Strain Name:
C57BL/6J-MtgxR3031Btlr/Mmmh
Stock Number:
040547-MU
Citation ID:
RRID:MMRRC_040547-MU
Other Names:
R3031 (G1), C57BL/6J-MtgxR3031Btlr
Major Collection:

Gene Information

Cacna1h
Name: calcium channel, voltage-dependent, T type, alpha 1H subunit
Synonyms: Cav3.2, alpha13.2, T-type Cav3.2
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 17
NCBI: 58226
HGNC: HGNC:1395
Homologene: 56913
Upf1
Name: UPF1 regulator of nonsense transcripts homolog (yeast)
Synonyms: PNORF-1, B430202H16Rik, Rent1
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 8
NCBI: 19704
HGNC: HGNC:9962
Homologene: 2185
Rfesd
Name: Rieske (Fe-S) domain containing
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 13
NCBI: 218341
VEGA: 13
Homologene: 18282
Cltc
Name: clathrin, heavy polypeptide (Hc)
Synonyms: CHC
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 11
NCBI: 67300
HGNC: HGNC:2092
Homologene: 3572
Vps13c
Name: vacuolar protein sorting 13C
Synonyms: C230055H22Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 9
NCBI: 320528
VEGA: 9
Homologene: 41188
Ltn1
Name: listerin E3 ubiquitin protein ligase 1
Synonyms: 4930528H02Rik, Zfp294, Listerin, Rnf160
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 16
NCBI: 78913
VEGA: 16
Homologene: 32272
Suds3
Name: suppressor of defective silencing 3 homolog (S. cerevisiae)
Synonyms: 2400003N08Rik, 2410008L21Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 5
NCBI: 71954
Homologene: 15906
Wdr48
Name: WD repeat domain 48
Synonyms: 8430408H12Rik, Uaf1
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 9
NCBI: 67561
VEGA: 9
Homologene: 10830
Ap3b1
Name: adaptor-related protein complex 3, beta 1 subunit
Synonyms: rim2, Hps2, recombination induced mutation 2, beta3A, AP-3
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 13
NCBI: 11774
VEGA: 13
HGNC: HGNC:566
Homologene: 68125
Traf3ip1
Name: TRAF3 interacting protein 1
Synonyms: 3930402D05Rik, MIP-T3
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 1
NCBI: 74019
Homologene: 22913
Slc9a8
Name: solute carrier family 9 (sodium/hydrogen exchanger), member 8
Synonyms: NHE8, 1200006P13Rik, 6430709P13Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 2
NCBI: 77031
Homologene: 75041
Abcc5
Name: ATP-binding cassette, sub-family C (CFTR/MRP), member 5
Synonyms: Mrp5, Abcc5b, Abcc5a, 2900011L11Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 16
NCBI: 27416
HGNC: HGNC:56
Homologene: 21164
Cbln4
Name: cerebellin 4 precursor protein
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 2
NCBI: 228942
Homologene: 15419
Cdc37
Name: cell division cycle 37
Synonyms: p50Cdc37
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 9
NCBI: 12539
VEGA: 9
HGNC: HGNC:1735
Homologene: 38268
Ubxn7
Name: UBX domain protein 7
Synonyms: Ubxd7
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 16
NCBI: 224111
VEGA: 16
Homologene: 45585
Hydin
Name: HYDIN, axonemal central pair apparatus protein
Synonyms: hy-3, hy3, 1700034M11Rik, 4930545D19Rik, hyrh
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 8
NCBI: 244653
Homologene: 52118
Sorcs1
Name: sortilin-related VPS10 domain containing receptor 1
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 19
NCBI: 58178
Homologene: 10967
Slc35e1
Name: solute carrier family 35, member E1
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 8
NCBI: 270066
Homologene: 49075
A2m
Name: alpha-2-macroglobulin
Synonyms: A2mp
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 6
NCBI: 232345
HGNC: HGNC:7
Homologene: 37248
Gjd4
Name: gap junction protein, delta 4
Synonyms: connexin 39, Cx39, 9430022F06Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 18
NCBI: 225152
VEGA: 18
Homologene: 17692
Lipe
Name: lipase, hormone sensitive
Synonyms: HSL, 4933403G17Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 7
NCBI: 16890
HGNC: HGNC:6621
Homologene: 3912
Dsg1a
Name: desmoglein 1 alpha
Synonyms: Dsg1
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 18
NCBI: 13510
HGNC: HGNC:3048
Homologene: 1463
Ccdc170
Name: coiled-coil domain containing 170
Synonyms: LOC237250, Gm221
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 10
NCBI: 100504234
Homologene: 69393
Mael
Name: maelstrom spermatogenic transposon silencer
Synonyms: 4933405K18Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 1
NCBI: 98558
Homologene: 13143
Kcnh8
Name: potassium voltage-gated channel, subfamily H (eag-related), member 8
Synonyms: Kv12.1, ELK1, C130090D05Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 17
NCBI: 211468
Homologene: 14332
Zfp58
Name: zinc finger protein 58
Synonyms: Mfg-1, Mfg1, A530094I17Rik, Zfp817
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 13
NCBI: 238693
Sult3a1
Name: sulfotransferase family 3A, member 1
Synonyms: Sultx2
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 10
NCBI: 57430
VEGA: 10
Homologene: 111031
Zfp663
Name: zinc finger protein 663
Synonyms: LOC381405, Gm1008
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 2
NCBI: 381405
Homologene: 128277
CAAA01083517.1
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 1
Gkn3
Name: gastrokine 3
Synonyms: 1190003M12Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 6
NCBI: 68888
Homologene: 87422
Genetic Alterations
ENU-induced transitions at the following base pair locations (GRCm38):
  • T to C, chromosome 1 at 91,520,100 bp
  • T to C, chromosome 1 at 166,204,806 bp
  • C to T, chromosome 1 at 183,351,121 bp
  • A to T, chromosome 2 at 165,353,696 bp
  • A to G, chromosome 2 at 167,451,281 bp
  • A to G, chromosome 2 at 172,042,180 bp
  • T to A, chromosome 5 at 117,109,755 bp
  • C to T, chromosome 6 at 87,383,525 bp
  • A to T, chromosome 6 at 121,678,567 bp
  • T to C, chromosome 7 at 25,384,895 bp
  • C to T, chromosome 8 at 70,338,460 bp
  • A to G, chromosome 8 at 72,484,891 bp
  • A to G, chromosome 8 at 110,603,216 bp
  • T to C, chromosome 9 at 21,143,191 bp
  • T to C, chromosome 9 at 67,923,770 bp
  • T to C, chromosome 9 at 119,924,110 bp
  • T to C, chromosome 10 at 4,518,931 bp
  • G to A, chromosome 10 at 33,877,349 bp
  • T to C, chromosome 11 at 86,730,332 bp
  • A to G, chromosome 13 at 67,492,112 bp
  • A to G, chromosome 13 at 76,007,979 bp
  • T to C, chromosome 13 at 94,565,643 bp
  • C to A, chromosome 16 at 20,375,113 bp
  • T to A, chromosome 16 at 32,375,307 bp
  • T to A, chromosome 16 at 87,380,873 bp
  • C to A, chromosome 17 at 25,433,134 bp
  • GAGACCAACGAGCAGCTGATGCTTCAGA to GAGA, chromosome 17 at 52,725,906 bp
  • G to T, chromosome 18 at 9,280,811 bp
  • A to T, chromosome 18 at 20,340,492 bp
  • G to A, chromosome 19 at 50,225,175 bp
Genotype Determination
Phenotype
G1 male heterozygous mice are viable and fertile. The G1 mice were not characterized prior to archiving.
Strain Development
C57BL/6J mice were injected with ENU, resulting in G0 mice that were bred back to C57BL/6J. Sperm was archived from G1 male mice that produced viable G2 mice.
Suggested Control Mice
Wild-type littermates or C57BL/6J mice
Donor
Bruce Beutler, M.D., University of Texas Southwestern Medical Center.
Primary Reference
MUTAGENETIX record for R3031 (G1). B. Beutler and colleagues, Center for the Genetics of Host Defense, UT Southwestern, Dallas, TX.

