Loading Mouse GIF
Loading...

Strain Name:
C57BL/6J-MtgxR2858Btlr/Mmmh
Stock Number:
040448-MU
Citation ID:
RRID:MMRRC_040448-MU
Other Names:
R2858 (G1), C57BL/6J-MtgxR2858Btlr
Major Collection:

Strain Information

Ppp1r1b
Name: protein phosphatase 1, regulatory inhibitor subunit 1B
Synonyms: DARPP-32, Darpp32
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 19049
HGNC: HGNC:9287
Homologene: 12972
Ntmt1
Name: N-terminal Xaa-Pro-Lys N-methyltransferase 1
Synonyms: 2610205E22Rik, Mettl11a
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 66617
Homologene: 5439
Fbxo36
Name: F-box protein 36
Synonyms: 0610008D19Rik, 2410002G19Rik, 1110020F21Rik, D1Ertd757e
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 66153
Homologene: 11927
Setx
Name: senataxin
Synonyms: A930037J23Rik, Als4
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 269254
HGNC: HGNC:445
Homologene: 41003
Rcbtb1
Name: regulator of chromosome condensation (RCC1) and BTB (POZ) domain containing protein 1
Synonyms: 5430409I18Rik
Type: Gene
Species: Mouse
Chromosome: 14
NCBI: 71330
Homologene: 10061
Helz
Name: helicase with zinc finger domain
Synonyms: 9630002H22Rik, 9430093I07Rik, 3110078M01Rik
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 78455
Homologene: 8918
Bltp3a
Name: bridge-like lipid transfer protein family member 3A
Synonyms: 1110020K19Rik, F830021D11Rik, Uhrf1bp1
Type: Gene
Species: Mouse
Chromosome: 17
NCBI: 224648
Homologene: 9816
Chd4
Name: chromodomain helicase DNA binding protein 4
Synonyms: D6Ertd380e, 9530019N15Rik, Mi-2beta
Type: Gene
Species: Mouse
Chromosome: 6
NCBI: 107932
HGNC: HGNC:1919
Homologene: 68175
Abcg5
Name: ATP binding cassette subfamily G member 5
Synonyms: Sterolin-1, trac, cmp
Type: Gene
Species: Mouse
Chromosome: 17
NCBI: 27409
Homologene: 31909
Psmf1
Name: proteasome (prosome, macropain) inhibitor subunit 1
Synonyms: PI31
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 228769
HGNC: HGNC:9571
Homologene: 38231
Pask
Name: PAS domain containing serine/threonine kinase
Synonyms: Paskin
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 269224
Homologene: 9038
Vps13a
Name: vacuolar protein sorting 13A
Synonyms: 4930516E05Rik, D330038K10Rik, 4930543C13Rik
Type: Gene
Species: Mouse
Chromosome: 19
NCBI: 271564
VEGA: 19
HGNC: HGNC:1908
Homologene: 22068
Cdh23
Name: cadherin related 23 (otocadherin)
Synonyms: 4930542A03Rik, USH1D, mdfw, ahl, bob, nmf112, nmf181, nmf252, sals
Type: Gene
Species: Mouse
Chromosome: 10
NCBI: 22295
Homologene: 11142
Amfr
Name: autocrine motility factor receptor
Synonyms: gp78
Type: Gene
Species: Mouse
Chromosome: 8
NCBI: 23802
HGNC: HGNC:463
Homologene: 888
Fat2
Name: FAT atypical cadherin 2
Synonyms: LOC245827, mKIAA0811, Fath2, EMI2
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 245827
HGNC: HGNC:3596
Homologene: 1110
Hivep2
Name: human immunodeficiency virus type I enhancer binding protein 2
Synonyms: MIBP1, Schnurri-2, Shn-2, Gm20114
Type: Gene
Species: Mouse
Chromosome: 10
NCBI: 15273
HGNC: HGNC:4921
Homologene: 4900
Polq
Name: polymerase (DNA directed), theta
Synonyms: A430110D14Rik
Type: Gene
Species: Mouse
Chromosome: 16
NCBI: 77782
HGNC: HGNC:9186
Homologene: 32727
Lrrc7
Name: leucine rich repeat containing 7
