Strain Name:
C57BL/6J-MtgxR3024Btlr/Mmmh
Stock Number:
040540-MU
Citation ID:
RRID:MMRRC_040540-MU
Other Names:
R3024 (G1), C57BL/6J-MtgxR3024Btlr
Major Collection:

Strain Information

Lyst
Name: lysosomal trafficking regulator
Synonyms: D13Sfk13
Type: Gene
Species: Mouse
Chromosome: 13
NCBI: 17101
VEGA: 13
HGNC: HGNC:1968
Homologene: 61
Phf20
Name: PHD finger protein 20
Synonyms: 6820402O20Rik
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 228829
Homologene: 9507
Birc6
Name: baculoviral IAP repeat-containing 6
Synonyms: D630005A10Rik, apollon, A430032G04Rik, A430040A19Rik, Bruce
Type: Gene
Species: Mouse
Chromosome: 17
NCBI: 12211
Homologene: 7248
Pes1
Name: pescadillo ribosomal biogenesis factor 1
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 64934
HGNC: HGNC:8848
Homologene: 5984
Slc35f5
Name: solute carrier family 35, member F5
Synonyms: 1300003P13Rik
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 74150
Homologene: 5745
Zfpm2
Name: zinc finger protein, multitype 2
Synonyms: FOG2, B330005D23Rik, FOG-2
Type: Gene
Species: Mouse
Chromosome: 15
NCBI: 22762
VEGA: 15
Homologene: 8008
Ksr2
Name: kinase suppressor of ras 2
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 333050
Homologene: 45469
Itpr2
Name: inositol 1,4,5-triphosphate receptor 2
Synonyms: Ip3r2, Itpr5
Type: Gene
Species: Mouse
Chromosome: 6
NCBI: 16439
HGNC: HGNC:6181
Homologene: 37593
Xylt1
Name: xylosyltransferase 1
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 233781
Homologene: 32534
Krt6a
Name: keratin 6A
Synonyms: mK6[a], Krt2-6c, Krt2-6a, MK6a
Type: Gene
Species: Mouse
Chromosome: 15
NCBI: 16687
VEGA: 15
Homologene: 136794
Pappa2
Name: pappalysin 2
Synonyms: pregnancy-associated plasma protein-E, pregnancy-associated plasma preproprotein-A2, placenta-specific 3, PLAC3, PAPP-A2, Pappe
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 23850
Homologene: 10661
Bfsp1
Name: beaded filament structural protein 1, in lens-CP94
Synonyms: filensin
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 12075
HGNC: HGNC:1040
Homologene: 922
Kcnh7
Name: potassium voltage-gated channel, subfamily H (eag-related), member 7
Synonyms: Kv11.3, erg3, 9330137I11Rik
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 170738
Homologene: 13249
Prex1
Name: phosphatidylinositol-3,4,5-trisphosphate-dependent Rac exchange factor 1
Synonyms: P-REX1
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 277360
Homologene: 10821
Tsnaxip1
Name: translin-associated factor X (Tsnax) interacting protein 1
Synonyms: TXI1, 1700016K08Rik
Type: Gene
Species: Mouse
Chromosome: 8
NCBI: 72236
Homologene: 10194
Trim41
Name: tripartite motif-containing 41
Synonyms: RINCK
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 211007
Homologene: 14140
Chil6
Name: chitinase-like 6
Synonyms: BC051070, BYm
Type: Gene
Species: Mouse
Chromosome: 3
NCBI: 229688
Homologene: 77638
Sstr3
Name: somatostatin receptor 3
Synonyms: Smstr3, Smstr-3, sst3
Type: Gene
Species: Mouse
Chromosome: 15
NCBI: 20607
VEGA: 15
Homologene: 20285
Slc25a54
Name: solute carrier family 25, member 54
Synonyms: SCaMC-1like, 4930443G12Rik
Type: Gene
Species: Mouse
Chromosome: 3
NCBI: 74686
Homologene: 82464
Arhgef37
Name: Rho guanine nucleotide exchange factor 37
Synonyms: 4933429F08Rik
Type: Gene
Species: Mouse
Chromosome: 18
NCBI: 328967
VEGA: 18
Homologene: 28467
Or12d13
Name: olfactory receptor family 12 subfamily D member 13
Synonyms: GA_x6K02T2PSCP-1798423-1797482, MOR250-3, MOR250-8_p, Olfr103
Type: Gene
Species: Mouse
Chromosome: 17
NCBI: 258830
Homologene: 115555
Or4c127
Name: olfactory receptor family 4 subfamily C member 127
Synonyms: GA_x6K02T2Q125-51434523-51435437, MOR234-1, Olfr1262
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 258976
Homologene: 74064
Vmn1r238
Name: vomeronasal 1 receptor, 238
Type: Gene
Species: Mouse
Chromosome: 18
NCBI: 100312476
Homologene: 128342
Genetic Alterations
ENU-induced transitions at the following base pair locations (GRCm38):
  • A to G, chromosome 1 at 125,568,598 bp
  • C to T, chromosome 1 at 158,936,225 bp
  • G to T, chromosome 2 at 62,764,663 bp
  • A to T, chromosome 2 at 90,003,240 bp
  • A to T, chromosome 2 at 143,845,959 bp
  • A to G, chromosome 2 at 156,287,867 bp
  • G to T, chromosome 2 at 166,589,036 bp
  • T to C, chromosome 3 at 106,388,770 bp
  • T to A, chromosome 3 at 109,080,666 bp
  • T to A, chromosome 5 at 117,555,060 bp
  • G to A, chromosome 6 at 146,180,310 bp
  • T to A, chromosome 7 at 117,548,648 bp
  • A to G, chromosome 8 at 105,841,743 bp
  • CGGAGGAGGAGGAGGAGGAGGAGG to CGGAGGAGGAGGAGGAGGAGG, chromosome 11 at 3,977,719 bp
  • T to C, chromosome 11 at 48,808,158 bp
  • T to C, chromosome 13 at 13,658,687 bp
  • G to A, chromosome 15 at 41,102,959 bp
  • G to A, chromosome 15 at 78,539,987 bp
  • A to T, chromosome 15 at 101,691,289 bp
  • A to T, chromosome 17 at 37,337,027 bp
  • T to C, chromosome 17 at 74,608,219 bp
  • T to C, chromosome 18 at 3,123,305 bp
  • T to C, chromosome 18 at 61,501,888 bp
Genotype Determination
Phenotype
G1 male heterozygous mice are viable and fertile. The G1 mice were not characterized prior to archiving.
Strain Development
C57BL/6J mice were injected with ENU, resulting in G0 mice that were bred back to C57BL/6J. Sperm was archived from G1 male mice that produced viable G2 mice.
Suggested Control Mice
Wild-type littermates or C57BL/6J mice
MMRRC Genetic QC Summary
The MMRRC Centers have developed a genetic QC pipeline using MiniMUGA array genotyping to provide additional information on strain backgrounds for MMRRC congenic and inbred strains. For more information on when data may be available, or to request genotyping for a strain of interest, please contact mmrrc@missouri.edu. Older strains may not have this information.
Donor
Bruce Beutler, M.D., University of Texas Southwestern Medical Center.
Primary Reference
MUTAGENETIX record for R3024 (G1). B. Beutler and colleagues, Center for the Genetics of Host Defense, UT Southwestern, Dallas, TX.

