Strain Name:
Stock Number:
Citation ID:
Other Names:
R2898 (G1), C57BL/6J-MtgxR2898Btlr
Major Collection:

Strain Information

Name: VPS41 HOPS complex subunit
Synonyms: Vam2, mVam2
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 13
NCBI: 218035
VEGA: 13
Homologene: 69165
Name: N-myc downstream regulated gene 4
Synonyms: D8Bwg1337e, Ndr1-rs, SMAP-8, Ndr4
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 8
NCBI: 234593
Homologene: 23228
Name: frizzled class receptor 9
Synonyms: mfz9, frizzled 9, Fz9
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 5
NCBI: 14371
Homologene: 2619
Name: actinin alpha 4
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 7
NCBI: 60595
Homologene: 55857
Name: protein phosphatase 1, regulatory subunit 9A
Synonyms: 4930518N04Rik, neurabin-I, A230094E16Rik, 2810430P21Rik, Neurabin I, NRB
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 6
NCBI: 243725
Homologene: 14247
Name: dystrophin, muscular dystrophy
Synonyms: Duchenne muscular dystrophy, mdx, pke, X-linked muscular dystrophy, Dp427, Dp71, dys
Type: Gene
Species: Mus musculus (mouse)
Chromosome: X
NCBI: 13405
Homologene: 20856
Name: TAO kinase 3
Synonyms: A430105I05Rik, 2900006A08Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 5
NCBI: 330177
Homologene: 83279
Name: shroom family member 3
Synonyms: D5Ertd287e, Shrm, Shrm3
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 5
NCBI: 27428
Homologene: 9263
Name: tankyrase, TRF1-interacting ankyrin-related ADP-ribose polymerase 2
Synonyms: 5430432P15Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 19
NCBI: 74493
Homologene: 11890
Name: basonuclin 2
Synonyms: 5031434M05Rik, 8430420F16Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 4
NCBI: 242509
Homologene: 18243
Name: DNA methyltransferase 3B
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 2
NCBI: 13436
Homologene: 56000
Name: SAC1 suppressor of actin mutations 1-like (yeast)
Synonyms: Sac1p, SAC1
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 9
NCBI: 83493
Homologene: 6320
Name: bromodomain and WD repeat domain containing 1
Synonyms: 5330419I02Rik, D530019K20Rik, G1-403-16, Wdr9, repro5
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 16
NCBI: 93871
Homologene: 23130
Name: protein phosphatase 1, regulatory subunit 10
Synonyms: 2610025H06Rik, D17Ertd808e, PNUTS
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 17
NCBI: 52040
Homologene: 2033
Name: RIC8 guanine nucleotide exchange factor B
Synonyms: Ric-8, Ric-8b
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 10
NCBI: 237422
VEGA: 10
Homologene: 23080
Name: pre-mRNA processing factor 8
Synonyms: DBF3/PRP8, Prp8, D11Bwg0410e, Sfprp8l
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 11
NCBI: 192159
Homologene: 4706
Name: HNF1 homeobox A
Synonyms: hepatocyte nuclear factor 1, HNF1-alpha, HNF1[a], HNF1, Hnf-1, Hnf1alpha, LFB1, Tcf1
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 5
NCBI: 21405
Homologene: 459
Name: ubiquitin specific peptidase 53
Synonyms: Sp6, Phxr3, mbo
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 3
NCBI: 99526
Homologene: 34521
Name: citron
Synonyms: CRIK-SK, citron-N, citron kinase, Cit-k, C030025P15Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 5
NCBI: 12704
Homologene: 21404
Name: G elongation factor, mitochondrial 2
Synonyms: MST027, EFG2, A930009M04Rik, 6530419G12Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 13
NCBI: 320806
Homologene: 6238
Name: transcription activation suppressor family member 2
Synonyms: BC016423, Fam208b
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 13
NCBI: 105203
VEGA: 13
Homologene: 26435
Name: LIM domain only 7
Synonyms: LOC380928, FBXO20
