Loading Mouse GIF
Loading...

Strain Name:
C57BL/6J-MtgxR2898Btlr/Mmmh
Stock Number:
040486-MU
Citation ID:
RRID:MMRRC_040486-MU
Other Names:
R2898 (G1), C57BL/6J-MtgxR2898Btlr
Major Collection:

Strain Information

Vps41
Name: VPS41 HOPS complex subunit
Synonyms: Vam2, mVam2
Type: Gene
Species: Mouse
Chromosome: 13
NCBI: 218035
VEGA: 13
Homologene: 69165
Ndrg4
Name: N-myc downstream regulated gene 4
Synonyms: D8Bwg1337e, Ndr1-rs, SMAP-8, Ndr4
Type: Gene
Species: Mouse
Chromosome: 8
NCBI: 234593
Homologene: 23228
Fzd9
Name: frizzled class receptor 9
Synonyms: mfz9, frizzled 9, Fz9
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 14371
HGNC: HGNC:4047
Homologene: 2619
Ppp1r9a
Name: protein phosphatase 1, regulatory subunit 9A
Synonyms: 4930518N04Rik, neurabin-I, A230094E16Rik, 2810430P21Rik, Neurabin I, NRB
Type: Gene
Species: Mouse
Chromosome: 6
NCBI: 243725
Homologene: 14247
Dmd
Name: dystrophin, muscular dystrophy
Synonyms: Duchenne muscular dystrophy, pke, mdx, X-linked muscular dystrophy, Dp427, Dp71, dys
Type: Gene
Species: Mus musculus (mouse)
Chromosome: X
NCBI: 13405
HGNC: HGNC:2928
Homologene: 20856
Taok3
Name: TAO kinase 3
Synonyms: A430105I05Rik, 2900006A08Rik
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 330177
Homologene: 83279
Shroom3
Name: shroom family member 3
Synonyms: D5Ertd287e, Shrm, Shrm3
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 27428
Homologene: 9263
Tnks2
Name: tankyrase, TRF1-interacting ankyrin-related ADP-ribose polymerase 2
Synonyms: 5430432P15Rik, Parp5b
Type: Gene
Species: Mouse
Chromosome: 19
NCBI: 74493
Homologene: 11890
Bnc2
Name: basonuclin zinc finger protein 2
Synonyms: 5031434M05Rik, 8430420F16Rik
Type: Gene
Species: Mouse
Chromosome: 4
NCBI: 242509
Homologene: 18243
Sacm1l
Name: SAC1 suppressor of actin mutations 1-like (yeast)
Synonyms: Sac1p, SAC1
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 83493
VEGA: 9
Homologene: 6320
Brwd1
Name: bromodomain and WD repeat domain containing 1
Synonyms: 5330419I02Rik, D530019K20Rik, G1-403-16, Wdr9, repro5
Type: Gene
Species: Mouse
Chromosome: 16
NCBI: 93871
Homologene: 23130
Ppp1r10
Name: protein phosphatase 1, regulatory subunit 10
Synonyms: 2610025H06Rik, D17Ertd808e, PNUTS
Type: Gene
Species: Mouse
Chromosome: 17
NCBI: 52040
HGNC: HGNC:9284
Homologene: 2033
Ric8b
Name: RIC8 guanine nucleotide exchange factor B
Synonyms: Ric-8, Ric-8b
Type: Gene
Species: Mouse
Chromosome: 10
NCBI: 237422
VEGA: 10
Homologene: 23080
Prpf8
Name: pre-mRNA processing factor 8
Synonyms: DBF3/PRP8, Prp8, D11Bwg0410e, Sfprp8l
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 192159
Homologene: 4706
Hnf1a
Name: HNF1 homeobox A
Synonyms: hepatocyte nuclear factor 1, HNF1-alpha, HNF1[a], HNF1, Hnf-1, Hnf1alpha, LFB1, Tcf1
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 21405
Homologene: 459
Usp53
Name: ubiquitin specific peptidase 53
Synonyms: Sp6, Phxr3, mbo
Type: Gene
Species: Mouse
Chromosome: 3
NCBI: 99526
Homologene: 34521
Cit
Name: citron
Synonyms: CRIK-SK, citron-N, citron kinase, Cit-k, C030025P15Rik
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 12704
HGNC: HGNC:1985
Homologene: 21404
Gfm2
Name: G elongation factor, mitochondrial 2
Synonyms: MST027, EFG2, A930009M04Rik, 6530419G12Rik
Type: Gene
Species: Mouse
Chromosome: 13
NCBI: 320806
Homologene: 6238
Tasor2
Name: transcription activation suppressor family member 2
Synonyms: BC016423, Fam208b
Type: Gene
Species: Mouse
Chromosome: 13
NCBI: 105203
VEGA: 13
Homologene: 26435
Lmo7
Name: LIM domain only 7
Synonyms: LOC380928, FBXO20
Type: Gene
Species: Mouse
Chromosome: 14
NCBI: 380928
HGNC: HGNC:6646
Homologene: 83924
