, Scospondin
Type: Gene
Species: Mouse
Chromosome: 6
NCBI: 243369
Homologene: 45453
Brf1
Name: BRF1, RNA polymerase III transcription initiation factor 90 kDa subunit
Synonyms: GTF3B, TAF3C, 2510002F24Rik, TFIIIB90, TAFIII90
Type: Gene
Species: Mouse
Chromosome: 12
NCBI: 72308
VEGA: 12
Homologene: 1161
Spag17
Name: sperm associated antigen 17
Synonyms: PF6, 4931427F14Rik
Type: Gene
Species: Mouse
Chromosome: 3
NCBI: 74362
Homologene: 52601
Mapkbp1
Name: mitogen-activated protein kinase binding protein 1
Synonyms: 2810483F24Rik, Jnkbp1
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 26390
Homologene: 69109
Slc34a1
Name: solute carrier family 34 (sodium phosphate), member 1
Synonyms: Slc17a2, NaPi-IIa, Na/Pi cotransporter, Npt2, renal Na+/Pi transporter
Type: Gene
Species: Mouse
Chromosome: 13
NCBI: 20505
VEGA: 13
Homologene: 20663
Wiz
Name: widely-interspaced zinc finger motifs
Type: Gene
Species: Mouse
Chromosome: 17
NCBI: 22404
Homologene: 7997
Tnk1
Name: tyrosine kinase, non-receptor, 1
Synonyms: Tnk1a, Kos1, Tnk1b
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 83813
Homologene: 2966
Arhgap9
Name: Rho GTPase activating protein 9
Type: Gene
Species: Mouse
Chromosome: 10
NCBI: 216445
VEGA: 10
Homologene: 13041
Amer2
Name: APC membrane recruitment 2
Synonyms: Fam123a, 2600011E07Rik, Amer2
Type: Gene
Species: Mouse
Chromosome: 14
NCBI: 72125
VEGA: 14
Homologene: 45141
Rbbp8nl
Name: RBBP8 N-terminal like
Synonyms: BC066135
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 271887
Homologene: 76811
Glra3
Name: glycine receptor, alpha 3 subunit
Type: Gene
Species: Mouse
Chromosome: 8
NCBI: 110304
HGNC: HGNC:4328
Homologene: 142
Trp53tg5
Name: transformation related protein 53 target 5
Synonyms: 1700126L10Rik
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 73603
Homologene: 49386
Or56a42-ps1
Name: olfactory receptor family 56 subfamily A member 42, pseudogene 1
Synonyms: GA_x6K02SYW8DF-188-1037, GA_x6K02T2PBJ9-7755919-7755070, MOR40-6P, Olfr217-ps1, Olfr682-ps1, MOR40-19_p
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 258187
Slc26a10
Name: solute carrier family 26, member 10
Type: Gene
Species: Mouse
Chromosome: 10
NCBI: 216441
VEGA: 10
Homologene: 66953
Or52z14
Name: olfactory receptor family 52 subfamily Z member 14
Synonyms: GA_x6K02T2PBJ9-6326488-6327450, MOR31-5, Olfr619
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 259080
Homologene: 45095
Genetic Alterations
ENU-induced transitions at the following base pair locations (GRCm38):
  • A to G, chromosome 1 at 74,554,703 bp
  • TATACATACATACATACATACATACATACATAC to TATACATACATACATACATACATACATACATACATAC, chromosome 1 at 84,814,790 bp
  • T to A, chromosome 1 at 171,461,623 bp
  • C to T, chromosome 1 at 194,749,317 bp
  • A to G, chromosome 2 at 119,964,793 bp
  • A to T, chromosome 2 at 120,024,590 bp
  • T to A, chromosome 2 at 164,471,330 bp
  • A to T, chromosome 2 at 180,280,971 bp
  • G to A, chromosome 3 at 56,085,306 bp
  • A to G, chromosome 3 at 100,103,456 bp
  • T to C, chromosome 5 at 44,192,453 bp
  • T to C, chromosome 5 at 130,229,562 bp
  • T to C, chromosome 5 at 142,476,777 bp
  • A to T, chromosome 5 at 144,024,570 bp
  • T to C, chromosome 6 at 48,454,055 bp
  • C to T, chromosome 7 at 103,604,034 bp
  • G to A, chromosome 7 at 105,126,699 bp
  • C to T, chromosome 8 at 56,112,827 bp
  • C to T, chromosome 8 at 70,338,460 bp
  • G to T, chromosome 8 at 71,327,940 bp
  • C to T, chromosome 8 at 85,669,767 bp
  • A to T, chromosome 8 at 91,087,146 bp
  • G to T, chromosome 9 at 15,592,458 bp
  • C to T, chromosome 9 at 57,679,949 bp
  • G to A, chromosome 9 at 107,978,560 bp
  • T to A, chromosome 10 at 127,179,737 bp
  • A to T, chromosome 10 at 127,327,124 bp
  • T to G, chromosome 11 at 69,855,761 bp
  • T to G, chromosome 11 at 109,814,006 bp
  • G to A, chromosome 12 at 113,000,199 bp
  • G to A, chromosome 13 at 55,409,052 bp
  • G to C, chromosome 13 at 103,753,028 bp
  • T to C, chromosome 14 at 30,666,767 bp
  • T to C, chromosome 14 at 60,379,207 bp
  • A to G, chromosome 16 at 21,559,337 bp
  • A to C, chromosome 17 at 32,361,885 bp
  • G to T, chromosome 18 at 9,280,811 bp
  • A to G, chromosome 19 at 14,467,174 bp
  • C to T, chromosome 19 at 27,236,288 bp
Genotype Determination
Phenotype
G1 male heterozygous mice are viable and fertile. The G1 mice were not characterized prior to archiving.
Strain Development
C57BL/6J mice were injected with ENU, resulting in G0 mice that were bred back to C57BL/6J. Sperm was archived from G1 male mice that produced viable G2 mice.
Suggested Control Mice
Wild-type littermates or C57BL/6J mice
MMRRC Genetic QC Summary
The MMRRC Centers have developed a genetic QC pipeline using MiniMUGA array genotyping to provide additional information on strain backgrounds for MMRRC congenic and inbred strains. For more information on when data may be available, or to request genotyping for a strain of interest, please contact mmrrc@missouri.edu. Older strains may not have this information.
Donor
Bruce Beutler, M.D., University of Texas Southwestern Medical Center.
Primary Reference
MUTAGENETIX record for R2423 (G1). B. Beutler and colleagues, Center for the Genetics of Host Defense, UT Southwestern, Dallas, TX.