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 14
NCBI: 380928
Homologene: 83924
Name: tropomyosin 1, alpha
Synonyms: Tpm-1, alpha-TM, TM2, Tm3
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 9
NCBI: 22003
Homologene: 128637
Name: zinc finger protein 37
Synonyms: Tzn, Zfp-37
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 4
NCBI: 22696
Homologene: 40682
Name: zinc finger protein 81
Synonyms: KRAB13, Zfp78, Hszfp36, C330034P10Rik, D330034E10Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 17
NCBI: 224694
Homologene: 138633
Name: inositol polyphosphate-4-phosphatase, type I
Synonyms: 107kDa
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 1
NCBI: 269180
Homologene: 2871
Name: centrosomal protein 192
Synonyms: D430014P18Rik, 4631422C13Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 18
NCBI: 70799
VEGA: 18
Homologene: 73526
Name: myosin VIIA
Synonyms: Myo7, USH1B, nmf371, polka, Hdb
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 7
NCBI: 17921
Homologene: 219
Name: myosin VI
Synonyms: Tlc, Myo6rsv, rsv
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 9
NCBI: 17920
Homologene: 56417
Name: tensin 2
Synonyms: nep, nph, Tenc1
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 15
NCBI: 209039
VEGA: 15
Homologene: 37077
Name: dynein, axonemal, heavy chain 10
Synonyms: Dnahc10
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 5
NCBI: 56087
Homologene: 25816
Name: inositol 1,4,5-triphosphate receptor 2
Synonyms: Ip3r2, Itpr5
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 6
NCBI: 16439
Homologene: 37593
Name: olfactory receptor family 8 subfamily B member 1C
Synonyms: GA_x6K02T2PVTD-32165709-32166641, MOR167-1, Olfr905
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 9
NCBI: 258800
Homologene: 110524
Name: unc-51-like kinase 3
Synonyms: 1200015E14Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 9
NCBI: 71742
Homologene: 68482
Name: leucine-rich repeats and IQ motif containing 1
Synonyms: LOC380658, 4930503E15Rik, Gm1557
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 10
NCBI: 74978
Homologene: 46007
Name: protein tyrosine phosphatase, receptor type, N
Synonyms: IA-2
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 1
NCBI: 19275
Homologene: 48142
Name: chromodomain helicase DNA binding protein 5
Synonyms: B230399N07Rik, 4930532L22Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 4
NCBI: 269610
Homologene: 56712
Name: solute carrier family 38, member 7
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 8
NCBI: 234595
Homologene: 41237
Name: neuraminidase 2
Synonyms: brain sialidase, cystolic sialidase, MSS, MBS, MTS
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 1
NCBI: 23956
Homologene: 3927
Name: adhesion G protein-coupled receptor G3
Synonyms: Pb99, A030001G24Rik, Gpr97
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 8
NCBI: 54672
Homologene: 18129
Name: TBC1 domain family, member 16
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 11
NCBI: 207592
Homologene: 10380
Name: HID1 domain containing
Synonyms: C630004H02Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 11
NCBI: 217310
Homologene: 12737
Name: tectorin beta
Synonyms: [b]-tectorin, Tctnb
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 19
NCBI: 21684
Homologene: 7568
Name: leucine rich repeat containing 15
Synonyms: 5430427N11Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 16
NCBI: 74488
Homologene: 26080
Name: F-box and WD-40 domain protein 21
Synonyms: E330009P21Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 9
NCBI: 320082
Homologene: 110776
Name: SH2B adaptor protein 3
Synonyms: Lnk
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 5
NCBI: 16923
Homologene: 36179
Name: adenylate cyclase 6
