Strain Name:
C57BL/6J-MtgxR2895Btlr/Mmmh
Stock Number:
040483-MU
Citation ID:
RRID:MMRRC_040483-MU
Other Names:
R2895 (G1), C57BL/6J-MtgxR2895Btlr
Major Collection:

Gene Information

Dysf
Name: dysferlin
Synonyms: 2310004N10Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 6
NCBI: 26903
HGNC: HGNC:3097
Homologene: 20748
Clasp1
Name: CLIP associating protein 1
Synonyms: 5730583A19Rik, 1700030C23Rik, mCLASP1, CLASP1alpha, CLASP1, B130045P17Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 1
NCBI: 76707
Homologene: 41024
Gpr1
Name: G protein-coupled receptor 1
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 1
NCBI: 241070
HGNC: HGNC:4463
Homologene: 21094
Sec24d
Name: Sec24 related gene family, member D (S. cerevisiae)
Synonyms: LOC383951, 2310020L09Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 3
NCBI: 69608
Homologene: 40986
Leo1
Name: Leo1, Paf1/RNA polymerase II complex component
Synonyms: LOC235497
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 9
NCBI: 235497
VEGA: 9
Homologene: 133895
Smg1
Name: SMG1 homolog, phosphatidylinositol 3-kinase-related kinase (C. elegans)
Synonyms: C130002K18Rik, 5430435M13Rik, 2610207I05Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 7
NCBI: 233789
Homologene: 56697
Lpar6
Name: lysophosphatidic acid receptor 6
Synonyms: P2y5, P2ry5, 2610302I02Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 14
NCBI: 67168
Homologene: 55925
Snx32
Name: sorting nexin 32
Synonyms: Snx6b, B930037P14Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 19
NCBI: 225861
VEGA: 19
Homologene: 62637
Pot1b
Name: protection of telomeres 1B
Synonyms: 2810458H16Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 17
NCBI: 72836
VEGA: 17
Homologene: 87058
Cyb5r4
Name: cytochrome b5 reductase 4
Synonyms: B5+B5R, Ncb5or, 2810034J18Rik, b5/b5r
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 9
NCBI: 266690
Homologene: 69207
Ttll4
Name: tubulin tyrosine ligase-like family, member 4
Synonyms: 4632407P03Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 1
NCBI: 67534
Homologene: 8764
Abhd3
Name: abhydrolase domain containing 3
Synonyms: LABH3
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 18
NCBI: 106861
Homologene: 14055
Scn10a
Name: sodium channel, voltage-gated, type X, alpha
Synonyms: Nav1.8
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 9
NCBI: 20264
VEGA: 9
Homologene: 21300
Lrrk2
Name: leucine-rich repeat kinase 2
Synonyms: 9330188B09Rik, 4921513O20Rik, cI-46, LOC381026, D630001M17Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 15
NCBI: 66725
Homologene: 18982
H3f3a
Name: H3.3 histone A
Synonyms: H3-3a, H3.3A
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 1
NCBI: 15078
Homologene: 134170
Nolc1
Name: nucleolar and coiled-body phosphoprotein 1
Synonyms: P130, 3230402K17Rik, NOPP140
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 19
NCBI: 70769
VEGA: 19
Fnip1
Name: folliculin interacting protein 1
Synonyms: A730024A03Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 11
NCBI: 216742
Homologene: 28173
Tlr3
Name: toll-like receptor 3
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 8
NCBI: 142980
Homologene: 20696
Muc5ac
Name: mucin 5, subtypes A and C, tracheobronchial/gastric
Synonyms: MGM, 2210005L13Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 7
NCBI: 17833
HGNC: HGNC:7515
Homologene: 137237
Zfhx4
Name: zinc finger homeodomain 4
Synonyms: Zfh4, Zfh-4, C130041O22Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 3
NCBI: 80892
Homologene: 23477
Plcz1
Name: phospholipase C, zeta 1
Synonyms: 1700041H07Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 6
NCBI: 114875
Homologene: 23815
Lonp1
Name: lon peptidase 1, mitochondrial
Synonyms: LON, Prss15, 1200017E13Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 17
NCBI: 74142
VEGA: 17
HGNC: HGNC:9479
Homologene: 3521
Slc7a1
Name: solute carrier family 7 (cationic amino acid transporter, y+ system), member 1
Synonyms: Atrc1, Rec-1, Rev-1, mCAT-1, Atrc-1, 4831426K01Rik, Cat1
