Loading Mouse GIF
Loading...

Strain Name:
C57BL/6J-MtgxR2912Btlr/Mmmh
Stock Number:
040499-MU
Citation ID:
RRID:MMRRC_040499-MU
Other Names:
R2912 (G1), C57BL/6J-MtgxR2912Btlr
Major Collection:

Strain Information

Hprt1
Name: hypoxanthine phosphoribosyltransferase 1
Synonyms: Hprt1, Hprt
Type: Gene
Species: Mus musculus (mouse)
Chromosome: X
NCBI: 15452
HGNC: HGNC:5157
Homologene: 56590
Nrg1
Name: neuregulin 1
Synonyms: HGL, HRG, Hgl, SMDF, GGF, ARIA, heregulin, D230005F13Rik, HRGalpha, 6030402G23Rik, GGFII, NDF
Type: Gene
Species: Mouse
Chromosome: 8
NCBI: 211323
HGNC: HGNC:7997
Homologene: 138451
Ptprf
Name: protein tyrosine phosphatase receptor type F
Synonyms: LAR, RPTP-LAR
Type: Gene
Species: Mouse
Chromosome: 4
NCBI: 19268
HGNC: HGNC:9670
Homologene: 20623
Macf1
Name: microtubule-actin crosslinking factor 1
Synonyms: Acf7, Aclp7, trabeculin alpha
Type: Gene
Species: Mouse
Chromosome: 4
NCBI: 11426
Homologene: 136191
Asxl2
Name: ASXL transcriptional regulator 2
Synonyms: 4930556B16Rik
Type: Gene
Species: Mouse
Chromosome: 12
NCBI: 75302
Homologene: 10102
Birc6
Name: baculoviral IAP repeat-containing 6
Synonyms: apollon, Bruce, A430032G04Rik, D630005A10Rik, A430040A19Rik
Type: Gene
Species: Mouse
Chromosome: 17
NCBI: 12211
Homologene: 7248
Mfsd5
Name: major facilitator superfamily domain containing 5
Type: Gene
Species: Mouse
Chromosome: 15
NCBI: 106073
VEGA: 15
Homologene: 69517
Snx29
Name: sorting nexin 29
Synonyms: LOC381035, LOC385605, 4933437K13Rik, Gm11170, Rundc2a
Type: Gene
Species: Mouse
Chromosome: 16
NCBI: 74478
Homologene: 32706
Creb3l1
Name: cAMP responsive element binding protein 3-like 1
Synonyms: BBF-2 (drosophila) homolog, Oasis
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 26427
Homologene: 8058
Nktr
Name: natural killer tumor recognition sequence
Synonyms: D9Wsu172e, 5330401F18Rik
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 18087
HGNC: HGNC:7833
Homologene: 122148
Dync1li1
Name: dynein cytoplasmic 1 light intermediate chain 1
Synonyms: LIC-1, 1110053F02Rik, Dnclic1, Dlic1
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 235661
VEGA: 9
Homologene: 9403
Dhx29
Name: DExH-box helicase 29
Synonyms: E130202M19Rik, DEAH (Asp-Glu-Ala-His) box polypeptide 29
Type: Gene
Species: Mouse
Chromosome: 13
NCBI: 218629
VEGA: 13
Homologene: 10387
Rbm45
Name: RNA binding motif protein 45
Synonyms: Drb1, G430095G15Rik, Drbp1
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 241490
Homologene: 15560
Dnajc27
Name: DnaJ heat shock protein family (Hsp40) member C27
Synonyms: Rabj, C330021A05Rik, Rbj
Type: Gene
Species: Mouse
Chromosome: 12
NCBI: 217378
VEGA: 12
Homologene: 9558
Emc1
Name: ER membrane protein complex subunit 1
Synonyms: C230096C10Rik
Type: Gene
Species: Mouse
Chromosome: 4
NCBI: 230866
Homologene: 9002
Ric3
Name: RIC3 acetylcholine receptor chaperone
Synonyms: E130307J04Rik
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 320360
Homologene: 49772
Med17
Name: mediator complex subunit 17
Synonyms: C330002H14Rik, Trap80, Crsp6
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 234959
VEGA: 9
HGNC: HGNC:2375
Homologene: 3151
Lama2
Name: laminin, alpha 2
Synonyms: merosin, mer
Type: Gene
Species: Mouse
Chromosome: 10
NCBI: 16773
HGNC: HGNC:6482
Homologene: 37306
Zfp750
Name: zinc finger protein 750
Synonyms: A030007D23Rik
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 319530
Homologene: 36423
F5
Name: coagulation factor V
Synonyms: Cf-5, Cf5
