Loading Mouse GIF
Loading...

Strain Name:
C57BL/6J-MtgxR3158Btlr/Mmmh
Stock Number:
040609-MU
Citation ID:
RRID:MMRRC_040609-MU
Other Names:
R3158 (G1), C57BL/6J-MtgxR3158Btlr
Major Collection:

Strain Information

Eya1
Name: EYA transcriptional coactivator and phosphatase 1
Synonyms: bor
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 14048
HGNC: HGNC:3519
Homologene: 74943
Lrp5
Name: low density lipoprotein receptor-related protein 5
Synonyms: LRP7, LR3
Type: Gene
Species: Mouse
Chromosome: 19
NCBI: 16973
Homologene: 1746
Diaph3
Name: diaphanous related formin 3
Synonyms: p134MDia2, mDia2, 4930417P13Rik, Drf3, Diap3
Type: Gene
Species: Mouse
Chromosome: 14
NCBI: 56419
VEGA: 14
Homologene: 84829
Stk3
Name: serine/threonine kinase 3
Synonyms: mess1, 0610042I06Rik, Mst2, MST, Ste20
Type: Gene
Species: Mouse
Chromosome: 15
NCBI: 56274
Homologene: 48420
Smu1
Name: smu-1 suppressor of mec-8 and unc-52 homolog (C. elegans)
Synonyms: 2600001O03Rik, SMU-1, 2610203K23Rik
Type: Gene
Species: Mouse
Chromosome: 4
NCBI: 74255
Homologene: 10079
Clca4b
Name: chloride channel accessory 4B
Synonyms: AI747448
Type: Gene
Species: Mouse
Chromosome: 3
NCBI: 99709
HGNC: HGNC:2018
Homologene: 40808
Cep95
Name: centrosomal protein 95
Synonyms: F630025I20Rik, 4732496G21Rik, Ccdc45
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 320162
Homologene: 16297
Galnt12
Name: polypeptide N-acetylgalactosaminyltransferase 12
Synonyms: A630062B03Rik
Type: Gene
Species: Mouse
Chromosome: 4
NCBI: 230145
Homologene: 11637
Myo7a
Name: myosin VIIA
Synonyms: Myo7, USH1B, nmf371, polka, Hdb
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 17921
HGNC: HGNC:7606
Homologene: 219
Itga11
Name: integrin alpha 11
Synonyms: 4732459H24Rik
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 319480
HGNC: HGNC:6136
Homologene: 8151
Dmpk
Name: dystrophia myotonica-protein kinase
Synonyms: DM, Dm15
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 13400
HGNC: HGNC:2933
Homologene: 3247
Myo1g
Name: myosin IG
Synonyms: E430002D17Rik
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 246177
Homologene: 27996
Gm872
Name: predicted gene 872
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 10
Fat4
Name: FAT atypical cadherin 4
Synonyms: 6030410K14Rik
Type: Gene
Species: Mouse
Chromosome: 3
NCBI: 329628
Homologene: 14377
AC225448.1
Name:
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 17
Prss52
Name: serine protease 52
Synonyms: 1700049K14Rik
Type: Gene
Species: Mouse
Chromosome: 14
NCBI: 73382
Homologene: 105740
Dll3
Name: delta like canonical Notch ligand 3
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 13389
HGNC: HGNC:2909
Homologene: 7291
Krt6a
Name: keratin 6A
Synonyms: mK6[a], MK6a, Krt2-6c, Krt2-6a
Type: Gene
Species: Mouse
Chromosome: 15
NCBI: 16687
VEGA: 15
Homologene: 136794
Hsd3b5
Name: hydroxy-delta-5-steroid dehydrogenase, 3 beta- and steroid delta-isomerase 5
Synonyms: 3(beta)HSDV
Type: Gene
Species: Mouse
Chromosome: 3
NCBI: 15496
Homologene: 104115
Aoc2
Name: amine oxidase copper containing 2
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 237940
HGNC: HGNC:549
Homologene: 56457
Gm7853
Name: predicted gene 7853
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 14
NCBI: 665933
Cd300e
Name: CD300E molecule
Synonyms: Clm2, Trem5, Cd300le
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 217306
Homologene: 18145
Or5b101
Name: olfactory receptor family 5 subfamily B member 101
Synonyms: GA_x6K02T2RE5P-3357666-3356743, MOR202-6, Olfr1453
Type: Gene
Species: Mouse
Chromosome: 19
NCBI: 258695
HGNC: HGNC:8324
Homologene: 120159
Mtus2
Name: microtubule associated tumor suppressor candidate 2
Synonyms: 5730592G18Rik, A730013O20Rik, C130038G02Rik
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 77521
Homologene: 78141
Or8h8
Name: olfactory receptor family 8 subfamily H member 8
Synonyms: GA_x6K02T2Q125-48410458-48409511, MOR206-1, Olfr1098
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 258842
Homologene: 37005
Vmn2r37
Name: vomeronasal 2, receptor 37
Synonyms: V2r14
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 22305
