Strain Name:
C57BL/6J-MtgxR2507Btlr/Mmmh
Stock Number:
040413-MU
Citation ID:
RRID:MMRRC_040413-MU
Other Names:
R2507 (G1), C57BL/6J-MtgxR2507Btlr
Major Collection:

Gene Information

Dnm2
Name: dynamin 2
Synonyms: Dyn2, b2b2159Clo
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 9
Alteration at locus: Chemically Induced
NCBI: 13430
HGNC: HGNC:2974
Homologene: 90883
B4galt5
Name: UDP-Gal:betaGlcNAc beta 1,4-galactosyltransferase, polypeptide 5
Synonyms: 9430078I07Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 2
Alteration at locus: Chemically Induced
NCBI: 56336
HGNC: HGNC:928
Homologene: 3507
Ptch1
Name: patched 1
Synonyms: Ptc1, Patched 1, A230106A15Rik, wig, Ptc
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 13
Alteration at locus: Chemically Induced
NCBI: 19206
HGNC: HGNC:9585
Homologene: 223
Gsr
Name: glutathione reductase
Synonyms: Gr1, Gr-1, D8Ertd238e
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 8
Alteration at locus: Chemically Induced
NCBI: 14782
HGNC: HGNC:4623
Homologene: 531
Dst
Name: dystonin
Synonyms: A830042E19Rik, 2310001O04Rik, Macf2, bullous pemphigoid antigen 1, BPAG1-n, BPAG1, athetoid, Bpag, ah, bullous pemphigoid antigen 1, Bpag1, nmf339, nmf203
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 1
Alteration at locus: Chemically Induced
NCBI: 13518
HGNC: HGNC:1090
Homologene: 136716
Thop1
Name: thimet oligopeptidase 1
Synonyms: EP24.15
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 10
Alteration at locus: Chemically Induced
NCBI: 50492
Homologene: 55726
Jam2
Name: junction adhesion molecule 2
Synonyms: 2410030G21Rik, Jcam2, 2410167M24Rik, JAM-2, VE-JAM
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 16
Alteration at locus: Chemically Induced
NCBI: 67374
Homologene: 10929
Pds5b
Name: PDS5 cohesin associated factor B
Synonyms: Her-2 Tg, WAP-Her-2, AS3, Tg(Wap-ERBB2)229Wzw, Aprin
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 5
Alteration at locus: Chemically Induced
NCBI: 100710
Homologene: 41001
Phax
Name: phosphorylated adaptor for RNA export
Synonyms: phosphorylation regulated, 2810055C14Rik, Phax, Rnuxa, D18Ertd65e, 4933427L19Rik, p55
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 18
Alteration at locus: Chemically Induced
NCBI: 56698
Homologene: 10558
Tex21
Name: testis expressed gene 21
Synonyms: 4931406F04Rik, tsec-2, 4931412D23Rik, 4931421K24Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 12
Alteration at locus: Chemically Induced
NCBI: 80384
VEGA: 12
Homologene: 10510
Trim6
Name: tripartite motif-containing 6
Synonyms: D7Ertd684e, C430046K18Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 7
Alteration at locus: Chemically Induced
NCBI: 94088
Homologene: 14381
Cpne3
Name: copine III
Synonyms: 5430428M23Rik, 5730450C07Rik, CPN3, PRO1071
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 4
Alteration at locus: Chemically Induced
NCBI: 70568
HGNC: HGNC:2316
Homologene: 20839
Cox4i1
Name: cytochrome c oxidase subunit 4I1
Synonyms: Cox4a, Cox4, COXIV
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 8
Alteration at locus: Chemically Induced
NCBI: 12857
HGNC: HGNC:2265
Homologene: 37537
Map4
Name: microtubule-associated protein 4
Synonyms: Mtap4, MAP 4
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 9
Alteration at locus: Chemically Induced
NCBI: 17758
HGNC: HGNC:6862
Homologene: 1780
Aurka
Name: aurora kinase A
Synonyms: IAK1, aurora A, Ark1, Ayk1, Aurora-A, IAK, AIRK1, Stk6
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 2
Alteration at locus: Chemically Induced
NCBI: 20878
Homologene: 2670
Rpap1
Name: RNA polymerase II associated protein 1
Synonyms: A730023M06Rik, 1190005L06Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 2
Alteration at locus: Chemically Induced
NCBI: 68925
Homologene: 32269
Api5
Name: apoptosis inhibitor 5
Synonyms: AAC-11
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 2
Alteration at locus: Chemically Induced
NCBI: 11800