Zfp37
Name: zinc finger protein 37
Synonyms: Tzn, Zfp-37
Type: Gene
Species: Mouse
Chromosome: 4
NCBI: 22696
Homologene: 40682
Zfp81
Name: zinc finger protein 81
Synonyms: KRAB13, Zfp78, Hszfp36, C330034P10Rik, D330034E10Rik
Type: Gene
Species: Mouse
Chromosome: 17
NCBI: 224694
Homologene: 138633
Inpp4a
Name: inositol polyphosphate-4-phosphatase, type I
Synonyms: 107kDa
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 269180
HGNC: HGNC:6074
Homologene: 2871
Cep192
Name: centrosomal protein 192
Synonyms: D430014P18Rik, 4631422C13Rik
Type: Gene
Species: Mouse
Chromosome: 18
NCBI: 70799
VEGA: 18
Homologene: 73526
Myo7a
Name: myosin VIIA
Synonyms: Myo7, USH1B, nmf371, polka, Hdb
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 17921
HGNC: HGNC:7606
Homologene: 219
Myo6
Name: myosin VI
Synonyms: Tlc, Myo6rsv, rsv
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 17920
HGNC: HGNC:7605
Homologene: 56417
Tns2
Name: tensin 2
Synonyms: nep, nph, Tenc1
Type: Gene
Species: Mouse
Chromosome: 15
NCBI: 209039
VEGA: 15
Homologene: 37077
Dnah10
Name: dynein, axonemal, heavy chain 10
Synonyms: Dnahc10
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 56087
HGNC: HGNC:2941
Homologene: 25816
Itpr2
Name: inositol 1,4,5-triphosphate receptor 2
Synonyms: Ip3r2, Itpr5
Type: Gene
Species: Mouse
Chromosome: 6
NCBI: 16439
HGNC: HGNC:6181
Homologene: 37593
Or8b1c
Name: olfactory receptor family 8 subfamily B member 1C
Synonyms: GA_x6K02T2PVTD-32165709-32166641, MOR167-1, Olfr905
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 258800
VEGA: 9
Homologene: 110524
Ulk3
Name: unc-51-like kinase 3
Synonyms: 1200015E14Rik
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 71742
VEGA: 9
Homologene: 68482
Lrriq1
Name: leucine-rich repeats and IQ motif containing 1
Synonyms: LOC380658, 4930503E15Rik, Gm1557
Type: Gene
Species: Mouse
Chromosome: 10
NCBI: 74978
Homologene: 46007
Ptprn
Name: protein tyrosine phosphatase receptor type N
Synonyms: IA-2
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 19275
HGNC: HGNC:9676
Homologene: 48142
Chd5
Name: chromodomain helicase DNA binding protein 5
Synonyms: B230399N07Rik, 4930532L22Rik
Type: Gene
Species: Mouse
Chromosome: 4
NCBI: 269610
Homologene: 56712
Slc38a7
Name: solute carrier family 38, member 7
Type: Gene
Species: Mouse
Chromosome: 8
NCBI: 234595
Homologene: 41237
Neu2
Name: neuraminidase 2
Synonyms: brain sialidase, cystolic sialidase, MSS, MBS, MTS
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 23956
HGNC: HGNC:7759
Homologene: 3927
Adgrg3
Name: adhesion G protein-coupled receptor G3
Synonyms: Pb99, A030001G24Rik, Gpr97
Type: Gene
Species: Mouse
Chromosome: 8
NCBI: 54672
Homologene: 18129
Tbc1d16
Name: TBC1 domain family, member 16
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 207592
Homologene: 10380
Hid1
Name: HID1 domain containing
Synonyms: C630004H02Rik
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 217310
Homologene: 12737
Tectb
Name: tectorin beta
Synonyms: [b]-tectorin, Tctnb
Type: Gene
Species: Mouse
Chromosome: 19
NCBI: 21684
Homologene: 7568
Lrrc15
Name: leucine rich repeat containing 15
Synonyms: 5430427N11Rik
Type: Gene
Species: Mouse
Chromosome: 16
NCBI: 74488
Homologene: 26080
Fbxw21
Name: F-box and WD-40 domain protein 21
Synonyms: E330009P21Rik
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 320082
Homologene: 110776
Sh2b3
Name: SH2B adaptor protein 3
Synonyms: Lnk
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 16923
Homologene: 36179
Adcy6
Name: adenylate cyclase 6
Synonyms: AC6
Type: Gene
Species: Mouse
Chromosome: 15
NCBI: 11512
VEGA: 15
HGNC: HGNC:237
Homologene: 22400