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 5
NCBI: 11987
Homologene: 20658
Dnah9
Name: dynein, axonemal, heavy chain 9
Synonyms: D11Ertd686e, Dnahc9
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 11
NCBI: 237806
HGNC: HGNC:2953
Homologene: 20357
Rnasel
Name: ribonuclease L (2', 5'-oligoisoadenylate synthetase-dependent)
Synonyms: 2-5A-dependent RNAase, E230029I04Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 1
NCBI: 24014
Homologene: 8040
Caskin1
Name: CASK interacting protein 1
Synonyms: C630036E02Rik, 3300002N10Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 17
NCBI: 268932
VEGA: 17
Homologene: 25873
Abca6
Name: ATP-binding cassette, sub-family A (ABC1), member 6
Synonyms: 6330565N06Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 11
NCBI: 76184
HGNC: HGNC:36
Homologene: 71264
Kmt2d
Name: lysine (K)-specific methyltransferase 2D
Synonyms: C430014K11Rik, Mll4, Mll2
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 15
NCBI: 381022
HGNC: HGNC:7133
Homologene: 86893
Asic1
Name: acid-sensing (proton-gated) ion channel 1
Synonyms: B530003N02Rik, ASIC1a, ASICalpha, ASIC1 beta, Accn2, BNaC2, ASIC
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 15
NCBI: 11419
VEGA: 15
HGNC: HGNC:100
Homologene: 121755
Dnah7b
Name: dynein, axonemal, heavy chain 7B
Synonyms: LOC227058, Dnahc7b
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 1
NCBI: 227058
Homologene: 41287
Col15a1
Name: collagen, type XV, alpha 1
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 4
NCBI: 12819
HGNC: HGNC:2192
Homologene: 1396
Cd96
Name: CD96 antigen
Synonyms: 1700109I12Rik, Tactile
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 16
NCBI: 84544
Homologene: 68489
Map3k19
Name: mitogen-activated protein kinase kinase kinase 19
Synonyms: Ysk4
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 1
NCBI: 22625
Homologene: 19318
Atp6v0a1
Name: ATPase, H+ transporting, lysosomal V0 subunit A1
Synonyms: Atp6n1, Vpp-1, Vpp1, Atp6n1a, V-ATPase a1
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 11
NCBI: 11975
HGNC: HGNC:865
Homologene: 3795
Sntg2
Name: syntrophin, gamma 2
Synonyms: 2210008K22Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 12
NCBI: 268534
Homologene: 41298
Rgsl1
Name: regulator of G-protein signaling like 1
Synonyms: 4930415K13Rik, Rgsl2
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 1
NCBI: 240816
Homologene: 129962
Ptpre
Name: protein tyrosine phosphatase, receptor type, E
Synonyms: PTPe, PTPepsilon, RPTPepsilon
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 7
NCBI: 19267
HGNC: HGNC:9669
Homologene: 31387
Mrc2
Name: mannose receptor, C type 2
Synonyms: Endo180, novel lectin, uPARAP
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 11
NCBI: 17534
Homologene: 4408
Neu1
Name: neuraminidase 1
Synonyms: Aglp, Map-2, Apl, Neu-1, sialidase 1, Bat-7, Bat7, lysosomal sialidase, G9
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 17
NCBI: 18010
HGNC: HGNC:7758
Homologene: 375
Cyp3a11
Name: cytochrome P450, family 3, subfamily a, polypeptide 11
Synonyms: Cyp3a, IIIAm1, Pcn
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 5
NCBI: 13112
HGNC: HGNC:2638
Homologene: 133568
Cep250
Name: centrosomal protein 250
Synonyms: B230210E21Rik, Inmp, Cep2
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 2
NCBI: 16328
HGNC: HGNC:1859
Homologene: 38286
Hcn1
Name: hyperpolarization activated cyclic nucleotide gated potassium channel 1
Synonyms: hyperpolarization-activated, cyclic nucleotide-gated K+ 1, C630013B14Rik, Bcng1, HAC2
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 13
NCBI: 15165
HGNC: HGNC:4845
Homologene: 32093
Stfa3
Name: stefin A3
Synonyms: Stf3
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 16
NCBI: 20863
VEGA: 16
HGNC: HGNC:2481
Homologene: 115602
Olfr748
Name: olfactory receptor 748
Synonyms: MOR106-9P, GA_x6K02T2PMLR-6454789-6455712
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 14
NCBI: 258113
Homologene: 134081
Apol7e
Name: apolipoprotein L 7e
