Loading Mouse GIF
Loading...

Strain Name:
C57BL/6J-MtgxR3156Btlr/Mmmh
Stock Number:
040607-MU
Citation ID:
RRID:MMRRC_040607-MU
Other Names:
R3156 (G1), C57BL/6J-MtgxR3156Btlr
Major Collection:

Strain Information

Sez6
Name: seizure related gene 6
Synonyms: sez-6, D11Bhm177e
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 20370
Homologene: 10948
Secisbp2
Name: SECIS binding protein 2
Synonyms: 2210413N07Rik, SBP2, 2810012K13Rik
Type: Gene
Species: Mouse
Chromosome: 13
NCBI: 75420
Homologene: 11415
Cnot7
Name: CCR4-NOT transcription complex, subunit 7
Synonyms: Caf1
Type: Gene
Species: Mouse
Chromosome: 8
NCBI: 18983
Homologene: 49011
Mycbp2
Name: MYC binding protein 2, E3 ubiquitin protein ligase
Synonyms: Pam, C130061D10Rik, Phr1
Type: Gene
Species: Mouse
Chromosome: 14
NCBI: 105689
Homologene: 9005
Cdca2
Name: cell division cycle associated 2
Synonyms: 2610311M19Rik
Type: Gene
Species: Mouse
Chromosome: 14
NCBI: 108912
Homologene: 18444
Patj
Name: PATJ, crumbs cell polarity complex component
Synonyms: Cipp, Inadl
Type: Gene
Species: Mouse
Chromosome: 4
NCBI: 12695
Homologene: 72199
Tex2
Name: testis expressed gene 2
Synonyms: Taz4, Def-5, 4930568E07Rik
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 21763
Homologene: 32414
Cbl
Name: Casitas B-lineage lymphoma
Synonyms: Cbl-2, c-Cbl, 4732447J05Rik
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 12402
HGNC: HGNC:1541
Homologene: 3802
Rif1
Name: replication timing regulatory factor 1
Synonyms: 5730435J01Rik, 6530403D07Rik, D2Ertd145e
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 51869
Homologene: 41231
Tonsl
Name: tonsoku-like, DNA repair protein
Synonyms: 2810439M11Rik, Nfkbil2
Type: Gene
Species: Mouse
Chromosome: 15
NCBI: 72749
HGNC: HGNC:7801
Homologene: 22754
Dmxl2
Name: Dmx-like 2
Synonyms: E130119P06Rik, 6430411K14Rik
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 235380
HGNC: HGNC:2938
Homologene: 41022
Neo1
Name: neogenin
Synonyms: D930014N22Rik, 2610028H22Rik, Igdcc2
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 18007
VEGA: 9
HGNC: HGNC:7754
Homologene: 1870
Triml2
Name: tripartite motif family-like 2
Synonyms: EG622117
Type: Gene
Species: Mouse
Chromosome: 8
NCBI: 622117
Homologene: 18316
Gcnt2
Name: glucosaminyl (N-acetyl) transferase 2 (I blood group)
Synonyms: IGnTC, IGnTB, IGnTA, 5330430K10Rik, IGnT
Type: Gene
Species: Mouse
Chromosome: 13
NCBI: 14538
VEGA: 13
HGNC: HGNC:4204
Homologene: 41535
Paxbp1
Name: PAX3 and PAX7 binding protein 1
Synonyms: 1810007M14Rik, Pax3/7bp, Gcfc1
Type: Gene
Species: Mouse
Chromosome: 16
NCBI: 67367
Homologene: 9604
Atad1
Name: ATPase family, AAA domain containing 1
Synonyms: 4921525H23Rik, Thorase
Type: Gene
Species: Mouse
Chromosome: 19
NCBI: 67979
VEGA: 19
Homologene: 5960
Yeats4
Name: YEATS domain containing 4
Synonyms: NuBI-1, 4930573H17Rik, GAS41, B230215M10Rik
Type: Gene
Species: Mouse
Chromosome: 10
NCBI: 64050
VEGA: 10
Homologene: 4760
Szt2
Name: SZT2 subunit of KICSTOR complex
Synonyms: seaizure threshold 2
Type: Gene
Species: Mouse
Chromosome: 4
NCBI: 230676
Homologene: 49413
Rbp3
Name: retinol binding protein 3, interstitial
Synonyms: Irbp, Rbp-3
Type: Gene
Species: Mouse
Chromosome: 14
NCBI: 19661
