Strain Name:
C57BL/6J-MtgxR3150Btlr/Mmmh
Stock Number:
040602-MU
Citation ID:
RRID:MMRRC_040602-MU
Other Names:
R3150 (G1), C57BL/6J-MtgxR3150Btlr
Major Collection:

Strain Information

Pkd1
Name: polycystin 1, transient receptor potential channel interacting
Synonyms: PC-1, PC1, polycystin-1
Type: Gene
Species: Mouse
Chromosome: 17
NCBI: 18763
VEGA: 17
HGNC: HGNC:9008
Homologene: 250
Shprh
Name: SNF2 histone linker PHD RING helicase
Synonyms: D230017O13Rik, 2610103K11Rik
Type: Gene
Species: Mouse
Chromosome: 10
NCBI: 268281
Homologene: 6489
Ppp2r2a
Name: protein phosphatase 2, regulatory subunit B, alpha
Synonyms: 2410004D02Rik
Type: Gene
Species: Mouse
Chromosome: 14
NCBI: 71978
VEGA: 14
HGNC: HGNC:9304
Homologene: 2035
Nmral1
Name: NmrA-like family domain containing 1
Synonyms: 1110025F24Rik
Type: Gene
Species: Mouse
Chromosome: 16
NCBI: 67824
Homologene: 41388
Spats1
Name: spermatogenesis associated, serine-rich 1
Synonyms: Srsp1, 1700011H05Rik, 4933400B06Rik
Type: Gene
Species: Mouse
Chromosome: 17
NCBI: 71020
VEGA: 17
Homologene: 12376
Srgap2
Name: SLIT-ROBO Rho GTPase activating protein 2
Synonyms: 9930124L22Rik, FBP2, Fnbp2
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 14270
Homologene: 52683
Rtn4
Name: reticulon 4
Synonyms: NOGO, C130026I10Rik, NgA, 1110020G17Rik, Nogo-A, Nogo-B
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 68585
Homologene: 10743
Cabin1
Name: calcineurin binding protein 1
Synonyms: A330070M20Rik, Cain, Ppp3in
Type: Gene
Species: Mouse
Chromosome: 10
NCBI: 104248
VEGA: 10
Homologene: 49307
Gpatch2l
Name: G patch domain containing 2 like
Synonyms: 1700020O03Rik
Type: Gene
Species: Mouse
Chromosome: 12
NCBI: 70373
VEGA: 12
Homologene: 9942
Usp22
Name: ubiquitin specific peptidase 22
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 216825
Homologene: 52664
Ddb1
Name: damage specific DNA binding protein 1
Synonyms: p127-Ddb1, DNA repair protein, damage-specific DNA-binding protein, DNA repair
Type: Gene
Species: Mouse
Chromosome: 19
NCBI: 13194
VEGA: 19
HGNC: HGNC:2717
Homologene: 1448
Git2
Name: GIT ArfGAP 2
Synonyms: 5830420E16Rik, B230104M05Rik, Cool associated tyrosine phosphorylated-2, Cat-2, ARF GTPase activating protein 2, 1500036H07Rik, 9630056M03Rik
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 26431
HGNC: HGNC:4273
Homologene: 41336
Map3k20
Name: mitogen-activated protein kinase kinase kinase 20
Synonyms: Zak, MLTKbeta, B230120H23Rik, MLTKalpha
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 65964
Homologene: 32331
Wdr62
Name: WD repeat domain 62
Synonyms: 2310038K02Rik
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 233064
Homologene: 15927
Zswim7
Name: zinc finger SWIM-type containing 7
Synonyms: 2410012H22Rik, SWS1
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 69747
Homologene: 15565
Xpo5
Name: exportin 5
Synonyms: 2410004H11Rik, 2700038C24Rik, Exp5
Type: Gene
Species: Mouse
Chromosome: 17
NCBI: 72322
VEGA: 17
Homologene: 69316
Robo1
Name: roundabout guidance receptor 1
Synonyms: DUTT1
Type: Gene
Species: Mouse
Chromosome: 16
NCBI: 19876
Homologene: 2206
Vps13d
Name: vacuolar protein sorting 13D
Type: Gene
Species: Mouse
Chromosome: 4
NCBI: 230895
Homologene: 15583
Hnrnph1
Name: heterogeneous nuclear ribonucleoprotein H1
Synonyms: Hnrph1, E430005G16Rik
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 59013
HGNC: HGNC:5041
Homologene: 31318
Cyp4f18
Name: cytochrome P450, family 4, subfamily f, polypeptide 18
Synonyms: 1810054N16Rik
Type: Gene
Species: Mouse
Chromosome: 8
NCBI: 72054
Homologene: 128623
Col4a3
Name: collagen, type IV, alpha 3