Synonyms: ENSMUSG00000071716
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 15
NCBI: 666348
VEGA: 15
Homologene: 40940
Abhd14b
Name: abhydrolase domain containing 14b
Synonyms: 1810013B01Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 9
NCBI: 76491
Homologene: 9125
Akirin1
Name: akirin 1
Synonyms: 6330407G11Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 4
NCBI: 68050
Homologene: 11348
Mrps7
Name: mitchondrial ribosomal protein S7
Synonyms: Rpms7, MRP-S7
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 11
NCBI: 50529
Homologene: 9321
Crygs
Name: crystallin, gamma S
Synonyms: Opj
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 16
NCBI: 12970
VEGA: 16
HGNC: HGNC:2417
Homologene: 40695
4930415L06Rik
Name: RIKEN cDNA 4930415L06 gene
Type: Gene
Species: Mus musculus (mouse)
Chromosome: X
NCBI: 245511
Homologene: 133109
Pcdh19
Name: protocadherin 19
Synonyms: B530002L05Rik, LOC279653
Type: Gene
Species: Mus musculus (mouse)
Chromosome: X
NCBI: 279653
Homologene: 18916
Genetic Alterations
ENU-induced transitions at the following base pair locations (GRCm38):
  • T to C, chromosome 1 at 46,139,741 bp
  • T to A, chromosome 1 at 63,183,162 bp
  • T to A, chromosome 1 at 74,685,358 bp
  • T to G, chromosome 1 at 118,459,838 bp
  • T to C, chromosome 1 at 127,822,098 bp
  • T to C, chromosome 1 at 153,760,776 bp
  • T to A, chromosome 1 at 153,827,548 bp
  • C to T, chromosome 1 at 180,803,138 bp
  • C to A, chromosome 2 at 155,992,122 bp
  • T to C, chromosome 3 at 5,244,309 bp
  • T to A, chromosome 3 at 123,343,151 bp
  • T to C, chromosome 4 at 47,312,091 bp
  • T to C, chromosome 4 at 123,738,071 bp
  • A to G, chromosome 5 at 145,869,112 bp
  • A to G, chromosome 5 at 148,340,592 bp
  • G to A, chromosome 6 at 84,186,509 bp
  • A to G, chromosome 6 at 140,023,151 bp
  • A to G, chromosome 7 at 118,189,143 bp
  • G to A, chromosome 7 at 135,643,858 bp
  • A to G, chromosome 7 at 141,791,140 bp
  • T to C, chromosome 8 at 45,397,592 bp
  • T to C, chromosome 9 at 75,461,002 bp
  • C to T, chromosome 9 at 87,040,399 bp
  • C to T, chromosome 9 at 106,450,114 bp
  • A to T, chromosome 9 at 119,661,401 bp
  • T to C, chromosome 11 at 54,475,780 bp
  • A to T, chromosome 11 at 66,076,478 bp
  • A to G, chromosome 11 at 101,044,598 bp
  • G to A, chromosome 11 at 105,348,431 bp
  • A to G, chromosome 11 at 110,202,426 bp
  • A to G, chromosome 11 at 115,605,039 bp
  • A to T, chromosome 12 at 30,226,846 bp
  • A to G, chromosome 13 at 117,874,091 bp
  • T to C, chromosome 14 at 50,710,516 bp
  • A to G, chromosome 14 at 73,239,276 bp
  • A to T, chromosome 15 at 77,714,467 bp
  • T to A, chromosome 15 at 91,814,651 bp
  • G to A, chromosome 15 at 98,843,939 bp
  • A to G, chromosome 15 at 99,696,602 bp
  • C to T, chromosome 16 at 22,805,551 bp
  • C to A, chromosome 16 at 36,452,160 bp
  • G to T, chromosome 16 at 46,117,805 bp
  • A to G, chromosome 17 at 24,489,042 bp
  • A to G, chromosome 17 at 34,932,782 bp
  • A to T, chromosome 17 at 55,687,939 bp
  • A to G, chromosome 17 at 56,615,562 bp
  • A to T, chromosome 18 at 10,658,765 bp
  • G to A, chromosome 19 at 5,498,171 bp
  • CCAGCAGCAGCAGCAGCAGCAGCAGC to CCAGCAGCAGCAGCAGCAGCAGCAGCAGC, chromosome 19 at 46,081,352 bp
  • A to G, chromosome X at 89,932,399 bp
  • CTGTCTCCTCCA to C, chromosome X at 133,681,308 bp
  • TGTCTCCTCCACGTC to TGTC, chromosome X at 133,681,309 bp
Genotype Determination
Phenotype
G1 male heterozygous mice are viable and fertile. The G1 mice were not characterized prior to archiving.
Strain Development
C57BL/6J mice were injected with ENU, resulting in G0 mice that were bred back to C57BL/6J. Sperm was archived from G1 male mice that produced viable G2 mice.
Suggested Control Mice
Wild-type littermates or C57BL/6J mice
Donor
Bruce Beutler, M.D., University of Texas Southwestern Medical Center.
Primary Reference
MUTAGENETIX record for R2895 (G1). B. Beutler and colleagues, Center for the Genetics of Host Defense, UT Southwestern, Dallas, TX.

