Strain Name:
C57BL/6J-MtgxR2852Btlr/Mmmh
Stock Number:
040445-MU
Citation ID:
RRID:MMRRC_040445-MU
Other Names:
R2852 (G1), C57BL/6J-MtgxR2852Btlr
Major Collection:

Strain Information

Ednrb
Name: endothelin receptor type B
Synonyms: ETR-b, Sox10m1, ETb
Type: Gene
Species: Mouse
Chromosome: 14
NCBI: 13618
VEGA: 14
HGNC: HGNC:3180
Homologene: 89
Stk11ip
Name: serine/threonine kinase 11 interacting protein
Synonyms: 1200014D22Rik, LIP1, LKB1IP
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 71728
Homologene: 12406
Pik3c2a
Name: phosphatidylinositol-4-phosphate 3-kinase catalytic subunit type 2 alpha
Synonyms: PI3KC2
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 18704
HGNC: HGNC:8971
Homologene: 20581
Mycbp2
Name: MYC binding protein 2, E3 ubiquitin protein ligase
Synonyms: Pam, Phr1, C130061D10Rik
Type: Gene
Species: Mouse
Chromosome: 14
NCBI: 105689
Homologene: 9005
Map4k4
Name: mitogen-activated protein kinase kinase kinase kinase 4
Synonyms: Nik, 9430080K19Rik
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 26921
HGNC: HGNC:6866
Homologene: 7442
Mdc1
Name: mediator of DNA damage checkpoint 1
Synonyms: NFBD1
Type: Gene
Species: Mouse
Chromosome: 17
NCBI: 240087
Homologene: 67092
Tmeff1
Name: transmembrane protein with EGF-like and two follistatin-like domains 1
Synonyms: tomoregulin-like, M7365
Type: Gene
Species: Mouse
Chromosome: 4
NCBI: 230157
Homologene: 130458
Hspd1
Name: heat shock protein 1 (chaperonin)
Synonyms: Hsp60
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 15510
HGNC: HGNC:5261
Homologene: 1626
Pah
Name: phenylalanine hydroxylase
Type: Gene
Species: Mouse
Chromosome: 10
NCBI: 18478
HGNC: HGNC:8582
Homologene: 234
Far1
Name: fatty acyl CoA reductase 1
Synonyms: 2600011M19Rik, Mlstd2, 2900034E22Rik, 3732409C05Rik
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 67420
Homologene: 41718
Man2a1
Name: mannosidase 2, alpha 1
Synonyms: Map-2, Mana-2, Mana2
Type: Gene
Species: Mouse
Chromosome: 17
NCBI: 17158
HGNC: HGNC:6824
Homologene: 1777
Zfp653
Name: zinc finger protein 653
Synonyms: E430039K05Rik
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 319601
VEGA: 9
Homologene: 16346
Robo4
Name: roundabout guidance receptor 4
Synonyms: 1200012D01Rik, Magic roundabout
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 74144
Homologene: 10397
Tek
Name: TEK receptor tyrosine kinase
Synonyms: tie-2, Cd202b, Tie2, Hyk
Type: Gene
Species: Mouse
Chromosome: 4
NCBI: 21687
Homologene: 397
Mslnl
Name: mesothelin-like
Type: Gene
Species: Mouse
Chromosome: 17
NCBI: 328783
VEGA: 17
Homologene: 18633
Zfyve28
Name: zinc finger, FYVE domain containing 28
Synonyms: 9630058O20Rik
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 231125
Homologene: 15119
Rnf168
Name: ring finger protein 168
Synonyms: 3110001H15Rik
Type: Gene
Species: Mouse
Chromosome: 16
NCBI: 70238
Homologene: 87044
Pilra
Name: paired immunoglobin-like type 2 receptor alpha
Synonyms: FDF03
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 231805
Homologene: 8387
Egflam
Name: EGF-like, fibronectin type III and laminin G domains
Synonyms: nectican, pikachurin
Type: Gene
Species: Mouse
Chromosome: 15
NCBI: 268780
Homologene: 65044
Mre11a
Name: MRE11A homolog A, double strand break repair nuclease
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 17535