Synonyms: tumstatin, alpha3(IV)
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 12828
HGNC: HGNC:2204
Homologene: 68033
Mapk11
Name: mitogen-activated protein kinase 11
Synonyms: Sapk2, P38b, Prkm11, p38beta
Type: Gene
Species: Mouse
Chromosome: 15
NCBI: 19094
VEGA: 15
HGNC: HGNC:6873
Homologene: 55684
Cspg4b
Name: chondroitin sulfate proteoglycan 4B
Synonyms: BC067074
Type: Gene
Species: Mouse
Chromosome: 13
NCBI: 408066
Prdm1
Name: PR domain containing 1, with ZNF domain
Synonyms: Blimp1, Blimp-1, PRDI-BF1, b2b1765Clo
Type: Gene
Species: Mouse
Chromosome: 10
NCBI: 12142
HGNC: HGNC:9346
Homologene: 925
Fcgbpl1
Name: Fc fragment of IgG binding protein like 1
Synonyms: 9530053A07Rik
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 319482
Homologene: 130055
Sycp1
Name: synaptonemal complex protein 1
Synonyms: SCP1
Type: Gene
Species: Mouse
Chromosome: 3
NCBI: 20957
Homologene: 2389
Akna
Name: AT-hook transcription factor
Type: Gene
Species: Mouse
Chromosome: 4
NCBI: 100182
Homologene: 49947
Or7e169
Name: olfactory receptor family 7 subfamily E member 169
Synonyms: MOR146-2, GA_x6K02T2PVTD-13586614-13585661, Olfr860
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 258521
Homologene: 134093
Csf2ra
Name: colony stimulating factor 2 receptor, alpha, low-affinity (granulocyte-macrophage)
Synonyms: CD116, GM-CSFRalpha, Csfgmra, GM-CSF-Ra
Type: Gene
Species: Mouse
Chromosome: 19
NCBI: 12982
VEGA: 19
HGNC: HGNC:2435
Homologene: 48406
Itgad
Name: integrin, alpha D
Synonyms: Cd11d
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 381924
HGNC: HGNC:6146
Homologene: 56919
Tie1
Name: tyrosine kinase with immunoglobulin-like and EGF-like domains 1
Synonyms: TIE, D430008P04Rik, tie-1
Type: Gene
Species: Mouse
Chromosome: 4
NCBI: 21846
Homologene: 3957
Padi6
Name: peptidyl arginine deiminase, type VI
Synonyms: Padi5, ePAD, Pad6
Type: Gene
Species: Mouse
Chromosome: 4
NCBI: 242726
Homologene: 17695
Ccdc178
Name: coiled coil domain containing 178
Synonyms: 4921528I01Rik
Type: Gene
Species: Mouse
Chromosome: 18
NCBI: 70950
VEGA: 18
Homologene: 12373
Mrc2
Name: mannose receptor, C type 2
Synonyms: uPARAP, novel lectin, Endo180
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 17534
Homologene: 4408
Sry
Name: sex determining region of Chr Y
Synonyms: Tdf, Tdy
Type: Gene
Species: Mouse
Chromosome: Y
NCBI: 21674
Ces1g
Name: carboxylesterase 1G
Synonyms: Ses-1, Ces-1, Ces1
Type: Gene
Species: Mouse
Chromosome: 8
NCBI: 12623
HGNC: HGNC:1863
Homologene: 137354
Or5b119
Name: olfactory receptor family 5 subfamily B member 119
Synonyms: Olfr1475, MOR202-36, GA_x6K02T2RE5P-3812807-3811863
Type: Gene
Species: Mouse
Chromosome: 19
NCBI: 258298
Homologene: 77370
Gm2128
Name: predicted gene 2128
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 7
NCBI: 100039269
Homologene: 45597
Zswim9
Name: zinc finger SWIM-type containing 9
Synonyms: 6330408A02Rik
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 321008
Homologene: 52386
Hao2
Name: hydroxyacid oxidase 2
Synonyms: Hao3
Type: Gene
Species: Mouse
Chromosome: 3
NCBI: 56185
HGNC: HGNC:4810
Homologene: 97412
Gm5592
Name: predicted gene 5592
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 434172
Homologene: 45597
Adprh
Name: ADP-ribosylarginine hydrolase
Synonyms: Arh1
Type: Gene
Species: Mouse
Chromosome: 16
NCBI: 11544
VEGA: 16
HGNC: HGNC:269
Homologene: 874
Or4c1
Name: olfactory receptor family 4 subfamily C member 1
Synonyms: Olfr1231, GA_x6K02T2Q125-50748233-50747292, MOR235-2
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 258446