Spty2d1
Name: SPT2 chromatin protein domain containing 1
Synonyms: 5830435K17Rik
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 101685
Homologene: 45499
Acap3
Name: ArfGAP with coiled-coil, ankyrin repeat and PH domains 3
Synonyms: Kiaa1716-hp, Centb5
Type: Gene
Species: Mouse
Chromosome: 4
NCBI: 140500
Homologene: 23708
Zfp777
Name: zinc finger protein 777
Synonyms: 2500002G23Rik
Type: Gene
Species: Mouse
Chromosome: 6
NCBI: 72306
Homologene: 56721
Pcdhb1
Name: protocadherin beta 1
Synonyms: PcdhbA
Type: Gene
Species: Mouse
Chromosome: 18
NCBI: 93872
HGNC: HGNC:8680
Homologene: 8348
Hsd3b1
Name: hydroxy-delta-5-steroid dehydrogenase, 3 beta- and steroid delta-isomerase 1
Synonyms: D3Ertd383e
Type: Gene
Species: Mouse
Chromosome: 3
NCBI: 15492
Homologene: 69149
Kcnh8
Name: potassium voltage-gated channel, subfamily H (eag-related), member 8
Synonyms: Kv12.1, ELK1, C130090D05Rik
Type: Gene
Species: Mouse
Chromosome: 17
NCBI: 211468
Homologene: 14332
Hmgxb3
Name: HMG box domain containing 3
Synonyms: 2510002C16Rik, A630042L21Rik
Type: Gene
Species: Mouse
Chromosome: 18
NCBI: 106894
VEGA: 18
Homologene: 44229
Ankk1
Name: ankyrin repeat and kinase domain containing 1
Synonyms: 9930020N01Rik
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 244859
VEGA: 9
Homologene: 18258
Stk36
Name: serine/threonine kinase 36
Synonyms: 1700112N14Rik, Fused
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 269209
Homologene: 49432
Coq9
Name: coenzyme Q9
Synonyms: 2310005O14Rik
Type: Gene
Species: Mouse
Chromosome: 8
NCBI: 67914
Homologene: 6477
Mpp4
Name: membrane protein, palmitoylated 4 (MAGUK p55 subfamily member 4)
Synonyms: DLG6
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 227157
Homologene: 23296
Bnipl
Name: BCL2/adenovirus E1B 19kD interacting protein like
Synonyms: BNIPL-2, BNIPL-1, BNIPL2, BNIPL1, PP753, BNIPL, 1700128A13Rik, BNIP-S
Type: Gene
Species: Mouse
Chromosome: 3
NCBI: 171388
Homologene: 15900
Sema6c
Name: sema domain, transmembrane domain (TM), and cytoplasmic domain, (semaphorin) 6C
Synonyms: Sema Y, Semay
Type: Gene
Species: Mouse
Chromosome: 3
NCBI: 20360
Homologene: 7931
Cxcr2
Name: C-X-C motif chemokine receptor 2
Synonyms: CD128, IL-8Rh, IL-8rb, Gpcr16, IL8RA, Cmkar2, Il8rb
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 12765
HGNC: HGNC:6027
Homologene: 10439
Or51g1
Name: olfactory receptor family 51 subfamily G member 1
Synonyms: GA_x6K02T2PBJ9-5696486-5695545, MOR7-1, Olfr578
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 259119
Homologene: 17513
Sirt6
Name: sirtuin 6
Synonyms: 2810449N18Rik
Type: Gene
Species: Mouse
Chromosome: 10
NCBI: 50721
Homologene: 6924
Thumpd2
Name: THUMP domain containing 2
Synonyms: 2810025A12Rik
Type: Gene
Species: Mouse
Chromosome: 17
NCBI: 72167
VEGA: 17
Homologene: 11898
Sycp3
Name: synaptonemal complex protein 3
Synonyms: Scp3, Cor1
Type: Gene
Species: Mouse
Chromosome: 10
NCBI: 20962
Homologene: 7964
Gkn3
Name: gastrokine 3
Synonyms: 1190003M12Rik
Type: Gene
Species: Mouse
Chromosome: 6
NCBI: 68888
Homologene: 87422
4930480E11Rik
Name: RIKEN cDNA 4930480E11 gene
Type: Gene
Species: Mouse
Chromosome: X
NCBI: 74910
Homologene: 136363
Genetic Alterations
ENU-induced transitions at the following base pair locations (GRCm38):
  • A to T, chromosome 1 at 37,366,594 bp
  • T to C, chromosome 1 at 59,144,694 bp
  • T to C, chromosome 1 at 74,158,971 bp
  • T to A, chromosome 1 at 74,632,825 bp
  • C to A, chromosome 1 at 75,253,170 bp
  • A to G, chromosome 1 at 87,595,060 bp
  • G to T, chromosome 2 at 153,667,630 bp
  • C to A, chromosome 3 at 95,172,818 bp
  • T to A, chromosome 3 at 95,243,049 bp