HGNC: HGNC:7230
Homologene: 4083
Zfp14
Name: zinc finger protein 14
Synonyms: 4732429I09Rik, Zfp-14, Krox-9
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 243906
Homologene: 45619
Dennd5a
Name: DENN domain containing 5A
Synonyms: Rab6ip1, 1500012B19Rik, ORF37
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 19347
Homologene: 14584
Npsr1
Name: neuropeptide S receptor 1
Synonyms: VRR1, PGR14, Gpr154, 9330128H10Rik
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 319239
Homologene: 45515
Vmn2r85
Name: vomeronasal 2, receptor 85
Synonyms: EG623734
Type: Gene
Species: Mouse
Chromosome: 10
NCBI: 623734
Homologene: 129606
Dnai4
Name: dynein axonemal intermediate chain 4
Synonyms: Wdr78
Type: Gene
Species: Mouse
Chromosome: 4
NCBI: 242584
Homologene: 11702
Arhgef4
Name: Rho guanine nucleotide exchange factor 4
Synonyms: C230030N03Rik, Asef, 9330140K16Rik
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 226970
HGNC: HGNC:684
Homologene: 49414
Kcnv2
Name: potassium channel, subfamily V, member 2
Synonyms: KV11.1
Type: Gene
Species: Mouse
Chromosome: 19
NCBI: 240595
Homologene: 26423
Bank1
Name: B cell scaffold protein with ankyrin repeats 1
Synonyms: A530094C12Rik
Type: Gene
Species: Mouse
Chromosome: 3
NCBI: 242248
Homologene: 9926
Pdzd7
Name: PDZ domain containing 7
Synonyms: Pdzk7, EG435601
Type: Gene
Species: Mouse
Chromosome: 19
NCBI: 100503041
Homologene: 129509
Krt82
Name: keratin 82
Synonyms: Krt2-20
Type: Gene
Species: Mouse
Chromosome: 15
NCBI: 114566
VEGA: 15
HGNC: HGNC:6459
Homologene: 13200
Zkscan16
Name: zinc finger with KRAB and SCAN domains 16
Synonyms: Zfp483
Type: Gene
Species: Mouse
Chromosome: 4
NCBI: 100041581
Homologene: 26419
Ehbp1l1
Name: EH domain binding protein 1-like 1
Synonyms: G430002G23Rik
Type: Gene
Species: Mouse
Chromosome: 19
NCBI: 114601
VEGA: 19
Homologene: 136059
Dzip1
Name: DAZ interacting protein 1
Synonyms: 2510025K24Rik, 2810422M04Rik
Type: Gene
Species: Mouse
Chromosome: 14
NCBI: 66573
VEGA: 14
Homologene: 45708
Catsperd
Name: cation channel sperm associated auxiliary subunit delta
Synonyms: Tmem146, 4921529N20Rik, 4933402B14Rik, Gm6095
Type: Gene
Species: Mouse
Chromosome: 17
NCBI: 106757
VEGA: 17
Homologene: 51896
Spata1
Name: spermatogenesis associated 1
Synonyms: 4921536I21Rik, SP-2
Type: Gene
Species: Mouse
Chromosome: 3
NCBI: 70951
Homologene: 23356
Stx5a
Name: syntaxin 5A
Synonyms: 0610031F24Rik, syntaxin 5, D19Ertd627e
Type: Gene
Species: Mouse
Chromosome: 19
NCBI: 56389
Homologene: 2381
Cblc
Name: Casitas B-lineage lymphoma c
Synonyms: Cbl3, 2310076I21Rik, 2310079L19Rik
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 80794
Homologene: 8108
Chrng
Name: cholinergic receptor, nicotinic, gamma polypeptide
Synonyms: Achr-3, Acrg
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 11449
HGNC: HGNC:1967
Homologene: 3810
Kap
Name: kidney androgen regulated protein
Synonyms: kidney androgen-regulated protein
Type: Gene
Species: Mouse
Chromosome: 6
NCBI: 16483
Homologene: 49244
Pde6h
Name: phosphodiesterase 6H, cGMP-specific, cone, gamma
Synonyms: A930033D18Rik, PDEgamma
Type: Gene
Species: Mouse
Chromosome: 6
NCBI: 78600
HGNC: HGNC:8790
Homologene: 4522
Oosp3
Name: oocyte secreted protein 3
Synonyms: Gm97, LOC225923
Type: Gene
Species: Mouse