Colony and Husbandry Information

Colony Surveillance Program and Current Health Reports

Mice recovered from a cryo-archive will have health surveillance performed on recipient females. Health reports will be provided prior to shipment. If you require additional health status information, please email mmrrc@missouri.edu .
Coat Color
Black
MMRRC Breeding System
Random intra-strain mating
Breeding Scheme(s)
When maintaining a live colony, heterozygous mice may be bred together, bred with wild-type siblings, or bred with C57BL/6J inbred mice.
Overall Breeding Performance
Undetermined; during development, mating was done with heterozygous males; viability, fertility and other breeding statistics for heterozygous females and homozygotes are unverified, but presumably would be similar to the C57BL/6J background strain
Average litter size
Undetermined
Recommended wean age
3 weeks

Order Request Information

Limited quantities of breeder mice (recovered litter) are available from a cryoarchive; recovered litter usually available to ship in 3 to 4 months.

Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

Distribution of this strain requires submission of the MMRRC Conditions of Use (COU). A link to the COU web form will be provided via email after an order has been placed; the form should be completed then or the email forwarded to your institutional official for completion.

The donor or their institution limits the distribution to non-profit institutions only.

Additional charges may apply for any special requests. Shipping costs are in addition to the basic distribution/resuscitation fees. Information on shipping costs and any additional charges will be provided by the supplying MMRRC facility.

Click button to Request this one strain. (Use the MMRRC Catalog Search to request more than one strain.)
MMRRC Item # Description Distribution Fee / Unit (US $) Units Notes
040483-MU-RESUS Litter recovered from cryo-archive $5,475.00 / Non-Profit Litter Recovered litter4; additional fees for any special requests.
Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

Some MMRRC strains were submitted by the donor as cryopreserved germplasm, and because these strains were not cryopreserved by the MMRRC, we have not assessed the quality of this material. We have extensive experience with recovery of mice from cryopreserved sperm and embryos of varying quality, including using techniques such as IVF and ICSI, and are confident that we will have success in most, if not all, cases. However, because of the unknown quality of these frozen samples, we will restrict recovery efforts to two attempts for each order. Subsequent attempts can be performed on a fee-for-service basis, in addition to the standard fees, upon request.

1 The distribution fee covers the expense of rederiving mice from a live mouse; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

2 An aliquot contains a sufficient number of embryos (in one or more vials or straws and based on the transfer success rate of the MMRRC facility) to transfer into one to three recipients. The MMRRC makes no guarantee concerning embryo transfer success experienced in the recipient investigator's laboratory. Neither gender nor genotype ratios are guaranteed.

3 An aliquot is one straw or vial with sufficient sperm to recover at least one litter of mice, as per provided protocols, when performed at the MMRRC facility. The MMRRC makes no guarantee concerning the success of these procedures when performed outside the MMRRC facilities.

4 The distribution fee covers the expense of resuscitating mice from the cryo-archive; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

To request material from the MMRRC: Please fill out our on-line request form (accessible from the catalog search results page, or click the Request this Strain button in the fees section). If you have questions or need assistance completing this form, you may call Customer Service at (800) 910-2291 (in USA or Canada) or (530) 757-5710 (international calls). Before you call, please have with you: the MMRRC item number, quantity needed, Bill-to and Ship-to contact information.