Synonyms: AC6
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 15
NCBI: 11512
VEGA: 15
Homologene: 22400
Name: SPT2 chromatin protein domain containing 1
Synonyms: 5830435K17Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 7
NCBI: 101685
Homologene: 45499
Name: ArfGAP with coiled-coil, ankyrin repeat and PH domains 3
Synonyms: Kiaa1716-hp, Centb5
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 4
NCBI: 140500
Homologene: 23708
Name: zinc finger protein 777
Synonyms: 2500002G23Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 6
NCBI: 72306
Homologene: 56721
Name: protocadherin beta 1
Synonyms: PcdhbA
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 18
NCBI: 93872
Homologene: 8348
Name: hydroxy-delta-5-steroid dehydrogenase, 3 beta- and steroid delta-isomerase 1
Synonyms: D3Ertd383e
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 3
NCBI: 15492
Homologene: 69149
Name: potassium voltage-gated channel, subfamily H (eag-related), member 8
Synonyms: Kv12.1, ELK1, C130090D05Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 17
NCBI: 211468
Homologene: 14332
Name: HMG box domain containing 3
Synonyms: 2510002C16Rik, A630042L21Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 18
NCBI: 106894
VEGA: 18
Homologene: 44229
Name: ankyrin repeat and kinase domain containing 1
Synonyms: 9930020N01Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 9
NCBI: 244859
Homologene: 18258
Name: serine/threonine kinase 36
Synonyms: 1700112N14Rik, Fused
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 1
NCBI: 269209
Homologene: 49432
Name: coenzyme Q9
Synonyms: 2310005O14Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 8
NCBI: 67914
Homologene: 6477
Name: membrane protein, palmitoylated 4 (MAGUK p55 subfamily member 4)
Synonyms: DLG6
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 1
NCBI: 227157
Homologene: 23296
Name: BCL2/adenovirus E1B 19kD interacting protein like
Synonyms: BNIPL-2, BNIPL-1, BNIPL2, BNIPL1, PP753, BNIPL, 1700128A13Rik, BNIP-S
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 3
NCBI: 171388
Homologene: 15900
Name: sema domain, transmembrane domain (TM), and cytoplasmic domain, (semaphorin) 6C
Synonyms: Sema Y, Semay
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 3
NCBI: 20360
Homologene: 7931
Name: chemokine (C-X-C motif) receptor 2
Synonyms: CD128, IL-8Rh, IL-8rb, Gpcr16, IL8RA, Cmkar2, Il8rb
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 1
NCBI: 12765
Homologene: 10439
Name: olfactory receptor family 51 subfamily G member 1
Synonyms: GA_x6K02T2PBJ9-5696486-5695545, MOR7-1, Olfr578
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 7
NCBI: 259119
Homologene: 17513
Name: sirtuin 6
Synonyms: 2810449N18Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 10
NCBI: 50721
Homologene: 6924
Name: THUMP domain containing 2
Synonyms: 2810025A12Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 17
NCBI: 72167
VEGA: 17
Homologene: 11898
Name: synaptonemal complex protein 3
Synonyms: Scp3, Cor1
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 10
NCBI: 20962
Homologene: 7964
Name: gastrokine 3
Synonyms: 1190003M12Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 6
NCBI: 68888
Homologene: 87422
Name: RIKEN cDNA 4930480E11 gene
Type: Gene
Species: Mus musculus (mouse)
Chromosome: X
NCBI: 74910
Homologene: 136363
Genetic Alterations
ENU-induced transitions at the following base pair locations (GRCm38):
  • A to T, chromosome 1 at 37,366,594 bp
  • T to C, chromosome 1 at 59,144,694 bp
  • T to C, chromosome 1 at 74,158,971 bp
  • T to A, chromosome 1 at 74,632,825 bp
  • C to A, chromosome 1 at 75,253,170 bp
  • A to G, chromosome 1 at 87,595,060 bp