Homologene: 27168
Vmn2r32
Name: vomeronasal 2, receptor 32
Synonyms: V2r5
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 22311
Homologene: 113703
Gzmk
Name: granzyme K
Type: Gene
Species: Mouse
Chromosome: 13
NCBI: 14945
HGNC: HGNC:4711
Homologene: 20485
Gfod2
Name: glucose-fructose oxidoreductase domain containing 2
Synonyms: 5730466C23Rik
Type: Gene
Species: Mouse
Chromosome: 8
NCBI: 70575
Homologene: 10361
Genetic Alterations
ENU-induced transitions at the following base pair locations (GRCm38):
  • T to G, chromosome 1 at 82,657,137 bp
  • T to C, chromosome 1 at 131,292,589 bp
  • C to T, chromosome 2 at 72,371,992 bp
  • C to T, chromosome 2 at 89,303,218 bp
  • T to C, chromosome 3 at 98,880,328 bp
  • G to A, chromosome 3 at 102,898,841 bp
  • A to T, chromosome 4 at 63,395,353 bp
  • G to A, chromosome 4 at 118,475,825 bp
  • A to G, chromosome 4 at 140,735,389 bp
  • A to C, chromosome 4 at 145,086,790 bp
  • A to G, chromosome 5 at 114,730,349 bp
  • T to C, chromosome 7 at 7,472,555 bp
  • T to C, chromosome 7 at 13,277,270 bp
  • C to A, chromosome 7 at 28,154,195 bp
  • A to T, chromosome 7 at 30,271,670 bp
  • A to G, chromosome 7 at 41,158,148 bp
  • A to G, chromosome 7 at 41,288,380 bp
  • C to A, chromosome 7 at 128,190,981 bp
  • T to C, chromosome 8 at 71,993,200 bp
  • C to T, chromosome 8 at 93,325,816 bp
  • C to T, chromosome 8 at 105,717,221 bp
  • A to G, chromosome 9 at 19,846,214 bp
  • A to G, chromosome 10 at 11,170,030 bp
  • A to T, chromosome 10 at 44,458,492 bp
  • A to G, chromosome 10 at 75,656,911 bp
  • CGAGGAGGAGGAGGAGGA to CGAGGAGGAGGAGGA, chromosome 11 at 29,693,308 bp
  • T to A, chromosome 11 at 50,385,792 bp
  • T to C, chromosome 11 at 61,160,581 bp
  • A to T, chromosome 11 at 62,273,785 bp
  • G to A, chromosome 11 at 105,348,431 bp
  • A to G, chromosome 12 at 86,244,315 bp
  • T to A, chromosome 13 at 113,173,920 bp
  • A to T, chromosome 13 at 113,351,760 bp
  • G to A, chromosome 14 at 67,023,765 bp
  • T to C, chromosome 15 at 89,145,450 bp
  • G to A, chromosome 16 at 4,716,469 bp
  • G to T, chromosome 16 at 38,446,107 bp
  • C to T, chromosome 16 at 72,970,269 bp
  • G to T, chromosome 17 at 24,579,791 bp
  • A to T, chromosome 17 at 45,464,554 bp
  • A to G, chromosome 17 at 46,242,247 bp
  • G to T, chromosome 18 at 22,067,652 bp
  • T to A, chromosome 19 at 10,612,982 bp
  • A to G, chromosome 19 at 13,479,460 bp
  • C to A, chromosome 19 at 61,227,320 bp
  • ACTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTG to ACTGCTGCTGCTGCTGCTGCTGCTGCTGCTG, chromosome Y at 2,662,944 bp
Genotype Determination
Phenotype
G1 male heterozygous mice are viable and fertile. The G1 mice were not characterized prior to archiving.
Strain Development
C57BL/6J mice were injected with ENU, resulting in G0 mice that were bred back to C57BL/6J. Sperm was archived from G1 male mice that produced viable G2 mice.
Suggested Control Mice
Wild-type littermates or C57BL/6J mice
MMRRC Genetic QC Summary
The MMRRC Centers have developed a genetic QC pipeline using MiniMUGA array genotyping to provide additional information on strain backgrounds for MMRRC congenic and inbred strains. For more information on when data may be available, or to request genotyping for a strain of interest, please contact mmrrc@missouri.edu. Older strains may not have this information.
Donor
Bruce Beutler, M.D., University of Texas Southwestern Medical Center.
Primary Reference
MUTAGENETIX record for R3150 (G1). B. Beutler and colleagues, Center for the Genetics of Host Defense, UT Southwestern, Dallas, TX.