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 14067
HGNC: HGNC:3542
Homologene: 104
Col7a1
Name: collagen, type VII, alpha 1
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 12836
HGNC: HGNC:2214
Homologene: 73
Cpne8
Name: copine VIII
Synonyms: 1200003E11Rik, 1500031E20Rik
Type: Gene
Species: Mouse
Chromosome: 15
NCBI: 66871
Homologene: 12049
Bmpr1b
Name: bone morphogenetic protein receptor, type 1B
Synonyms: Alk6, CFK-43a, Acvrlk6, BMPR-IB
Type: Gene
Species: Mouse
Chromosome: 3
NCBI: 12167
HGNC: HGNC:1077
Homologene: 20322
Dbn1
Name: drebrin 1
Synonyms: drebrin E2, drebrin A
Type: Gene
Species: Mouse
Chromosome: 13
NCBI: 56320
HGNC: HGNC:2695
Homologene: 3236
Trank1
Name: tetratricopeptide repeat and ankyrin repeat containing 1
Synonyms: A230061D21Rik, LOC235639, C030048J01Rik, Lba1
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 320429
Homologene: 45845
Wdr64
Name: WD repeat domain 64
Synonyms: 4930415O10Rik, 4930511H01Rik
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 75820
Homologene: 51634
Or8g34
Name: olfactory receptor family 8 subfamily G member 34
Synonyms: GA_x6K02T2PVTD-33158015-33158950, MOR171-42, MOR171-53, Olfr954
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 258328
VEGA: 9
HGNC: HGNC:8484
Homologene: 71961
4921528O07Rik
Name:
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 1
Cd109
Name: CD109 antigen
Synonyms: Gov platelet alloantigens, 9930012E15Rik
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 235505
Homologene: 25183
Rfx6
Name: regulatory factor X, 6
Synonyms: 4930572O07Rik, Rfxdc1
Type: Gene
Species: Mouse
Chromosome: 10
NCBI: 320995
Homologene: 18318
Nup210
Name: nucleoporin 210
Synonyms: gp210, gp190, Pom210
Type: Gene
Species: Mouse
Chromosome: 6
NCBI: 54563
Homologene: 41286
Zfp467
Name: zinc finger protein 467
Synonyms: MNCb-3350, EZI, 1190001I08Rik
Type: Gene
Species: Mouse
Chromosome: 6
NCBI: 68910
Homologene: 10758
Or10ak7
Name: olfactory receptor family 10 subfamily AK member 7
Synonyms: GA_x6K02T2QD9B-18602750-18603691, MOR259-1, MOR259-13, MOR259-1, Olfr1519, Olfr1328
Type: Gene
Species: Mouse
Chromosome: 4
NCBI: 258394
Homologene: 121524
Or5j3
Name: olfactory receptor family 5 subfamily J member 3
Synonyms: GA_x6K02T2Q125-47777498-47778436, MOR172-1, Olfr1052
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 259012
Homologene: 79679
Lax1
Name: lymphocyte transmembrane adaptor 1
Synonyms: E430019B13Rik
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 240754
Homologene: 49504
Or4c11
Name: olfactory receptor family 4 subfamily C member 11
Synonyms: GA_x6K02T2Q125-50339974-50340609, GA_x6K02T2Q125-50338497-50339264, MOR230-3, Olfr1207, Olfr1206
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 258896
Homologene: 81567
Mrgprb5
Name: MAS-related GPR, member B5
Synonyms: MrgB5
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 404239
Homologene: 115575
Zscan4d
Name: zinc finger and SCAN domain containing 4D
Synonyms: EG545913
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 545913
Homologene: 85986
Cyp4v3
Name: cytochrome P450, family 4, subfamily v, polypeptide 3
Type: Gene
Species: Mouse
Chromosome: 8
NCBI: 102294
Homologene: 133054
Vmn1r42
Name: vomeronasal 1 receptor 42
Synonyms: V1ra6
Type: Gene
Species: Mouse
Chromosome: 6
NCBI: 113848
Homologene: 130651
Aloxe3
Name: arachidonate lipoxygenase 3
Synonyms: e-LOX-3
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 23801
Homologene: 8013
Nherf2
Name: NHERF family PDZ scaffold protein 2