  • G to T, chromosome 2 at 153,667,630 bp
  • C to A, chromosome 3 at 95,172,818 bp
  • T to A, chromosome 3 at 95,243,049 bp
  • A to T, chromosome 3 at 98,853,307 bp
  • A to T, chromosome 3 at 122,957,574 bp
  • C to T, chromosome 4 at 62,191,777 bp
  • T to C, chromosome 4 at 84,292,915 bp
  • T to C, chromosome 4 at 152,372,115 bp
  • C to T, chromosome 4 at 155,903,459 bp
  • G to C, chromosome 4 at 155,904,931 bp
  • G to T, chromosome 5 at 92,943,086 bp
  • C to T, chromosome 5 at 114,960,047 bp
  • A to G, chromosome 5 at 115,873,978 bp
  • A to G, chromosome 5 at 117,200,069 bp
  • A to T, chromosome 5 at 121,829,048 bp
  • G to A, chromosome 5 at 124,817,670 bp
  • T to G, chromosome 5 at 135,249,846 bp
  • C to T, chromosome 6 at 4,906,558 bp
  • C to T, chromosome 6 at 48,025,660 bp
  • C to T, chromosome 6 at 87,383,525 bp
  • C to T, chromosome 6 at 146,173,341 bp
  • A to T, chromosome 6 at 146,323,169 bp
  • G to A, chromosome 7 at 28,898,266 bp
  • T to A, chromosome 7 at 46,993,352 bp
  • G to T, chromosome 7 at 98,054,424 bp
  • T to C, chromosome 7 at 98,097,206 bp
  • T to A, chromosome 7 at 102,984,877 bp
  • T to C, chromosome 8 at 94,853,124 bp
  • A to G, chromosome 8 at 95,036,946 bp
  • A to G, chromosome 8 at 95,678,386 bp
  • A to G, chromosome 8 at 95,845,796 bp
  • T to C, chromosome 9 at 38,472,975 bp
  • T to A, chromosome 9 at 49,421,822 bp
  • T to C, chromosome 9 at 57,593,968 bp
  • T to C, chromosome 9 at 67,031,040 bp
  • T to A, chromosome 9 at 80,269,611 bp
  • T to C, chromosome 9 at 109,156,336 bp
  • T to C, chromosome 9 at 123,560,601 bp
  • A to G, chromosome 10 at 81,627,458 bp
  • T to G, chromosome 10 at 84,947,897 bp
  • G to A, chromosome 10 at 88,472,682 bp
  • T to C, chromosome 10 at 103,227,250 bp
  • A to T, chromosome 11 at 75,496,034 bp
  • A to G, chromosome 11 at 115,350,530 bp
  • A to T, chromosome 11 at 119,157,828 bp
  • T to C, chromosome 13 at 3,585,122 bp
  • T to C, chromosome 13 at 18,810,428 bp
  • T to C, chromosome 13 at 97,172,961 bp
  • A to G, chromosome 14 at 101,876,914 bp
  • A to G, chromosome 15 at 98,593,488 bp
  • C to T, chromosome 15 at 102,108,934 bp
  • C to T, chromosome 16 at 30,273,786 bp
  • C to A, chromosome 16 at 96,066,100 bp
  • A to T, chromosome 17 at 33,334,300 bp
  • A to G, chromosome 17 at 35,928,892 bp
  • GAGACCAACGAGCAGCTGATGCTTCAGA to GAGA, chromosome 17 at 52,725,906 bp
  • C to T, chromosome 17 at 81,044,128 bp
  • A to G, chromosome 18 at 37,266,463 bp
  • C to T, chromosome 18 at 61,155,296 bp
  • T to A, chromosome 18 at 67,855,270 bp
  • T to C, chromosome 19 at 36,872,590 bp
  • C to G, chromosome 19 at 55,180,999 bp
  • C to T, chromosome X at 78,370,262 bp
  • T to A, chromosome X at 83,781,517 bp
Genotype Determination
G1 male heterozygous mice are viable and fertile. The G1 mice were not characterized prior to archiving.
Strain Development
C57BL/6J mice were injected with ENU, resulting in G0 mice that were bred back to C57BL/6J. Sperm was archived from G1 male mice that produced viable G2 mice.
Suggested Control Mice
Wild-type littermates or C57BL/6J mice
MMRRC Genetic QC Summary
The MMRRC Centers have developed a genetic QC pipeline using MiniMUGA array genotyping to provide additional information on strain backgrounds for MMRRC congenic and inbred strains. For more information on when data may be available, or to request genotyping for a strain of interest, please contact Older strains may not have this information.
Bruce Beutler, M.D., University of Texas Southwestern Medical Center.
Primary Reference
MUTAGENETIX record for R2898 (G1). B. Beutler and colleagues, Center for the Genetics of Host Defense, UT Southwestern, Dallas, TX.