Colony and Husbandry Information

Colony Surveillance Program and Current Health Reports

Mice recovered from a cryo-archive will have health surveillance performed on recipient females. Health reports will be provided prior to shipment. If you require additional health status information, please email mmrrc@missouri.edu.
Coat Color
Black
MMRRC Breeding System
Random intra-strain mating
Breeding Scheme(s)
When maintaining a live colony, heterozygous mice may be bred together, bred with wild-type siblings, or bred with C57BL/6J inbred mice.
Overall Breeding Performance
Undetermined; during development, mating was done with heterozygous males; viability, fertility and other breeding statistics for heterozygous females and homozygotes are unverified, but presumably would be similar to the C57BL/6J background strain
Average litter size
Undetermined
Recommended wean age
3 weeks

Order Request Information

Limited quantities of breeder mice (recovered litter) are available from a cryoarchive; recovered litter usually available to ship in 3 to 4 months.

Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

Distribution of this strain requires submission of the MMRRC Conditions of Use (COU). A link to the COU web form will be provided via email after an order has been placed; the form should be completed then or the email forwarded to your institutional official for completion.

The donor or their institution limits the distribution to non-profit institutions only.

Additional charges may apply for any special requests. Shipping costs are in addition to the basic distribution/resuscitation fees. Information on shipping costs and any additional charges will be provided by the supplying MMRRC facility.

Click button to Request this one strain. (Use the MMRRC Catalog Search to request more than one strain.)
MMRRC Item # Description Distribution Fee / Unit (US $)
*Shipping & Handling not included*
Units Notes
040602-MU-RESUS Litter recovered from cryo-archive $5,475.00 / Non-Profit Litter Recovered litter4; additional fees for any special requests.
Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

Some MMRRC strains were submitted by the donor as cryopreserved germplasm, and because these strains were not cryopreserved by the MMRRC, we have not assessed the quality, nor genotype, of this material. Our expertise in reviving mice from various qualities of frozen sperm and embryos, using methods like IVF and ICSI, gives us confidence in successful recoveries in most cases. However, due to the uncertain quality of these samples, we'll limit revival attempts to two per order. Additional attempts are available for a fee, on top of standard charges, if requested. It's important to note that some strains may lack the expected mutation, so we can't assure successful order fulfillment until we attempt to revive the strain.

1 The distribution fee covers the expense of rederiving mice from a live mouse; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

2 An aliquot contains a sufficient number of embryos (in one or more vials or straws and based on the transfer success rate of the MMRRC facility) to transfer into one to three recipients. The MMRRC makes no guarantee concerning embryo transfer success experienced in the recipient investigator's laboratory. Neither gender nor genotype ratios are guaranteed.

3 An aliquot is one straw or vial with sufficient sperm to recover at least one litter of mice, as per provided protocols, when performed at the MMRRC facility. The MMRRC makes no guarantee concerning the success of these procedures when performed outside the MMRRC facilities.

4 The distribution fee covers the expense of resuscitating mice from the cryo-archive; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

To request material from the MMRRC: Please fill out our on-line request form (accessible from the catalog search results page, or click the Request this Strain button in the fees section). If you have questions or need assistance completing this form, you may call Customer Service at (800) 910-2291 (in USA or Canada) or (530) 757-5710 (international calls). Before you call, please have with you: the MMRRC item number, quantity needed, Bill-to and Ship-to contact information.