HGNC: HGNC:594
Homologene: 4809
Daam1
Name: dishevelled associated activator of morphogenesis 1
Synonyms: 1700066F09Rik, 2310028E21Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 12
Alteration at locus: Chemically Induced
NCBI: 208846
VEGA: 12
Homologene: 36635
Tpr
Name: translocated promoter region, nuclear basket protein
Synonyms: 2610029M07Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 1
Alteration at locus: Chemically Induced
NCBI: 108989
Homologene: 37753
Chd9
Name: chromodomain helicase DNA binding protein 9
Synonyms: 9030205D12Rik, 1810014J18Rik, AD013, A330063D19Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 8
Alteration at locus: Chemically Induced
NCBI: 109151
Homologene: 11844
Dop1a
Name: DOP1 leucine zipper like protein A
Synonyms: B130005I07Rik, Dopey1, D9Ertd809e
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 9
Alteration at locus: Chemically Induced
NCBI: 320615
Homologene: 26645
Tpp2
Name: tripeptidyl peptidase II
Synonyms: TppII
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 1
Alteration at locus: Chemically Induced
NCBI: 22019
Homologene: 2471
Exoc2
Name: exocyst complex component 2
Synonyms: Sec5l1, 2410030I24Rik, Sec5
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 13
Alteration at locus: Chemically Induced
NCBI: 66482
Homologene: 10122
Phip
Name: pleckstrin homology domain interacting protein
Synonyms: Wdr11, 2810004D21Rik, 4632404O06Rik, Ndrp
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 9
Alteration at locus: Chemically Induced
NCBI: 83946
Homologene: 41209
Emc2
Name: ER membrane protein complex subunit 2
Synonyms: 4921531G14Rik, Ttc35
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 15
Alteration at locus: Chemically Induced
NCBI: 66736
VEGA: 15
Homologene: 8785
Bub1
Name: BUB1, mitotic checkpoint serine/threonine kinase
Synonyms: Bub1a, D2Xrf87
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 2
Alteration at locus: Chemically Induced
NCBI: 12235
HGNC: HGNC:1148
Homologene: 37910
Senp1
Name: SUMO1/sentrin specific peptidase 1
Synonyms: 2310046A20Rik, E330036L07Rik, D15Ertd528e
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 15
Alteration at locus: Chemically Induced
NCBI: 223870
Homologene: 8731
Mark3
Name: MAP/microtubule affinity regulating kinase 3
Synonyms: ETK-1, A430080F22Rik, C-TAK1, 1600015G02Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 12
Alteration at locus: Chemically Induced
NCBI: 17169
VEGA: 12
HGNC: HGNC:6897
Homologene: 55653
Ralgapa1
Name: Ral GTPase activating protein, alpha subunit 1
Synonyms: 4930400K19Rik, 2310003F20Rik, Garnl1, Tulip1
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 12
Alteration at locus: Chemically Induced
NCBI: 56784
VEGA: 12
Homologene: 84805
Nek1
Name: NIMA (never in mitosis gene a)-related expressed kinase 1
Synonyms: kat, kidney, anemia and testis, D8Ertd790e
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 8
Alteration at locus: Chemically Induced
NCBI: 18004
HGNC: HGNC:7744
Homologene: 14376
N4bp2
Name: NEDD4 binding protein 2
Synonyms: LOC386488, B3bp, LOC333789
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 5
Alteration at locus: Chemically Induced
NCBI: 333789
Homologene: 32396
Ccdc117
Name: coiled-coil domain containing 117
Synonyms: 1700026O03Rik, 1110004K02Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 11
Alteration at locus: Chemically Induced
NCBI: 104479
Homologene: 15886
Commd9
Name: COMM domain containing 9
Synonyms: 1810029F08Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 2
Alteration at locus: Chemically Induced
NCBI: 76501
Homologene: 8584
Galnt4
Name: polypeptide N-acetylgalactosaminyltransferase 4
Synonyms: ppGaNTase-T4
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 10
Alteration at locus: Chemically Induced
NCBI: 14426
HGNC: HGNC:4126
Homologene: 74511
Ntng2
Name: netrin G2
Synonyms: 2610016D08Rik, Lmnt2
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 2