Chromosome: 19
NCBI: 225923
Glrp1
Name: glutamine repeat protein 1
Synonyms: GRP-1
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 14659
Mrln
Name: myoregulin
Synonyms: 2310015B20Rik, MLN, Linc-RAM
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 10
NCBI: 69563
Genetic Alterations
ENU-induced transitions at the following base pair locations (GRCm38):
  • A to C, chromosome 1 at 34,724,048 bp
  • T to A, chromosome 1 at 40,000,755 bp
  • A to T, chromosome 1 at 55,081,097 bp
  • A to G, chromosome 1 at 75,529,267 bp
  • A to G, chromosome 1 at 87,206,706 bp
  • GTGCTGCTGCTGCTGCTGCTGCTGCTG to GTGCTGCTGCTGCTGCTGCTGCTGCTGCTG, chromosome 1 at 88,503,275 bp
  • A to T, chromosome 3 at 136,242,940 bp
  • A to G, chromosome 3 at 146,487,540 bp
  • T to A, chromosome 4 at 48,604,692 bp
  • A to G, chromosome 4 at 58,957,364 bp
  • A to G, chromosome 4 at 94,820,224 bp
  • A to G, chromosome 4 at 103,096,661 bp
  • A to G, chromosome 5 at 32,924,171 bp
  • G to A, chromosome 5 at 34,196,662 bp
  • T to A, chromosome 5 at 137,836,080 bp
  • T to C, chromosome 6 at 133,850,094 bp
  • G to A, chromosome 6 at 136,963,208 bp
  • A to G, chromosome 7 at 19,780,964 bp
  • A to G, chromosome 7 at 30,039,171 bp
  • A to T, chromosome 7 at 109,933,671 bp
  • T to C, chromosome 7 at 113,553,737 bp
  • A to G, chromosome 7 at 116,368,202 bp
  • A to G, chromosome 9 at 14,826,547 bp
  • A to T, chromosome 9 at 22,057,566 bp
  • A to G, chromosome 9 at 24,310,005 bp
  • CGG to CG, chromosome 9 at 37,411,490 bp
  • T to C, chromosome 10 at 70,219,626 bp
  • T to A, chromosome 10 at 87,567,465 bp
  • T to A, chromosome 10 at 130,419,166 bp
  • A to T, chromosome 14 at 103,144,333 bp
  • G to T, chromosome 14 at 103,821,674 bp
  • A to C, chromosome 14 at 118,922,445 bp
  • A to T, chromosome 15 at 7,219,701 bp
  • T to C, chromosome 15 at 101,548,435 bp
  • A to G, chromosome 16 at 32,282,374 bp
  • G to A, chromosome 17 at 25,742,934 bp
  • T to A, chromosome 17 at 35,849,010 bp
  • A to G, chromosome 17 at 56,660,169 bp
  • A to G, chromosome 17 at 64,713,601 bp
  • T to A, chromosome 19 at 5,716,487 bp
  • T to C, chromosome 19 at 8,755,112 bp
  • T to A, chromosome 19 at 11,699,532 bp
  • T to C, chromosome 19 at 27,323,096 bp
  • C to G, chromosome 19 at 45,027,674 bp
Genotype Determination
Phenotype
G1 male heterozygous mice are viable and fertile. The G1 mice were not characterized prior to archiving.
Strain Development
C57BL/6J mice were injected with ENU, resulting in G0 mice that were bred back to C57BL/6J. Sperm was archived from G1 male mice that produced viable G2 mice.
Suggested Control Mice
Wild-type littermates or C57BL/6J mice
MMRRC Genetic QC Summary
The MMRRC Centers have developed a genetic QC pipeline using MiniMUGA array genotyping to provide additional information on strain backgrounds for MMRRC congenic and inbred strains. For more information on when data may be available, or to request genotyping for a strain of interest, please contact mmrrc@missouri.edu. Older strains may not have this information.
Donor
Bruce Beutler, M.D., University of Texas Southwestern Medical Center.
Primary Reference
MUTAGENETIX record for R2852 (G1). B. Beutler and colleagues, Center for the Genetics of Host Defense, UT Southwestern, Dallas, TX.