  • A to T, chromosome 3 at 98,853,307 bp
  • A to T, chromosome 3 at 122,957,574 bp
  • C to T, chromosome 4 at 62,191,777 bp
  • T to C, chromosome 4 at 84,292,915 bp
  • T to C, chromosome 4 at 152,372,115 bp
  • C to T, chromosome 4 at 155,903,459 bp
  • G to C, chromosome 4 at 155,904,931 bp
  • G to T, chromosome 5 at 92,943,086 bp
  • C to T, chromosome 5 at 114,960,047 bp
  • A to G, chromosome 5 at 115,873,978 bp
  • A to G, chromosome 5 at 117,200,069 bp
  • A to T, chromosome 5 at 121,829,048 bp
  • G to A, chromosome 5 at 124,817,670 bp
  • T to G, chromosome 5 at 135,249,846 bp
  • C to T, chromosome 6 at 4,906,558 bp
  • C to T, chromosome 6 at 48,025,660 bp
  • C to T, chromosome 6 at 87,383,525 bp
  • C to T, chromosome 6 at 146,173,341 bp
  • A to T, chromosome 6 at 146,323,169 bp
  • G to A, chromosome 7 at 28,898,266 bp
  • T to A, chromosome 7 at 46,993,352 bp
  • G to T, chromosome 7 at 98,054,424 bp
  • T to C, chromosome 7 at 98,097,206 bp
  • T to A, chromosome 7 at 102,984,877 bp
  • T to C, chromosome 8 at 94,853,124 bp
  • A to G, chromosome 8 at 95,036,946 bp
  • A to G, chromosome 8 at 95,678,386 bp
  • A to G, chromosome 8 at 95,845,796 bp
  • T to C, chromosome 9 at 38,472,975 bp
  • T to A, chromosome 9 at 49,421,822 bp
  • T to C, chromosome 9 at 57,593,968 bp
  • T to C, chromosome 9 at 67,031,040 bp
  • T to A, chromosome 9 at 80,269,611 bp
  • T to C, chromosome 9 at 109,156,336 bp
  • T to C, chromosome 9 at 123,560,601 bp
  • A to G, chromosome 10 at 81,627,458 bp
  • T to G, chromosome 10 at 84,947,897 bp
  • G to A, chromosome 10 at 88,472,682 bp
  • T to C, chromosome 10 at 103,227,250 bp
  • A to T, chromosome 11 at 75,496,034 bp
  • A to G, chromosome 11 at 115,350,530 bp
  • A to T, chromosome 11 at 119,157,828 bp
  • T to C, chromosome 13 at 3,585,122 bp
  • T to C, chromosome 13 at 18,810,428 bp
  • T to C, chromosome 13 at 97,172,961 bp
  • A to G, chromosome 14 at 101,876,914 bp
  • A to G, chromosome 15 at 98,593,488 bp
  • C to T, chromosome 15 at 102,108,934 bp
  • C to T, chromosome 16 at 30,273,786 bp
  • C to A, chromosome 16 at 96,066,100 bp
  • A to T, chromosome 17 at 33,334,300 bp
  • A to G, chromosome 17 at 35,928,892 bp
  • GAGACCAACGAGCAGCTGATGCTTCAGA to GAGA, chromosome 17 at 52,725,906 bp
  • C to T, chromosome 17 at 81,044,128 bp
  • A to G, chromosome 18 at 37,266,463 bp
  • C to T, chromosome 18 at 61,155,296 bp
  • T to A, chromosome 18 at 67,855,270 bp
  • T to C, chromosome 19 at 36,872,590 bp
  • C to G, chromosome 19 at 55,180,999 bp
  • C to T, chromosome X at 78,370,262 bp
  • T to A, chromosome X at 83,781,517 bp
Genotype Determination
Phenotype
G1 male heterozygous mice are viable and fertile. The G1 mice were not characterized prior to archiving.
Strain Development
C57BL/6J mice were injected with ENU, resulting in G0 mice that were bred back to C57BL/6J. Sperm was archived from G1 male mice that produced viable G2 mice.
Suggested Control Mice
Wild-type littermates or C57BL/6J mice
MMRRC Genetic QC Summary
The MMRRC Centers have developed a genetic QC pipeline using MiniMUGA array genotyping to provide additional information on strain backgrounds for MMRRC congenic and inbred strains. For more information on when data may be available, or to request genotyping for a strain of interest, please contact mmrrc@missouri.edu. Older strains may not have this information.
Donor
Bruce Beutler, M.D., University of Texas Southwestern Medical Center.
Primary Reference
MUTAGENETIX record for R2898 (G1). B. Beutler and colleagues, Center for the Genetics of Host Defense, UT Southwestern, Dallas, TX.