Homologene: 113703
Or11h4
Name: olfactory receptor family 11 subfamily H member 4
Synonyms: GA_x6K02T2PMLR-6484046-6483105, MOR106-1, Olfr749
Type: Gene
Species: Mouse
Chromosome: 14
NCBI: 56858
Homologene: 10652
Kcnh8
Name: potassium voltage-gated channel, subfamily H (eag-related), member 8
Synonyms: Kv12.1, ELK1, C130090D05Rik
Type: Gene
Species: Mouse
Chromosome: 17
NCBI: 211468
Homologene: 14332
Mmp11
Name: matrix metallopeptidase 11
Synonyms: stromelysin 3, ST3, Stmy3
Type: Gene
Species: Mouse
Chromosome: 10
NCBI: 17385
HGNC: HGNC:7157
Homologene: 38116
Med14
Name: mediator complex subunit 14
Synonyms: ORF1, LOC270579, 9930001L01Rik, Trap170, Crsp2, ENSMUSG00000073278
Type: Gene
Species: Mus musculus (mouse)
Chromosome: X
NCBI: 26896
HGNC: HGNC:2370
Homologene: 22082
Tle6
Name: transducin-like enhancer of split 6
Synonyms: Grg6, 1810057E06Rik
Type: Gene
Species: Mouse
Chromosome: 10
NCBI: 114606
Homologene: 11701
E330034G19Rik
Name: RIKEN cDNA E330034G19 gene
Synonyms: ZPAC
Type: Gene
Species: Mouse
Chromosome: 14
NCBI: 105418
Sectm1a
Name: secreted and transmembrane 1A
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 209588
Homologene: 134112
Ccr4
Name: C-C motif chemokine receptor 4
Synonyms: CC CKR-4, Cmkbr4
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 12773
VEGA: 9
HGNC: HGNC:1605
Homologene: 21135
Sbk2
Name: SH3-binding domain kinase family, member 2
Synonyms: LOC381836
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 381836
Homologene: 30927
Genetic Alterations
ENU-induced transitions at the following base pair locations (GRCm38):
  • G to A, chromosome 1 at 14,304,467 bp
  • C to T, chromosome 2 at 86,922,606 bp
  • A to G, chromosome 3 at 38,890,791 bp
  • G to A, chromosome 3 at 98,622,059 bp
  • C to A, chromosome 3 at 144,912,117 bp
  • T to A, chromosome 4 at 40,754,529 bp
  • A to G, chromosome 4 at 47,104,264 bp
  • A to G, chromosome 5 at 148,231,827 bp
  • G to A, chromosome 7 at 4,957,527 bp
  • C to T, chromosome 7 at 9,217,714 bp
  • A to G, chromosome 7 at 19,093,019 bp
  • A to T, chromosome 7 at 28,294,095 bp
  • A to G, chromosome 7 at 98,052,292 bp
  • A to G, chromosome 9 at 62,769,278 bp
  • G to T, chromosome 9 at 114,492,282 bp
  • C to T, chromosome 10 at 75,927,114 bp
  • T to C, chromosome 10 at 81,595,204 bp
  • T to C, chromosome 10 at 92,999,056 bp
  • G to T, chromosome 11 at 6,514,527 bp
  • A to T, chromosome 11 at 101,329,276 bp
  • A to G, chromosome 11 at 106,809,187 bp
  • A to C, chromosome 11 at 115,062,023 bp
  • A to G, chromosome 11 at 121,068,777 bp
  • A to T, chromosome 14 at 24,296,897 bp
  • A to G, chromosome 14 at 36,089,401 bp
  • A to G, chromosome 14 at 50,736,814 bp
  • G to T, chromosome 14 at 64,113,543 bp
  • A to T, chromosome 14 at 86,656,456 bp
  • A to G, chromosome 15 at 35,008,241 bp
  • T to C, chromosome 15 at 101,691,366 bp
  • GAGACCAACGAGCAGCTGATGCTTCAGA to GAGA, chromosome 17 at 52,725,906 bp
  • T to A, chromosome 17 at 94,877,293 bp
  • A to G, chromosome 19 at 3,615,849 bp
  • G to C, chromosome 19 at 13,028,047 bp
  • G to A, chromosome X at 12,684,091 bp
Genotype Determination
Phenotype
G1 male heterozygous mice are viable and fertile. The G1 mice were not characterized prior to archiving.
Strain Development
C57BL/6J mice were injected with ENU, resulting in G0 mice that were bred back to C57BL/6J. Sperm was archived from G1 male mice that produced viable G2 mice.
Suggested Control Mice
Wild-type littermates or C57BL/6J mice
MMRRC Genetic QC Summary
The MMRRC Centers have developed a genetic QC pipeline using MiniMUGA array genotyping to provide additional information on strain backgrounds for MMRRC congenic and inbred strains. For more information on when data may be available, or to request genotyping for a strain of interest, please contact mmrrc@missouri.edu. Older strains may not have this information.
Donor
Bruce Beutler, M.D., University of Texas Southwestern Medical Center.
Primary Reference
MUTAGENETIX record for R3158 (G1). B. Beutler and colleagues, Center for the Genetics of Host Defense, UT Southwestern, Dallas, TX.