Colony and Husbandry Information

Colony Surveillance Program and Current Health Reports

Mice recovered from a cryo-archive will have health surveillance performed on recipient females. Health reports will be provided prior to shipment. If you require additional health status information, please email mmrrc@missouri.edu.
Coat Color
Black
MMRRC Breeding System
Random intra-strain mating
Breeding Scheme(s)
When maintaining a live colony, heterozygous mice may be bred together, bred with wild-type siblings, or bred with C57BL/6J inbred mice.
Overall Breeding Performance
Undetermined; during development, mating was done with heterozygous males; viability, fertility and other breeding statistics for heterozygous females and homozygotes are unverified, but presumably would be similar to the C57BL/6J background strain
Average litter size
Undetermined
Recommended wean age
3 weeks

Order Request Information

Limited quantities of breeder mice (recovered litter) are available from a cryoarchive; recovered litter usually available to ship in 3 to 4 months.

Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

Distribution of this strain requires submission of the MMRRC Conditions of Use (COU). A link to the COU web form will be provided via email after an order has been placed; the form should be completed then or the email forwarded to your institutional official for completion.

The donor or their institution limits the distribution to non-profit institutions only.

Additional charges may apply for any special requests. Shipping costs are in addition to the basic distribution/resuscitation fees. Information on shipping costs and any additional charges will be provided by the supplying MMRRC facility.

Click button to Request this one strain. (Use the MMRRC Catalog Search to request more than one strain.)
MMRRC Item # Description Distribution Fee / Unit (US $)
*Shipping & Handling not included*
Units Notes
040385-MU-RESUS Litter recovered from cryo-archive $5,475.00 / Non-Profit Litter Recovered litter4; additional fees for any special requests.
Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

Some MMRRC strains were submitted by the donor as cryopreserved germplasm, and because these strains were not cryopreserved by the MMRRC, we have not assessed the quality, nor genotype, of this material. Our expertise in reviving mice from various qualities of frozen sperm and embryos, using methods like IVF and ICSI, gives us confidence in successful recoveries in most cases. However, due to the uncertain quality of these samples, we'll limit revival attempts to two per order. Additional attempts are available for a fee, on top of standard charges, if requested. It's important to note that some strains may lack the expected mutation, so we can't assure successful order fulfillment until we attempt to revive the strain.

1 The distribution fee covers the expense of rederiving mice from a live mouse; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

2 An aliquot contains a sufficient number of embryos (in one or more vials or straws and based on the transfer success rate of the MMRRC facility) to transfer into one to three recipients. The MMRRC makes no guarantee concerning embryo transfer success experienced in the recipient investigator's laboratory. Neither gender nor genotype ratios are guaranteed.

3 An aliquot is one straw or vial with sufficient sperm to recover at least one litter of mice, as per provided protocols, when performed at the MMRRC facility. The MMRRC makes no guarantee concerning the success of these procedures when performed outside the MMRRC facilities.

4 The distribution fee covers the expense of resuscitating mice from the cryo-archive; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

To request material from the MMRRC: Please fill out our on-line request form (accessible from the catalog search results page, or click the Request this Strain button in the fees section). If you have questions or need assistance completing this form, you may call Customer Service at (800) 910-2291 (in USA or Canada) or (530) 757-5710 (international calls). Before you call, please have with you: the MMRRC item number, quantity needed, Bill-to and Ship-to contact information.