Synonyms: Nherf2, Octs2, Tka-1, Sip-1, E3karp, 1200011K07Rik, Sip1, 2010007A20Rik, 0610011L07Rik, Sryip1, Slc9a3r2
Type: Gene
Species: Mouse
Chromosome: 17
NCBI: 65962
VEGA: 17
Homologene: 56962
Gpr157
Name: G protein-coupled receptor 157
Synonyms: F730108M23Rik
Type: Gene
Species: Mouse
Chromosome: 4
NCBI: 269604
Homologene: 18573
Genetic Alterations
ENU-induced transitions at the following base pair locations (GRCm38):
  • A to G, chromosome 1 at 133,684,053 bp
  • T to C, chromosome 1 at 163,044,003 bp
  • A to G, chromosome 1 at 164,193,919 bp
  • A to G, chromosome 1 at 175,764,082 bp
  • C to T, chromosome 2 at 76,375,454 bp
  • A to G, chromosome 2 at 86,298,389 bp
  • A to T, chromosome 2 at 88,865,114 bp
  • T to C, chromosome 2 at 91,987,053 bp
  • A to G, chromosome 2 at 181,081,774 bp
  • T to C, chromosome 3 at 141,880,378 bp
  • A to G, chromosome 4 at 118,248,980 bp
  • A to G, chromosome 4 at 118,934,701 bp
  • T to A, chromosome 4 at 123,475,911 bp
  • T to C, chromosome 4 at 139,365,260 bp
  • T to C, chromosome 4 at 144,392,734 bp
  • G to A, chromosome 4 at 150,098,765 bp
  • C to A, chromosome 6 at 48,439,076 bp
  • T to C, chromosome 6 at 89,844,706 bp
  • T to G, chromosome 6 at 91,026,974 bp
  • G to A, chromosome 7 at 11,162,687 bp
  • T to C, chromosome 7 at 48,168,067 bp
  • A to G, chromosome 7 at 109,054,453 bp
  • A to G, chromosome 8 at 31,818,567 bp
  • A to G, chromosome 8 at 45,317,656 bp
  • A to G, chromosome 9 at 15,275,914 bp
  • T to C, chromosome 9 at 39,462,216 bp
  • CATTTATTTATTTATTTATTTATTTATTTATTTAT to CATTTATTTATTTATTTATTTATTTATTTATTTATTTAT, chromosome 9 at 78,712,500 bp
  • C to A, chromosome 9 at 108,965,796 bp
  • T to C, chromosome 9 at 111,392,483 bp
  • T to G, chromosome 9 at 114,715,675 bp
  • T to C, chromosome 9 at 121,749,604 bp
  • T to C, chromosome 10 at 27,000,803 bp
  • A to G, chromosome 10 at 51,718,130 bp
  • A to T, chromosome 11 at 69,130,040 bp
  • C to A, chromosome 11 at 121,512,327 bp
  • A to G, chromosome 12 at 3,474,517 bp
  • C to T, chromosome 12 at 4,096,280 bp
  • A to G, chromosome 13 at 55,482,421 bp
  • A to G, chromosome 13 at 112,935,575 bp
  • A to G, chromosome 15 at 89,069,821 bp
  • A to T, chromosome 15 at 90,615,099 bp
  • A to G, chromosome 15 at 102,281,308 bp
  • C to T, chromosome 16 at 11,447,453 bp
  • C to T, chromosome 17 at 24,642,241 bp
  • A to G, chromosome 17 at 74,692,206 bp
  • T to C, chromosome X at 53,020,139 bp
Genotype Determination
Phenotype
G1 male heterozygous mice are viable and fertile. The G1 mice were not characterized prior to archiving.
Strain GQC Summary
The MMRRC Centers have developed a Strain GQC pipeline using MiniMUGA array genotyping to provide additional information on strain backgrounds for MMRRC strains. For more information on whether data may be available, or to request genotyping for a strain of interest, please contact MMRRC_GeneticQC@med.unc.edu. Older strains may not have this information available.
Suggested Control Mice
Littermates of all relevant genotypes.
Donor
Bruce Beutler, M.D., University of Texas Southwestern Medical Center.
Primary Reference
MUTAGENETIX record for R2912 (G1). B. Beutler and colleagues, Center for the Genetics of Host Defense, UT Southwestern, Dallas, TX.
Strain Development
C57BL/6J mice were injected with ENU, resulting in G0 mice that were bred back to C57BL/6J. Sperm was archived from G1 male mice that produced viable G2 mice.