Colony and Husbandry Information

Colony Surveillance Program and Current Health Reports

Mice recovered from a cryo-archive will have health surveillance performed on recipient females. Health reports will be provided prior to shipment. If you require additional health status information, please email mmrrc@missouri.edu.
Coat Color
Black
MMRRC Breeding System
Random intra-strain mating
Breeding Scheme(s)
When maintaining a live colony, heterozygous mice may be bred together, bred with wild-type siblings, or bred with C57BL/6J inbred mice.
Overall Breeding Performance
Undetermined; during development, mating was done with heterozygous males; viability, fertility and other breeding statistics for heterozygous females and homozygotes are unverified, but presumably would be similar to the C57BL/6J background strain
Average litter size
Undetermined
Recommended wean age
3 weeks

Order Request Information

Limited quantities of breeder mice (recovered litter) are available from a cryoarchive; recovered litter usually available to ship in 3 to 4 months.

Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

Distribution of this strain requires submission of the MMRRC Conditions of Use (COU). A link to the COU web form will be provided via email after an order has been placed; the form should be completed then or the email forwarded to your institutional official for completion.

The donor or their institution limits the distribution to non-profit institutions only.

Additional charges may apply for any special requests. Shipping costs are in addition to the basic distribution/resuscitation fees. Information on shipping costs and any additional charges will be provided by the supplying MMRRC facility.

Click button to Request this one strain. (Use the MMRRC Catalog Search to request more than one strain.)
MMRRC Item # Description Distribution Fee / Unit (US $)
*Shipping & Handling not included*
Units Notes
040486-MU-RESUS Litter recovered from cryo-archive $5,475.00 / Non-Profit Litter Recovered litter4; additional fees for any special requests.
Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

Some MMRRC strains were submitted by the donor as cryopreserved germplasm, and because these strains were not cryopreserved by the MMRRC, we have not assessed the quality, nor genotype, of this material. Our expertise in reviving mice from various qualities of frozen sperm and embryos, using methods like IVF and ICSI, gives us confidence in successful recoveries in most cases. However, due to the uncertain quality of these samples, we'll limit revival attempts to two per order. Additional attempts are available for a fee, on top of standard charges, if requested. It's important to note that some strains may lack the expected mutation, so we can't assure successful order fulfillment until we attempt to revive the strain.

1 The distribution fee covers the expense of rederiving mice from a live mouse; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

2 An aliquot contains a sufficient number of embryos (in one or more vials or straws and based on the transfer success rate of the MMRRC facility) to transfer into one to three recipients. The MMRRC makes no guarantee concerning embryo transfer success experienced in the recipient investigator's laboratory. Neither gender nor genotype ratios are guaranteed.

3 An aliquot is one straw or vial with sufficient sperm to recover at least one litter of mice, as per provided protocols, when performed at the MMRRC facility. The MMRRC makes no guarantee concerning the success of these procedures when performed outside the MMRRC facilities.

4 The distribution fee covers the expense of resuscitating mice from the cryo-archive; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

To request material from the MMRRC: Please fill out our on-line request form (accessible from the catalog search results page, or click the Request this Strain button in the fees section). If you have questions or need assistance completing this form, you may call Customer Service at (800) 910-2291 (in USA or Canada) or (530) 757-5710 (international calls). Before you call, please have with you: the MMRRC item number, quantity needed, Bill-to and Ship-to contact information.