VEGA: 14
HGNC: HGNC:9921
Homologene: 9261
Hps6
Name: HPS6, biogenesis of lysosomal organelles complex 2 subunit 3
Synonyms: 5330434M19Rik, ruby eye, ru, BLOC-2, Hermansky-Pudlak syndrome 6
Type: Gene
Species: Mouse
Chromosome: 19
NCBI: 20170
VEGA: 19
Homologene: 11691
Anxa9
Name: annexin A9
Synonyms: 2310069F17Rik
Type: Gene
Species: Mouse
Chromosome: 3
NCBI: 71790
HGNC: HGNC:547
Homologene: 2643
Trpc1
Name: transient receptor potential cation channel, subfamily C, member 1
Synonyms: Trrp1, Trp1, Mtrp1
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 22063
Homologene: 2478
Myh6
Name: myosin, heavy polypeptide 6, cardiac muscle, alpha
Synonyms: alpha myosin, Myhc-a, alpha cardiac MHC, cardiomyopathy, hypertrophic 1, Myhca, A830009F23Rik, alpha-MHC, alphaMHC
Type: Gene
Species: Mouse
Chromosome: 14
NCBI: 17888
HGNC: HGNC:7576
Homologene: 124414
Dnah5
Name: dynein, axonemal, heavy chain 5
Synonyms: Mdnah5, b2b1154Clo, b2b1134Clo, b2b1537Clo, b2b1565Clo, Dnahc5, b2b3491Clo
Type: Gene
Species: Mouse
Chromosome: 15
NCBI: 110082
HGNC: HGNC:2950
Homologene: 1048
Mylk3
Name: myosin light chain kinase 3
Synonyms: D830007F02Rik
Type: Gene
Species: Mouse
Chromosome: 8
NCBI: 213435
Homologene: 35278
Mab21l4
Name: mab-21-like 4
Synonyms: 2310007B03Rik
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 71874
Homologene: 11761
Dis3l
Name: DIS3 like exosome 3'-5' exoribonuclease
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 213550
Homologene: 15797
Ror2
Name: receptor tyrosine kinase-like orphan receptor 2
Synonyms: Ntrkr2
Type: Gene
Species: Mouse
Chromosome: 13
NCBI: 26564
Homologene: 55831
Adra2b
Name: adrenergic receptor, alpha 2b
Synonyms: [a]2B, alpha2B, Adra-2b, a2b-AR
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 11552
HGNC: HGNC:282
Homologene: 553
Col4a2
Name: collagen, type IV, alpha 2
Synonyms: Col4a-2
Type: Gene
Species: Mouse
Chromosome: 8
NCBI: 12827
HGNC: HGNC:2203
Homologene: 1390
Cfap45
Name: cilia and flagella associated protein 45
Synonyms: 1700028D05Rik, Nesg1, Ccdc19
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 71870
Homologene: 71837
Slc5a9
Name: solute carrier family 5 (sodium/glucose cotransporter), member 9
Synonyms: SGLT4
Type: Gene
Species: Mouse
Chromosome: 4
NCBI: 230612
Homologene: 17081
Rusc1
Name: RUN and SH3 domain containing 1
Synonyms: 2210403N08Rik
Type: Gene
Species: Mouse
Chromosome: 3
NCBI: 72296
Homologene: 75028
Or7g27
Name: olfactory receptor family 7 subfamily G member 27
Synonyms: GA_x6K02T2PVTD-13076685-13077623, MOR150-1P, MOR150-2, MOR150-1, MOR150-1P, Olfr1522-ps1, Olfr845
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 258249
HGNC: HGNC:8466
Homologene: 133689
Fut2
Name: fucosyltransferase 2
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 14344
HGNC: HGNC:4013
Homologene: 10325
Or4k15c
Name: olfactory receptor family 4 subfamily K member 15C
Synonyms: GA_x6K02T2PMLR-5775299-5774334, MOR246-4, Olfr726
Type: Gene
Species: Mouse
Chromosome: 14
NCBI: 258313
Homologene: 44957
Setbp1
Name: SET binding protein 1
Synonyms: Seb
Type: Gene
Species: Mouse
Chromosome: 18
NCBI: 240427
Homologene: 9192
Glrp1
Name: glutamine repeat protein 1
Synonyms: GRP-1
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 14659