Disclaimer: If MMRRC Strain Genetic Quality Control (GQC; based on MiniMUGA genotyping and analysis) has been completed for this strain, the information might differ from the genetic background information provided by the submitter. MiniMUGA genetic analysis is done on a strain’s tissue samples taken when archived by or ordered from the assigned MMRRC Center.

Colony and Husbandry Information

Colony Surveillance Program and Current Health Reports

Mice recovered from a cryo-archive will have health surveillance performed on recipient females. Health reports will be provided prior to shipment. If you require additional health status information, please email mmrrc@missouri.edu.
Coat Color
Black
MMRRC Breeding System
Random intra-strain mating
Breeding Scheme(s)
When maintaining a live colony, heterozygous mice may be bred together, bred with wild-type siblings, or bred with C57BL/6J inbred mice.
Overall Breeding Performance
Undetermined; during development, mating was done with heterozygous males; viability, fertility and other breeding statistics for heterozygous females and homozygotes are unverified, but presumably would be similar to the C57BL/6J background strain
Average litter size
Undetermined
Recommended wean age
3 weeks

Order Request Information

Limited quantities of breeder mice (recovered litter) are available from a cryoarchive; recovered litter usually available to ship in 3 to 4 months.

Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

Distribution of this strain requires submission of the MMRRC Conditions of Use (COU). A link to the COU web form will be provided via email after an order has been placed; the form should be completed then or the email forwarded to your institutional official for completion.

The donor or their institution limits the distribution to non-profit institutions only.

Additional charges may apply for any special requests. Shipping costs are in addition to the basic distribution/resuscitation fees. Information on shipping costs and any additional charges will be provided by the supplying MMRRC facility.

Click button to Request this one strain. (Use the MMRRC Catalog Search to request more than one strain.)
MMRRC Item # Description Distribution Fee / Unit (US $)
*Shipping & Handling not included*
Units Notes
040499-MU-RESUS Litter recovered from cryo-archive $5,475.00 / Non-Profit Litter Recovered litter4; additional fees for any special requests.
Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

Some MMRRC strains were submitted by the donor as cryopreserved germplasm, and because these strains were not cryopreserved by the MMRRC, we have not assessed the quality, nor genotype, of this material. Our expertise in reviving mice from various qualities of frozen sperm and embryos, using methods like IVF and ICSI, gives us confidence in successful recoveries in most cases. However, due to the uncertain quality of these samples, we'll limit revival attempts to two per order. Additional attempts are available for a fee, on top of standard charges, if requested. It's important to note that some strains may lack the expected mutation, so we can't assure successful order fulfillment until we attempt to revive the strain.

1 The distribution fee covers the expense of rederiving mice from a live mouse; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

2 An aliquot contains a sufficient number of embryos (in one or more vials or straws and based on the transfer success rate of the MMRRC facility) to transfer into one to three recipients. The MMRRC makes no guarantee concerning embryo transfer success experienced in the recipient investigator's laboratory. Neither gender nor genotype ratios are guaranteed.

3 An aliquot is one straw or vial with sufficient sperm to recover at least one litter of mice, as per provided protocols, when performed at the MMRRC facility. The MMRRC makes no guarantee concerning the success of these procedures when performed outside the MMRRC facilities.

4 The distribution fee covers the expense of resuscitating mice from the cryo-archive; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

To request material from the MMRRC: Please fill out our on-line request form (accessible from the catalog search results page, or click the Request this Strain button in the fees section). If you have questions or need assistance completing this form, you may call Customer Service at (800) 910-2291 (in USA or Canada) or (530) 757-5710 (international calls). Before you call, please have with you: the MMRRC item number, quantity needed, Bill-to and Ship-to contact information.