Colony and Husbandry Information

Colony Surveillance Program and Current Health Reports

Mice recovered from a cryo-archive will have health surveillance performed on recipient females. Health reports will be provided prior to shipment. If you require additional health status information, please email mmrrc@missouri.edu .
Coat Color
Black
MMRRC Breeding System
Random intra-strain mating
Breeding Scheme(s)
When maintaining a live colony, heterozygous mice may be bred together, bred with wild-type siblings, or bred with C57BL/6J inbred mice.
Overall Breeding Performance
Undetermined; during development, mating was done with heterozygous males; viability, fertility and other breeding statistics for heterozygous females and homozygotes are unverified, but presumably would be similar to the C57BL/6J background strain
Average litter size
Undetermined
Recommended wean age
3 weeks

Order Request Information

Limited quantities of breeder mice (recovered litter) are available from a cryoarchive; recovered litter usually available to ship in 3 to 4 months.

Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

Distribution of this strain requires submission of the MMRRC Conditions of Use (COU). A link to the COU web form will be provided via email after an order has been placed; the form should be completed then or the email forwarded to your institutional official for completion.

The donor or their institution limits the distribution to non-profit institutions only.

Additional charges may apply for any special requests. Shipping costs are in addition to the basic distribution/resuscitation fees. Information on shipping costs and any additional charges will be provided by the supplying MMRRC facility.

Click button to Request this one strain. (Use the MMRRC Catalog Search to request more than one strain.)
MMRRC Item # Description Distribution Fee / Unit (US $) Units Notes
040547-MU-RESUS Litter recovered from cryo-archive $5,475.00 / Non-Profit Litter Recovered litter4; additional fees for any special requests.
Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

Some MMRRC strains were submitted by the donor as cryopreserved germplasm, and because these strains were not cryopreserved by the MMRRC, we have not assessed the quality of this material. We have extensive experience with recovery of mice from cryopreserved sperm and embryos of varying quality, including using techniques such as IVF and ICSI, and are confident that we will have success in most, if not all, cases. However, because of the unknown quality of these frozen samples, we will restrict recovery efforts to two attempts for each order. Subsequent attempts can be performed on a fee-for-service basis, in addition to the standard fees, upon request.

1 The distribution fee covers the expense of rederiving mice from a live mouse; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

2 An aliquot contains a sufficient number of embryos (in one or more vials or straws and based on the transfer success rate of the MMRRC facility) to transfer into one to three recipients. The MMRRC makes no guarantee concerning embryo transfer success experienced in the recipient investigator's laboratory. Neither gender nor genotype ratios are guaranteed.

3 An aliquot is one straw or vial with sufficient sperm to recover at least one litter of mice, as per provided protocols, when performed at the MMRRC facility. The MMRRC makes no guarantee concerning the success of these procedures when performed outside the MMRRC facilities.

4 The distribution fee covers the expense of resuscitating mice from the cryo-archive; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

To request material from the MMRRC: Please fill out our on-line request form (accessible from the catalog search results page, or click the Request this Strain button in the fees section). If you have questions or need assistance completing this form, you may call Customer Service at (800) 910-2291 (in USA or Canada) or (530) 757-5710 (international calls). Before you call, please have with you: the MMRRC item number, quantity needed, Bill-to and Ship-to contact information.