Alteration at locus: Chemically Induced
NCBI: 171171
Homologene: 13053
Fbf1
Name: Fas (TNFRSF6) binding factor 1
Synonyms: 1110033G01Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 11
Alteration at locus: Chemically Induced
NCBI: 217335
Homologene: 16531
Lmo1
Name: LIM domain only 1
Synonyms: Rbtn1, Ttg1, Rbtn-1
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 7
Alteration at locus: Chemically Induced
NCBI: 109594
HGNC: HGNC:6641
Homologene: 48101
Prpf39
Name: pre-mRNA processing factor 39
Synonyms: Srcs1
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 12
Alteration at locus: Chemically Induced
NCBI: 328110
Homologene: 32377
Apc
Name: APC, WNT signaling pathway regulator
Synonyms: CC1, Min
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 18
Alteration at locus: Chemically Induced
NCBI: 11789
HGNC: HGNC:583
Homologene: 30950
Zfp37
Name: zinc finger protein 37
Synonyms: Zfp-37, Tzn
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 4
Alteration at locus: Chemically Induced
NCBI: 22696
Homologene: 40682
Cenph
Name: centromere protein H
Synonyms: 2410018A12Rik, 2810046K12Rik, 2610042E16Rik, CENP-H, 1700021I11Rik, ENP
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 13
Alteration at locus: Chemically Induced
NCBI: 26886
Homologene: 32519
Med23
Name: mediator complex subunit 23
Synonyms: ESTM7, X83317, 3000002A17Rik, Sur2, Crsp3
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 10
Alteration at locus: Chemically Induced
NCBI: 70208
HGNC: HGNC:2372
Homologene: 3552
Cdh6
Name: cadherin 6
Synonyms: K-cadherin, cad6
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 15
Alteration at locus: Chemically Induced
NCBI: 12563
VEGA: 15
HGNC: HGNC:1765
Homologene: 21027
Mecom
Name: MDS1 and EVI1 complex locus
Synonyms: D630039M04Rik, ZNFPR1B1, MDS1-EVI1, Evi-1, Mds1, Evi1, Prdm3, Jbo
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 3
Alteration at locus: Chemically Induced
NCBI: 14013
HGNC: HGNC:3498
Homologene: 21086
Irak2
Name: interleukin-1 receptor-associated kinase 2
Synonyms: 6330415L08Rik, IRAK-2
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 6
Alteration at locus: Chemically Induced
NCBI: 108960
HGNC: HGNC:6113
Homologene: 1207
C87499
Name: expressed sequence C87499
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 4
Alteration at locus: Chemically Induced
NCBI: 381590
Unc80
Name: unc-80, NALCN activator
Synonyms: C030018G13Rik, C230061B10Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 1
Alteration at locus: Chemically Induced
NCBI: 329178
Homologene: 122243
Dner
Name: delta/notch-like EGF repeat containing
Synonyms: A930026D19Rik, BET
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 1
Alteration at locus: Chemically Induced
NCBI: 227325
Homologene: 26722
Gm12695
Name: predicted gene 12695
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 4
Alteration at locus: Chemically Induced
NCBI: 620779
Homologene: 51847
Galnt11
Name: polypeptide N-acetylgalactosaminyltransferase 11
Synonyms: E430002F06Rik, A430075I06Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 5
Alteration at locus: Chemically Induced
NCBI: 231050
Homologene: 11126
Cdhr3
Name: cadherin-related family member 3
Synonyms: 1110049B09Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 12
Alteration at locus: Chemically Induced
NCBI: 68764
VEGA: 12
Homologene: 45146
Abcc12
Name: ATP-binding cassette, sub-family C (CFTR/MRP), member 12
Synonyms: 4930467B22Rik, MRP9
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 8
Alteration at locus: Chemically Induced
NCBI: 244562
Homologene: 57211
Stk35
Name: serine/threonine kinase 35
Synonyms: 1700054C12Rik, CLIK1, CLP-36 interacting kinase
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 2
Alteration at locus: Chemically Induced
NCBI: 67333
Homologene: 15441
Duox1
Name: dual oxidase 1
Synonyms: THOX1, 9930101G15Rik, NOXEF1, LNOX1
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 2
Alteration at locus: Chemically Induced