Synonyms: densin, B230334C09Rik
Type: Gene
Species: Mouse
Chromosome: 3
NCBI: 242274
Homologene: 10817
Alox5ap
Name: arachidonate 5-lipoxygenase activating protein
Synonyms: arachidonate 5 lipoxygenase activating protein, Flap
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 11690
HGNC: HGNC:436
Homologene: 1231
Cd109
Name: CD109 antigen
Synonyms: Gov platelet alloantigens, 9930012E15Rik
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 235505
Homologene: 25183
Or11g27
Name: olfactory receptor family 11 subfamily G member 27
Synonyms: GA_x6K02T2N6FY-3870-3385, GA_x6K02T2N6FY-2320-2039, GA_x6K02T2PMLR-6243196-6244132, MOR106-8P, MOR106-14, Olfr265, Olfr743-ps1, Olfr264, Olfr743
Type: Gene
Species: Mouse
Chromosome: 14
NCBI: 219019
Homologene: 74163
Ddb2
Name: damage specific DNA binding protein 2
Synonyms: p48, 2610043A19Rik
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 107986
HGNC: HGNC:2718
Homologene: 83
Vmn2r82
Name: vomeronasal 2, receptor 82
Synonyms: EG624845
Type: Gene
Species: Mouse
Chromosome: 10
NCBI: 624845
Homologene: 83483
Fmo9
Name: flavin containing monooxygenase 9
Synonyms: 4831428F09Rik
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 240894
Homologene: 134192
Slc24a1
Name: solute carrier family 24 (sodium/potassium/calcium exchanger), member 1
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 214111
VEGA: 9
Homologene: 3472
Lrrc66
Name: leucine rich repeat containing 66
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 231296
Homologene: 51944
Slc6a21
Name: solute carrier family 6 member 21
Synonyms: 1700039E15Rik
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 76713
Homologene: 66347
Or3a10
Name: olfactory receptor family 3 subfamily A member 10
Synonyms: M5, MOR255-2, GA_x6K02T2P1NL-4202012-4201065, Olfr139
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 259005
Homologene: 77386
Zfp1007
Name: zinc finger protein 1007
Synonyms: ENSMUSG00000072763, 5430403G16Rik
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 77200
Nexn
Name: nexilin
Synonyms: nF actin binding protein, 1110046H09Rik
Type: Gene
Species: Mouse
Chromosome: 3
NCBI: 68810
Homologene: 44892
Ifit1bl1
Name: interferon induced protein with tetratricpeptide repeats 1B like 1
Synonyms: Gm14446
Type: Gene
Species: Mouse
Chromosome: 19
NCBI: 667373
Homologene: 78213
S1pr4
Name: sphingosine-1-phosphate receptor 4
Synonyms: lpC1, S1P4, Edg6
Type: Gene
Species: Mouse
Chromosome: 10
NCBI: 13611
VEGA: 10
HGNC: HGNC:3170
Homologene: 2799
Kcnk10
Name: potassium channel, subfamily K, member 10
Synonyms: 3010005K24Rik, 1700024D23Rik, Trek2
Type: Gene
Species: Mouse
Chromosome: 12
NCBI: 72258
VEGA: 12
HGNC: HGNC:6273
Homologene: 11321
1700028K03Rik
Name: RIKEN cDNA 1700028K03 gene
Synonyms: SCRE, Spo16
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 76421
Homologene: 18810
Or9e1
Name: olfactory receptor family 9 subfamily E member 1
Synonyms: GA_x6K02T2NKPP-565870-564944, MOR222-1, Olfr311
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 258530
Homologene: 77375
Sycp3
Name: synaptonemal complex protein 3
Synonyms: Scp3, Cor1
Type: Gene
Species: Mouse
Chromosome: 10
NCBI: 20962
Homologene: 7964
Cyp2a22
Name: cytochrome P450, family 2, subfamily a, polypeptide 22
Synonyms: EG233005