Hmgcs1
Name: 3-hydroxy-3-methylglutaryl-Coenzyme A synthase 1
Synonyms: B130032C06Rik
Type: Gene
Species: Mouse
Chromosome: 13
NCBI: 208715
VEGA: 13
HGNC: HGNC:5007
Homologene: 1609
Genetic Alterations
ENU-induced transitions at the following base pair locations (GRCm38):
  • T to C, chromosome 1 at 85,931,383 bp
  • C to A, chromosome 1 at 88,503,254 bp
  • T to A, chromosome 1 at 93,160,042 bp
  • A to T, chromosome 1 at 172,545,724 bp
  • GCCACCA to GCCA, chromosome 2 at 52,110,324 bp
  • T to C, chromosome 2 at 127,363,650 bp
  • T to C, chromosome 3 at 89,091,731 bp
  • A to T, chromosome 3 at 95,302,405 bp
  • A to G, chromosome 4 at 98,674,228 bp
  • A to T, chromosome 4 at 111,890,224 bp
  • A to G, chromosome 4 at 118,402,819 bp
  • T to C, chromosome 7 at 41,573,655 bp
  • A to T, chromosome 7 at 45,650,667 bp
  • T to A, chromosome 8 at 11,313,414 bp
  • CTTATTTATTTATTTATTTATTTATTTATTTATTTATTTATTTATTTATTTATTTATTTATTTATTTATTTATTTATTT to CTTATTTATTTATTTATTTATTTATTTATTTATTTATTTATTTATTTATTTATTTATTTATTTATTTATTTATTTATTTATTT, chromosome 8 at 40,500,668 bp
  • A to G, chromosome 8 at 43,187,679 bp
  • A to G, chromosome 8 at 85,380,846 bp
  • A to G, chromosome 9 at 19,339,424 bp
  • T to C, chromosome 9 at 44,158,850 bp
  • A to G, chromosome 9 at 54,374,742 bp
  • T to C, chromosome 9 at 58,888,979 bp
  • T to C, chromosome 9 at 64,311,750 bp
  • C to T, chromosome 9 at 95,721,132 bp
  • C to T, chromosome 10 at 117,222,281 bp
  • T to A, chromosome 11 at 77,953,779 bp
  • A to G, chromosome 11 at 106,533,869 bp
  • T to C, chromosome 13 at 40,861,178 bp
  • A to G, chromosome 13 at 51,662,675 bp
  • G to T, chromosome 13 at 53,117,364 bp
  • C to T, chromosome 13 at 119,705,078 bp
  • A to T, chromosome 14 at 33,957,114 bp
  • T to C, chromosome 14 at 50,084,525 bp
  • A to G, chromosome 14 at 54,944,668 bp
  • T to C, chromosome 14 at 67,698,163 bp
  • A to T, chromosome 14 at 103,208,743 bp
  • G to A, chromosome 15 at 28,438,091 bp
  • A to T, chromosome 15 at 76,639,521 bp
  • T to C, chromosome 16 at 91,035,990 bp
  • A to G, chromosome 18 at 78,859,303 bp
  • A to T, chromosome 19 at 32,706,955 bp
  • A to G, chromosome 19 at 46,003,741 bp
Genotype Determination
Phenotype
G1 male heterozygous mice are viable and fertile. The G1 mice were not characterized prior to archiving.
Strain Development
C57BL/6J mice were injected with ENU, resulting in G0 mice that were bred back to C57BL/6J. Sperm was archived from G1 male mice that produced viable G2 mice.
Suggested Control Mice
Wild-type littermates or C57BL/6J mice
MMRRC Genetic QC Summary
The MMRRC Centers have developed a genetic QC pipeline using MiniMUGA array genotyping to provide additional information on strain backgrounds for MMRRC congenic and inbred strains. For more information on when data may be available, or to request genotyping for a strain of interest, please contact mmrrc@missouri.edu. Older strains may not have this information.
Donor
Bruce Beutler, M.D., University of Texas Southwestern Medical Center.
Primary Reference
MUTAGENETIX record for R3156 (G1). B. Beutler and colleagues, Center for the Genetics of Host Defense, UT Southwestern, Dallas, TX.