NCBI: 99439
HGNC: HGNC:3062
Homologene: 68136
Itgad
Name: integrin, alpha D
Synonyms: Cd11d
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 7
Alteration at locus: Chemically Induced
NCBI: 381924
HGNC: HGNC:6146
Homologene: 56919
Bsn
Name: bassoon
Synonyms: presynaptic cytomatrix protein
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 9
Alteration at locus: Chemically Induced
NCBI: 12217
HGNC: HGNC:1117
Homologene: 31161
Gria1
Name: glutamate receptor, ionotropic, AMPA1 (alpha 1)
Synonyms: 2900051M01Rik, GluR-A, Glur-1, Glr1, GluA1, GluRA, Glr-1, HIPA1, GluR1, Glur1
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 11
Alteration at locus: Chemically Induced
NCBI: 14799
HGNC: HGNC:4571
Homologene: 20226
Col11a1
Name: collagen, type XI, alpha 1
Synonyms: C530001D20Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 3
Alteration at locus: Chemically Induced
NCBI: 12814
HGNC: HGNC:2186
Homologene: 56389
Nwd2
Name: NACHT and WD repeat domain containing 2
Synonyms: B830017A01Rik, 3110047P20Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 5
Alteration at locus: Chemically Induced
NCBI: 319807
Homologene: 14974
Pcolce
Name: procollagen C-endopeptidase enhancer protein
Synonyms: Astt2, Astt-2
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 5
Alteration at locus: Chemically Induced
NCBI: 18542
HGNC: HGNC:8738
Homologene: 1946
Zfp426
Name: zinc finger protein 426
Synonyms: KRAB1, Zfp68-rs1, 2900057C04Rik, Zfo61
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 9
Alteration at locus: Chemically Induced
NCBI: 235028
Homologene: 23435
Clpx
Name: caseinolytic mitochondrial matrix peptidase chaperone subunit
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 9
Alteration at locus: Chemically Induced
NCBI: 270166
HGNC: HGNC:2088
Homologene: 4851
Unc45b
Name: unc-45 myosin chaperone B
Synonyms: D230041A13Rik, Cmya4, UNC45
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 11
Alteration at locus: Chemically Induced
NCBI: 217012
Homologene: 14666
Olfr1328
Name: olfactory receptor 1328
Synonyms: GA_x6K02T2QD9B-18602750-18603691, MOR259-1, MOR259-13, MOR259-1, Olfr1519
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 4
Alteration at locus: Chemically Induced
NCBI: 258394
Homologene: 121524
Cnga1
Name: cyclic nucleotide gated channel alpha 1
Synonyms: Cncg
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 5
Alteration at locus: Chemically Induced
NCBI: 12788
HGNC: HGNC:2148
Homologene: 55432
Map3k21
Name: mitogen-activated protein kinase kinase kinase 21
Synonyms: BC021891
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 8
Alteration at locus: Chemically Induced
NCBI: 234878
Homologene: 32778
Usb1
Name: U6 snRNA biogenesis 1
Synonyms: AA960436
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 8
Alteration at locus: Chemically Induced
NCBI: 101985
Homologene: 11611
Cpt1b
Name: carnitine palmitoyltransferase 1b, muscle
Synonyms: M-CPT I, M-CPTI, Cpt1
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 15
Alteration at locus: Chemically Induced
NCBI: 12895
HGNC: HGNC:2329
Homologene: 22548
Gopc
Name: golgi associated PDZ and coiled-coil motif containing
Synonyms: 2210402P09Rik, GOPC1
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 10
Alteration at locus: Chemically Induced
NCBI: 94221
VEGA: 10
Homologene: 10695
Clec2h
Name: C-type lectin domain family 2, member h
Synonyms: Clrf
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 6
Alteration at locus: Chemically Induced
NCBI: 94071
Homologene: 131164
Tlr1
Name: toll-like receptor 1
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 5
Alteration at locus: Chemically Induced
NCBI: 21897
Homologene: 20694
Vmn1r233
Name: vomeronasal 1 receptor 233
Synonyms: V1rf5
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 17
Alteration at locus: Chemically Induced
NCBI: 171236
Homologene: 128343
Fdxr
Name: ferredoxin reductase
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 11