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 233005
Homologene: 69128
Ctla2a
Name: cytotoxic T lymphocyte-associated protein 2 alpha
Synonyms: Ctla-2a
Type: Gene
Species: Mouse
Chromosome: 13
NCBI: 13024
VEGA: 13
Homologene: 130627
Cyp4b1-ps2
Name: cytochrome P450, family 4, subfamily b, polypeptide 1, pseudogene 2
Synonyms: Gm12839
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 4
NCBI: 631037
Genetic Alterations
ENU-induced transitions at the following base pair locations (GRCm38):
  • A to G, chromosome 1 at 84,896,595 bp
  • A to G, chromosome 1 at 93,321,651 bp
  • A to C, chromosome 1 at 166,673,667 bp
  • GTGGCT to GT, chromosome 2 at 29,154,061 bp
  • A to G, chromosome 2 at 30,822,365 bp
  • T to C, chromosome 2 at 91,216,677 bp
  • A to G, chromosome 2 at 151,729,536 bp
  • C to T, chromosome 3 at 152,248,043 bp
  • T to A, chromosome 3 at 158,161,725 bp
  • G to A, chromosome 4 at 115,583,076 bp
  • T to A, chromosome 5 at 73,607,303 bp
  • T to A, chromosome 5 at 107,545,801 bp
  • T to C, chromosome 5 at 109,675,953 bp
  • T to C, chromosome 5 at 149,285,439 bp
  • A to G, chromosome 6 at 125,104,886 bp
  • T to C, chromosome 7 at 26,934,262 bp
  • G to A, chromosome 7 at 45,280,528 bp
  • A to T, chromosome 8 at 94,005,214 bp
  • T to C, chromosome 9 at 64,949,332 bp
  • CATTTATTTATTTATTTATTTATTTATTTATTTAT to CATTTATTTATTTATTTATTTATTTATTTATTTATTTAT, chromosome 9 at 78,712,500 bp
  • C to A, chromosome 10 at 14,128,969 bp
  • C to T, chromosome 10 at 60,382,653 bp
  • T to A, chromosome 10 at 79,381,256 bp
  • C to A, chromosome 10 at 81,499,239 bp
  • A to G, chromosome 10 at 88,467,372 bp
  • A to G, chromosome 11 at 55,283,773 bp
  • T to A, chromosome 11 at 58,841,882 bp
  • C to T, chromosome 11 at 74,044,827 bp
  • T to C, chromosome 11 at 98,355,319 bp
  • G to A, chromosome 11 at 107,672,927 bp
  • T to C, chromosome 12 at 98,435,289 bp
  • T to C, chromosome 13 at 60,935,681 bp
  • T to A, chromosome 14 at 50,533,440 bp
  • T to A, chromosome 14 at 59,221,412 bp
  • T to A, chromosome 16 at 37,062,753 bp
  • G to T, chromosome 17 at 27,885,462 bp
  • A to G, chromosome 17 at 84,670,220 bp
  • A to T, chromosome 19 at 16,766,552 bp
  • A to T, chromosome 19 at 34,594,322 bp
Genotype Determination
Phenotype
G1 male heterozygous mice are viable and fertile. The G1 mice were not characterized prior to archiving.
Strain GQC Summary
The MMRRC Centers have developed a Strain GQC pipeline using MiniMUGA array genotyping to provide additional information on strain backgrounds for MMRRC strains. For more information on whether data may be available, or to request genotyping for a strain of interest, please contact MMRRC_GeneticQC@med.unc.edu. Older strains may not have this information available.
Suggested Control Mice
Littermates of all relevant genotypes.
Donor
Bruce Beutler, M.D., University of Texas Southwestern Medical Center.
Primary Reference
MUTAGENETIX record for R2858 (G1). B. Beutler and colleagues, Center for the Genetics of Host Defense, UT Southwestern, Dallas, TX.
Strain Development
C57BL/6J mice were injected with ENU, resulting in G0 mice that were bred back to C57BL/6J. Sperm was archived from G1 male mice that produced viable G2 mice.