Colony and Husbandry Information

Colony Surveillance Program and Current Health Reports

Mice recovered from a cryo-archive will have health surveillance performed on recipient females. Health reports will be provided prior to shipment. If you require additional health status information, please email mmrrc@missouri.edu.
Coat Color
Black
MMRRC Breeding System
Random intra-strain mating
Breeding Scheme(s)
When maintaining a live colony, heterozygous mice may be bred together, bred with wild-type siblings, or bred with C57BL/6J inbred mice.
Overall Breeding Performance
Undetermined; during development, mating was done with heterozygous males; viability, fertility and other breeding statistics for heterozygous females and homozygotes are unverified, but presumably would be similar to the C57BL/6J background strain
Average litter size
Undetermined
Recommended wean age
3 weeks

Order Request Information

Limited quantities of breeder mice (recovered litter) are available from a cryoarchive; recovered litter usually available to ship in 3 to 4 months.

Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

Distribution of this strain requires submission of the MMRRC Conditions of Use (COU). A link to the COU web form will be provided via email after an order has been placed; the form should be completed then or the email forwarded to your institutional official for completion.

The donor or their institution limits the distribution to non-profit institutions only.

Additional charges may apply for any special requests. Shipping costs are in addition to the basic distribution/resuscitation fees. Information on shipping costs and any additional charges will be provided by the supplying MMRRC facility.

Click button to Request this one strain. (Use the MMRRC Catalog Search to request more than one strain.)
MMRRC Item # Description Distribution Fee / Unit (US $)
*Shipping & Handling not included*
Units Notes
040607-MU-RESUS Litter recovered from cryo-archive $5,475.00 / Non-Profit Litter Recovered litter4; additional fees for any special requests.
Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

Some MMRRC strains were submitted by the donor as cryopreserved germplasm, and because these strains were not cryopreserved by the MMRRC, we have not assessed the quality, nor genotype, of this material. Our expertise in reviving mice from various qualities of frozen sperm and embryos, using methods like IVF and ICSI, gives us confidence in successful recoveries in most cases. However, due to the uncertain quality of these samples, we'll limit revival attempts to two per order. Additional attempts are available for a fee, on top of standard charges, if requested. It's important to note that some strains may lack the expected mutation, so we can't assure successful order fulfillment until we attempt to revive the strain.

1 The distribution fee covers the expense of rederiving mice from a live mouse; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

2 An aliquot contains a sufficient number of embryos (in one or more vials or straws and based on the transfer success rate of the MMRRC facility) to transfer into one to three recipients. The MMRRC makes no guarantee concerning embryo transfer success experienced in the recipient investigator's laboratory. Neither gender nor genotype ratios are guaranteed.

3 An aliquot is one straw or vial with sufficient sperm to recover at least one litter of mice, as per provided protocols, when performed at the MMRRC facility. The MMRRC makes no guarantee concerning the success of these procedures when performed outside the MMRRC facilities.

4 The distribution fee covers the expense of resuscitating mice from the cryo-archive; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

To request material from the MMRRC: Please fill out our on-line request form (accessible from the catalog search results page, or click the Request this Strain button in the fees section). If you have questions or need assistance completing this form, you may call Customer Service at (800) 910-2291 (in USA or Canada) or (530) 757-5710 (international calls). Before you call, please have with you: the MMRRC item number, quantity needed, Bill-to and Ship-to contact information.