Alteration at locus: Chemically Induced
NCBI: 14149
HGNC: HGNC:3642
Homologene: 3033
Mrgpra9
Name: MAS-related GPR, member A9
Synonyms: EG668725, MrgA9
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 7
Alteration at locus: Chemically Induced
NCBI: 668725
Homologene: 79615
AY702102
Name: cDNA sequence AY702102
Synonyms: STDP1
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 2
Alteration at locus: Chemically Induced
NCBI: 446211
Vmn1r17
Name: vomeronasal 1 receptor 17
Synonyms: V1rc16
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 6
Alteration at locus: Chemically Induced
NCBI: 171189
Homologene: 115643
Ubash3b
Name: ubiquitin associated and SH3 domain containing, B
Synonyms: TULA-2, 2810457I06Rik, Sts-1
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 9
Alteration at locus: Chemically Induced
NCBI: 72828
Homologene: 13152
Irx1
Name: Iroquois homeobox 1
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 13
Alteration at locus: Chemically Induced
NCBI: 16371
Homologene: 19065
Akr1b3
Name: aldo-keto reductase family 1, member B3 (aldose reductase)
Synonyms: Ahr1, AR, ALR2, Aldor1, Ahr-1, Aldr1
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 6
Alteration at locus: Chemically Induced
NCBI: 11677
HGNC: HGNC:381
Homologene: 133743
Kcns3
Name: potassium voltage-gated channel, delayed-rectifier, subfamily S, member 3
Synonyms: D12Ertd137e
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 12
Alteration at locus: Chemically Induced
NCBI: 238076
VEGA: 12
HGNC: HGNC:6302
Homologene: 20518
Armcx4
Name: armadillo repeat containing, X-linked 4
Type: Gene
Species: Mus musculus (mouse)
Chromosome: X
Alteration at locus: Chemically Induced
NCBI: 100503043
Homologene: 131587
Cacna1f
Name: calcium channel, voltage-dependent, alpha 1F subunit
Synonyms: Cav1.4, Sfc17
Type: Gene
Species: Mus musculus (mouse)
Chromosome: X
Alteration at locus: Chemically Induced
NCBI: 54652
HGNC: HGNC:1393
Homologene: 74542
1700020N01Rik
Name: RIKEN cDNA 1700020N01 gene
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 10
Alteration at locus: Chemically Induced
NCBI: 67692
Samd1
Name: sterile alpha motif domain containing 1
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 8
Alteration at locus: Chemically Induced
NCBI: 666704
Homologene: 124206
Erich3
Name: glutamate rich 3
Synonyms: 5031409G23Rik, 4922501L14Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 3
Alteration at locus: Chemically Induced
NCBI: 209601
Homologene: 27877
Ikzf2
Name: IKAROS family zinc finger 2
Synonyms: A730095J18Rik, Zfpn1a2, Helios
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 1
Alteration at locus: Chemically Induced
NCBI: 22779
Homologene: 22659
Olfr1414
Name: olfactory receptor 1414
Synonyms: GA_x6K02T2R7CC-81245243-81246181, MOR103-2
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 1
Alteration at locus: Chemically Induced
NCBI: 259041
Homologene: 88368
Pecr
Name: peroxisomal trans-2-enoyl-CoA reductase
Synonyms: 2400003B18Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 1
Alteration at locus: Chemically Induced
NCBI: 111175
Homologene: 69255
Hcfc1r1
Name: host cell factor C1 regulator 1 (XPO1-dependent)
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 17
Alteration at locus: Chemically Induced
NCBI: 353502
Homologene: 9901
Genetic Alterations
ENU-induced transitions at the following base pair locations (GRCm38):
  • T to C, chromosome 1 at 34,011,909 bp
  • T to C, chromosome 1 at 34,188,417 bp
  • A to G, chromosome 1 at 44,001,449 bp
  • A to G, chromosome 1 at 66,612,107 bp
  • G to A, chromosome 1 at 69,539,288 bp
  • A to G, chromosome 1 at 72,261,976 bp
  • A to T, chromosome 1 at 84,583,080 bp
  • A to G, chromosome 1 at 92,511,378 bp
  • A to G, chromosome 1 at 150,392,944 bp
  • T to C, chromosome 2 at 29,207,519 bp
  • T to C, chromosome 2 at 94,429,817 bp
  • G to A, chromosome 2 at 101,886,331 bp
  • A to G, chromosome 2 at 119,780,054 bp