Disclaimer: If MMRRC Strain Genetic Quality Control (GQC; based on MiniMUGA genotyping and analysis) has been completed for this strain, the information might differ from the genetic background information provided by the submitter. MiniMUGA genetic analysis is done on a strain’s tissue samples taken when archived by or ordered from the assigned MMRRC Center.

Colony and Husbandry Information

Colony Surveillance Program and Current Health Reports

Mice recovered from a cryo-archive will have health surveillance performed on recipient females. Health reports will be provided prior to shipment. If you require additional health status information, please email mmrrc@missouri.edu.
Coat Color
Black
MMRRC Breeding System
Random intra-strain mating
Breeding Scheme(s)
When maintaining a live colony, heterozygous mice may be bred together, bred with wild-type siblings, or bred with C57BL/6J inbred mice.
Overall Breeding Performance
Undetermined; during development, mating was done with heterozygous males; viability, fertility and other breeding statistics for heterozygous females and homozygotes are unverified, but presumably would be similar to the C57BL/6J background strain
Average litter size
Undetermined
Recommended wean age
3 weeks

Order Request Information

Limited quantities of breeder mice (recovered litter) are available from a cryoarchive; recovered litter usually available to ship in 3 to 4 months.

Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

Distribution of this strain requires submission of the MMRRC Conditions of Use (COU). A link to the COU web form will be provided via email after an order has been placed; the form should be completed then or the email forwarded to your institutional official for completion.

The donor or their institution limits the distribution to non-profit institutions only.

Additional charges may apply for any special requests. Shipping costs are in addition to the basic distribution/resuscitation fees. Information on shipping costs and any additional charges will be provided by the supplying MMRRC facility.

Click button to Request this one strain. (Use the MMRRC Catalog Search to request more than one strain.)
MMRRC Item # Description Distribution Fee / Unit (US $)
*Shipping & Handling not included*
Units Notes
040448-MU-RESUS Litter recovered from cryo-archive $5,475.00 / Non-Profit Litter Recovered litter4; additional fees for any special requests.
Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

Some MMRRC strains were submitted by the donor as cryopreserved germplasm, and because these strains were not cryopreserved by the MMRRC, we have not assessed the quality, nor genotype, of this material. Our expertise in reviving mice from various qualities of frozen sperm and embryos, using methods like IVF and ICSI, gives us confidence in successful recoveries in most cases. However, due to the uncertain quality of these samples, we'll limit revival attempts to two per order. Additional attempts are available for a fee, on top of standard charges, if requested. It's important to note that some strains may lack the expected mutation, so we can't assure successful order fulfillment until we attempt to revive the strain.

1 The distribution fee covers the expense of rederiving mice from a live mouse; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

2 An aliquot contains a sufficient number of embryos (in one or more vials or straws and based on the transfer success rate of the MMRRC facility) to transfer into one to three recipients. The MMRRC makes no guarantee concerning embryo transfer success experienced in the recipient investigator's laboratory. Neither gender nor genotype ratios are guaranteed.

3 An aliquot is one straw or vial with sufficient sperm to recover at least one litter of mice, as per provided protocols, when performed at the MMRRC facility. The MMRRC makes no guarantee concerning the success of these procedures when performed outside the MMRRC facilities.

4 The distribution fee covers the expense of resuscitating mice from the cryo-archive; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

To request material from the MMRRC: Please fill out our on-line request form (accessible from the catalog search results page, or click the Request this Strain button in the fees section). If you have questions or need assistance completing this form, you may call Customer Service at (800) 910-2291 (in USA or Canada) or (530) 757-5710 (international calls). Before you call, please have with you: the MMRRC item number, quantity needed, Bill-to and Ship-to contact information.