Colony and Husbandry Information

Colony Surveillance Program and Current Health Reports

Mice recovered from a cryo-archive will have health surveillance performed on recipient females. Health reports will be provided prior to shipment. If you require additional health status information, please email mmrrc@missouri.edu.
Coat Color
Black
MMRRC Breeding System
Random intra-strain mating
Breeding Scheme(s)
When maintaining a live colony, heterozygous mice may be bred together, bred with wild-type siblings, or bred with C57BL/6J inbred mice.
Overall Breeding Performance
Undetermined; during development, mating was done with heterozygous males; viability, fertility and other breeding statistics for heterozygous females and homozygotes are unverified, but presumably would be similar to the C57BL/6J background strain
Average litter size
Undetermined
Recommended wean age
3 weeks

Order Request Information

Limited quantities of breeder mice (recovered litter) are available from a cryoarchive; recovered litter usually available to ship in 3 to 4 months.

Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

Distribution of this strain requires submission of the MMRRC Conditions of Use (COU). A link to the COU web form will be provided via email after an order has been placed; the form should be completed then or the email forwarded to your institutional official for completion.

The donor or their institution limits the distribution to non-profit institutions only.

Additional charges may apply for any special requests. Shipping costs are in addition to the basic distribution/resuscitation fees. Information on shipping costs and any additional charges will be provided by the supplying MMRRC facility.

Click button to Request this one strain. (Use the MMRRC Catalog Search to request more than one strain.)
MMRRC Item # Description Distribution Fee / Unit (US $)
*Shipping & Handling not included*
Units Notes
040445-MU-RESUS Litter recovered from cryo-archive $5,475.00 / Non-Profit Litter Recovered litter4; additional fees for any special requests.
Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

Some MMRRC strains were submitted by the donor as cryopreserved germplasm, and because these strains were not cryopreserved by the MMRRC, we have not assessed the quality, nor genotype, of this material. Our expertise in reviving mice from various qualities of frozen sperm and embryos, using methods like IVF and ICSI, gives us confidence in successful recoveries in most cases. However, due to the uncertain quality of these samples, we'll limit revival attempts to two per order. Additional attempts are available for a fee, on top of standard charges, if requested. It's important to note that some strains may lack the expected mutation, so we can't assure successful order fulfillment until we attempt to revive the strain.

1 The distribution fee covers the expense of rederiving mice from a live mouse; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

2 An aliquot contains a sufficient number of embryos (in one or more vials or straws and based on the transfer success rate of the MMRRC facility) to transfer into one to three recipients. The MMRRC makes no guarantee concerning embryo transfer success experienced in the recipient investigator's laboratory. Neither gender nor genotype ratios are guaranteed.

3 An aliquot is one straw or vial with sufficient sperm to recover at least one litter of mice, as per provided protocols, when performed at the MMRRC facility. The MMRRC makes no guarantee concerning the success of these procedures when performed outside the MMRRC facilities.

4 The distribution fee covers the expense of resuscitating mice from the cryo-archive; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

To request material from the MMRRC: Please fill out our on-line request form (accessible from the catalog search results page, or click the Request this Strain button in the fees section). If you have questions or need assistance completing this form, you may call Customer Service at (800) 910-2291 (in USA or Canada) or (530) 757-5710 (international calls). Before you call, please have with you: the MMRRC item number, quantity needed, Bill-to and Ship-to contact information.