  • A to G, chromosome 2 at 122,333,138 bp
  • A to T, chromosome 2 at 127,801,423 bp
  • A to G, chromosome 2 at 129,801,515 bp
  • T to A, chromosome 2 at 167,306,638 bp
  • T to A, chromosome 2 at 169,962,595 bp
  • T to C, chromosome 2 at 172,370,445 bp
  • T to C, chromosome 3 at 29,956,299 bp
  • T to C, chromosome 3 at 114,138,392 bp
  • A to T, chromosome 3 at 154,698,659 bp
  • A to T, chromosome 4 at 19,553,871 bp
  • A to T, chromosome 4 at 62,191,256 bp
  • T to A, chromosome 4 at 88,629,211 bp
  • T to A, chromosome 4 at 96,754,189 bp
  • T to C, chromosome 4 at 118,933,925 bp
  • C to G, chromosome 5 at 25,247,612 bp
  • T to C, chromosome 5 at 63,791,437 bp
  • T to C, chromosome 5 at 64,925,296 bp
  • T to A, chromosome 5 at 65,790,061 bp
  • C to T, chromosome 5 at 72,619,061 bp
  • A to G, chromosome 5 at 137,607,051 bp
  • C to A, chromosome 5 at 150,756,428 bp
  • C to T, chromosome 6 at 34,310,064 bp
  • C to A, chromosome 6 at 57,361,259 bp
  • T to C, chromosome 6 at 113,647,678 bp
  • A to G, chromosome 6 at 128,673,982 bp
  • A to G, chromosome 7 at 47,235,494 bp
  • T to C, chromosome 7 at 104,228,185 bp
  • C to A, chromosome 7 at 109,140,641 bp
  • A to G, chromosome 7 at 128,178,065 bp
  • T to G, chromosome 8 at 33,680,288 bp
  • T to C, chromosome 8 at 61,043,228 bp
  • CGAGGAGGAGGAGGAGGAGGA to CGAGGAGGAGGAGGAGGA, chromosome 8 at 83,998,996 bp
  • G to C, chromosome 8 at 86,534,865 bp
  • C to T, chromosome 8 at 91,033,987 bp
  • T to C, chromosome 8 at 95,343,124 bp
  • T to A, chromosome 8 at 120,673,290 bp
  • A to G, chromosome 8 at 125,939,938 bp
  • T to C, chromosome 9 at 20,470,431 bp
  • T to C, chromosome 9 at 21,489,807 bp
  • T to C, chromosome 9 at 41,157,354 bp
  • G to A, chromosome 9 at 65,301,977 bp
  • T to C, chromosome 9 at 82,915,339 bp
  • T to A, chromosome 9 at 86,513,117 bp
  • T to C, chromosome 9 at 108,116,114 bp
  • A to G, chromosome 9 at 110,037,483 bp
  • A to G, chromosome 10 at 21,621,782 bp
  • A to G, chromosome 10 at 24,910,813 bp
  • C to T, chromosome 10 at 52,353,326 bp
  • T to G, chromosome 10 at 81,070,264 bp
  • A to G, chromosome 10 at 99,109,286 bp
  • T to C, chromosome 11 at 5,541,360 bp
  • A to T, chromosome 11 at 57,289,320 bp
  • G to A, chromosome 11 at 82,940,137 bp
  • G to A, chromosome 11 at 115,271,980 bp
  • T to C, chromosome 11 at 116,155,426 bp
  • A to C, chromosome 12 at 11,092,086 bp
  • T to C, chromosome 12 at 33,038,915 bp
  • G to A, chromosome 12 at 55,718,201 bp
  • T to A, chromosome 12 at 65,057,815 bp
  • G to A, chromosome 12 at 71,975,223 bp
  • A to G, chromosome 12 at 76,217,099 bp
  • T to A, chromosome 12 at 111,627,242 bp
  • A to G, chromosome 13 at 30,882,365 bp
  • T to G, chromosome 13 at 63,524,959 bp
  • T to C, chromosome 13 at 71,959,820 bp
  • A to T, chromosome 13 at 100,771,236 bp
  • A to G, chromosome 15 at 13,041,361 bp
  • A to T, chromosome 15 at 43,511,698 bp
  • A to G, chromosome 15 at 89,419,098 bp
  • G to A, chromosome 15 at 98,066,745 bp
  • G to A, chromosome 16 at 84,806,953 bp
  • A to T, chromosome 17 at 20,993,848 bp
  • T to A, chromosome 17 at 23,674,078 bp
  • A to T, chromosome 18 at 34,316,537 bp
  • T to A, chromosome 18 at 56,586,884 bp
  • T to G, chromosome X at 7,626,448 bp
  • T to G, chromosome X at 134,695,379 bp
Genotype Determination
Phenotype
G1 male heterozygous mice are viable and fertile. The G1 mice were not characterized prior to archiving.
Strain Development
C57BL/6J mice were injected with ENU, resulting in G0 mice that were bred back to C57BL/6J. Sperm was archived from G1 male mice that produced viable G2 mice.
Suggested Control Mice
Wild-type littermates or C57BL/6J mice
Donor
Bruce Beutler, M.D., University of Texas Southwestern Medical Center.
Primary Reference
MUTAGENETIX record for R2507 (G1). B. Beutler and colleagues, Center for the Genetics of Host Defense, UT Southwestern, Dallas, TX.