Colony and Husbandry Information

Colony Surveillance Program and Current Health Reports

Mice recovered from a cryo-archive will have health surveillance performed on recipient females. Health reports will be provided prior to shipment. If you require additional health status information, please email .
Coat Color
MMRRC Breeding System
Random intra-strain mating
Breeding Scheme(s)
When maintaining a live colony, heterozygous mice may be bred together, bred with wild-type siblings, or bred with C57BL/6J inbred mice.
Overall Breeding Performance
Undetermined; during development, mating was done with heterozygous males; viability, fertility and other breeding statistics for heterozygous females and homozygotes are unverified, but presumably would be similar to the C57BL/6J background strain
Average litter size
Recommended wean age
3 weeks

Order Request Information

Limited quantities of breeder mice (recovered litter) are available from a cryoarchive; recovered litter usually available to ship in 3 to 4 months.

Cryopreserved material may be available upon request, please inquire to for more information.

Distribution of this strain requires submission of the MMRRC Conditions of Use (COU). A link to the COU web form will be provided via email after an order has been placed; the form should be completed then or the email forwarded to your institutional official for completion.

The donor or their institution limits the distribution to non-profit institutions only.

Additional charges may apply for any special requests. Shipping costs are in addition to the basic distribution/resuscitation fees. Information on shipping costs and any additional charges will be provided by the supplying MMRRC facility.

Click button to Request this one strain. (Use the MMRRC Catalog Search to request more than one strain.)
MMRRC Item # Description Distribution Fee / Unit (US $)
*Shipping & Handling not included*
Units Notes
040486-MU-RESUS Litter recovered from cryo-archive $5,475.00 / Non-Profit Litter Recovered litter4; additional fees for any special requests.
Cryopreserved material may be available upon request, please inquire to for more information.

Some MMRRC strains were submitted by the donor as cryopreserved germplasm, and because these strains were not cryopreserved by the MMRRC, we have not assessed the quality of this material. We have extensive experience with recovery of mice from cryopreserved sperm and embryos of varying quality, including using techniques such as IVF and ICSI, and are confident that we will have success in most, if not all, cases. However, because of the unknown quality of these frozen samples, we will restrict recovery efforts to two attempts for each order. Subsequent attempts can be performed on a fee-for-service basis, in addition to the standard fees, upon request.

1 The distribution fee covers the expense of rederiving mice from a live mouse; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

2 An aliquot contains a sufficient number of embryos (in one or more vials or straws and based on the transfer success rate of the MMRRC facility) to transfer into one to three recipients. The MMRRC makes no guarantee concerning embryo transfer success experienced in the recipient investigator's laboratory. Neither gender nor genotype ratios are guaranteed.

3 An aliquot is one straw or vial with sufficient sperm to recover at least one litter of mice, as per provided protocols, when performed at the MMRRC facility. The MMRRC makes no guarantee concerning the success of these procedures when performed outside the MMRRC facilities.

4 The distribution fee covers the expense of resuscitating mice from the cryo-archive; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

To request material from the MMRRC: Please fill out our on-line request form (accessible from the catalog search results page, or click the Request this Strain button in the fees section). If you have questions or need assistance completing this form, you may call Customer Service at (800) 910-2291 (in USA or Canada) or (530) 757-5710 (international calls). Before you call, please have with you: the MMRRC item number, quantity needed, Bill-to and Ship-to contact information.