Colony and Husbandry Information

Colony Surveillance Program and Current Health Reports

Mice recovered from a cryo-archive will have health surveillance performed on recipient females. Health reports will be provided prior to shipment. If you require additional health status information, please email mmrrc@missouri.edu.
Coat Color
Black
MMRRC Breeding System
Random intra-strain mating
Breeding Scheme(s)
When maintaining a live colony, heterozygous mice may be bred together, bred with wild-type siblings, or bred with C57BL/6J inbred mice.
Overall Breeding Performance
Undetermined; during development, mating was done with heterozygous males; viability, fertility and other breeding statistics for heterozygous females and homozygotes are unverified, but presumably would be similar to the C57BL/6J background strain
Average litter size
Undetermined
Recommended wean age
3 weeks

Order Request Information

Limited quantities of breeder mice (recovered litter) are available from a cryoarchive; recovered litter usually available to ship in 3 to 4 months.

Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

Distribution of this strain requires submission of the MMRRC Conditions of Use (COU). A link to the COU web form will be provided via email after an order has been placed; the form should be completed then or the email forwarded to your institutional official for completion.

The donor or their institution limits the distribution to non-profit institutions only.

Additional charges may apply for any special requests. Shipping costs are in addition to the basic distribution/resuscitation fees. Information on shipping costs and any additional charges will be provided by the supplying MMRRC facility.

Click button to Request this one strain. (Use the MMRRC Catalog Search to request more than one strain.)
MMRRC Item # Description Distribution Fee / Unit (US $)
*Shipping & Handling not included*
Units Notes
040540-MU-RESUS Litter recovered from cryo-archive $5,475.00 / Non-Profit Litter Recovered litter4; additional fees for any special requests.
Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

Some MMRRC strains were submitted by the donor as cryopreserved germplasm, and because these strains were not cryopreserved by the MMRRC, we have not assessed the quality, nor genotype, of this material. Our expertise in reviving mice from various qualities of frozen sperm and embryos, using methods like IVF and ICSI, gives us confidence in successful recoveries in most cases. However, due to the uncertain quality of these samples, we'll limit revival attempts to two per order. Additional attempts are available for a fee, on top of standard charges, if requested. It's important to note that some strains may lack the expected mutation, so we can't assure successful order fulfillment until we attempt to revive the strain.

1 The distribution fee covers the expense of rederiving mice from a live mouse; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

2 An aliquot contains a sufficient number of embryos (in one or more vials or straws and based on the transfer success rate of the MMRRC facility) to transfer into one to three recipients. The MMRRC makes no guarantee concerning embryo transfer success experienced in the recipient investigator's laboratory. Neither gender nor genotype ratios are guaranteed.

3 An aliquot is one straw or vial with sufficient sperm to recover at least one litter of mice, as per provided protocols, when performed at the MMRRC facility. The MMRRC makes no guarantee concerning the success of these procedures when performed outside the MMRRC facilities.

4 The distribution fee covers the expense of resuscitating mice from the cryo-archive; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

To request material from the MMRRC: Please fill out our on-line request form (accessible from the catalog search results page, or click the Request this Strain button in the fees section). If you have questions or need assistance completing this form, you may call Customer Service at (800) 910-2291 (in USA or Canada) or (530) 757-5710 (international calls). Before you call, please have with you: the MMRRC item number, quantity needed, Bill-to and Ship-to contact information.