Colony and Husbandry Information

Colony Surveillance Program and Current Health Reports

Mice recovered from a cryo-archive will have health surveillance performed on recipient females. Health reports will be provided prior to shipment. If you require additional health status information, please email mmrrc@missouri.edu .
Coat Color
Black
MMRRC Breeding System
Random intra-strain mating
Breeding Scheme(s)
When maintaining a live colony, heterozygous mice may be bred together, bred with wild-type siblings, or bred with C57BL/6J inbred mice.
Overall Breeding Performance
Undetermined; during development, mating was done with heterozygous males; viability, fertility and other breeding statistics for heterozygous females and homozygotes are unverified, but presumably would be similar to the C57BL/6J background strain
Average litter size
Undetermined
Recommended wean age
3 weeks

Order Request Information

Limited quantities of breeder mice (recovered litter) are available from a cryoarchive; recovered litter usually available to ship in 3 to 4 months.

Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

Distribution of this strain requires submission of the MMRRC Conditions of Use (COU). A link to the COU web form will be provided via email after an order has been placed; the form should be completed then or the email forwarded to your institutional official for completion.

The donor or their institution limits the distribution to non-profit institutions only.

Additional charges may apply for any special requests. Shipping costs are in addition to the basic distribution/resuscitation fees. Information on shipping costs and any additional charges will be provided by the supplying MMRRC facility.

Click button to Request this one strain. (Use the MMRRC Catalog Search to request more than one strain.)
MMRRC Item # Description Distribution Fee / Unit (US $) Units Notes
040413-MU-RESUS Litter recovered from cryo-archive $5,475.00 / Non-Profit Litter Recovered litter1; additional fees for any special requests.
Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

Some MMRRC strains were submitted by the donor as cryopreserved germplasm, and because these strains were not cryopreserved by the MMRRC, we have not assessed the quality of this material. We have extensive experience with recovery of mice from cryopreserved sperm and embryos of varying quality, including using techniques such as IVF and ICSI, and are confident that we will have success in most, if not all, cases. However, because of the unknown quality of these frozen samples, we will restrict recovery efforts to two attempts for each order. Subsequent attempts can be performed on a fee-for-service basis, in addition to the standard fees, upon request.

1 The distribution fee covers the expense of resuscitating mice from the cryo-archive; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

2 An aliquot is one straw or vial with sufficient sperm to recover at least one litter of mice, as per provided protocols, when performed at the MMRRC facility. The MMRRC makes no guarantee concerning the success of these procedures when performed outside the MMRRC facilities.

3 An aliquot contains a sufficient number of embryos (in one or more vials or straws and based on the transfer success rate of the MMRRC facility) to transfer into one to three recipients. The MMRRC makes no guarantee concerning embryo transfer success experienced in the recipient investigator's laboratory. Neither gender nor genotype ratios are guaranteed.

To request material from the MMRRC: Please fill out our on-line request form (accessible from the catalog search results page, or click the Request this Strain button in the fees section). If you have questions or need assistance completing this form, you may call Customer Service at (800) 910-2291 (in USA or Canada) or (530) 757-5710 (international calls). Before you call, please have with you: the MMRRC item number, quantity needed, Bill-to and Ship-to contact information.