Colony and Husbandry Information

Colony Surveillance Program and Current Health Reports

Mice recovered from a cryo-archive will have health surveillance performed on recipient females. Health reports will be provided prior to shipment. If you require additional health status information, please email mmrrc@missouri.edu.
Coat Color
Black
MMRRC Breeding System
Random intra-strain mating
Breeding Scheme(s)
When maintaining a live colony, heterozygous mice may be bred together, bred with wild-type siblings, or bred with C57BL/6J inbred mice.
Overall Breeding Performance
Undetermined; during development, mating was done with heterozygous males; viability, fertility and other breeding statistics for heterozygous females and homozygotes are unverified, but presumably would be similar to the C57BL/6J background strain
Average litter size
Undetermined
Recommended wean age
3 weeks

Order Request Information

Limited quantities of breeder mice (recovered litter) are available from a cryoarchive; recovered litter usually available to ship in 3 to 4 months.

Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

Distribution of this strain requires submission of the MMRRC Conditions of Use (COU). A link to the COU web form will be provided via email after an order has been placed; the form should be completed then or the email forwarded to your institutional official for completion.

The donor or their institution limits the distribution to non-profit institutions only.

Additional charges may apply for any special requests. Shipping costs are in addition to the basic distribution/resuscitation fees. Information on shipping costs and any additional charges will be provided by the supplying MMRRC facility.

Click button to Request this one strain. (Use the MMRRC Catalog Search to request more than one strain.)
MMRRC Item # Description Distribution Fee / Unit (US $)
*Shipping & Handling not included*
Units Notes
040609-MU-RESUS Litter recovered from cryo-archive $5,475.00 / Non-Profit Litter Recovered litter4; additional fees for any special requests.
Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

Some MMRRC strains were submitted by the donor as cryopreserved germplasm, and because these strains were not cryopreserved by the MMRRC, we have not assessed the quality, nor genotype, of this material. Our expertise in reviving mice from various qualities of frozen sperm and embryos, using methods like IVF and ICSI, gives us confidence in successful recoveries in most cases. However, due to the uncertain quality of these samples, we'll limit revival attempts to two per order. Additional attempts are available for a fee, on top of standard charges, if requested. It's important to note that some strains may lack the expected mutation, so we can't assure successful order fulfillment until we attempt to revive the strain.

1 The distribution fee covers the expense of rederiving mice from a live mouse; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

2 An aliquot contains a sufficient number of embryos (in one or more vials or straws and based on the transfer success rate of the MMRRC facility) to transfer into one to three recipients. The MMRRC makes no guarantee concerning embryo transfer success experienced in the recipient investigator's laboratory. Neither gender nor genotype ratios are guaranteed.

3 An aliquot is one straw or vial with sufficient sperm to recover at least one litter of mice, as per provided protocols, when performed at the MMRRC facility. The MMRRC makes no guarantee concerning the success of these procedures when performed outside the MMRRC facilities.

4 The distribution fee covers the expense of resuscitating mice from the cryo-archive; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

To request material from the MMRRC: Please fill out our on-line request form (accessible from the catalog search results page, or click the Request this Strain button in the fees section). If you have questions or need assistance completing this form, you may call Customer Service at (800) 910-2291 (in USA or Canada) or (530) 757-5710 (international calls). Before you call, please have with you: the MMRRC item number, quantity needed, Bill-to and Ship-to contact information.