Strain Name:
C57BL/6J-MtgxR3693Btlr/Mmmh
Stock Number:
040688-MU
Citation ID:
RRID:MMRRC_040688-MU
Other Names:
R3693 (G1), C57BL/6J-MtgxR3693Btlr
Major Collection:

Strain Information

Pip5k1a
Name: phosphatidylinositol-4-phosphate 5-kinase, type 1 alpha
Synonyms: Pipk5a
Type: Gene
Species: Mouse
Chromosome: 3
NCBI: 18720
HGNC: HGNC:8994
Homologene: 93492
Eya1
Name: EYA transcriptional coactivator and phosphatase 1
Synonyms: bor
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 14048
HGNC: HGNC:3519
Homologene: 74943
Strn
Name: striatin, calmodulin binding protein
Type: Gene
Species: Mouse
Chromosome: 17
NCBI: 268980
Homologene: 2380
Tet1
Name: tet methylcytosine dioxygenase 1
Synonyms: BB001228, 2510010B09Rik, Cxxc6, D10Ertd17e
Type: Gene
Species: Mouse
Chromosome: 10
NCBI: 52463
Homologene: 12735
Cyp11b2
Name: cytochrome P450, family 11, subfamily b, polypeptide 2
Synonyms: Cyp11b-2, Cyp11b, aldosterone synthase, steroid-11-beta-hydroxylase
Type: Gene
Species: Mouse
Chromosome: 15
NCBI: 13072
Homologene: 128035
Osbpl8
Name: oxysterol binding protein-like 8
Synonyms: D330025H14Rik, ORP-8
Type: Gene
Species: Mouse
Chromosome: 10
NCBI: 237542
VEGA: 10
Homologene: 68813
Nop14
Name: NOP14 nucleolar protein
Synonyms: Nol14, 2610033H07Rik
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 75416
Homologene: 41773
Dnaja2
Name: DnaJ heat shock protein family (Hsp40) member A2
Synonyms: 1500017M13Rik, DNJ3, PRO3015, HIRIP4, 2010206B19Rik, mDj3
Type: Gene
Species: Mouse
Chromosome: 8
NCBI: 56445
Homologene: 21193
Rims2
Name: regulating synaptic membrane exocytosis 2
Synonyms: RIM2, Syt3-rs, 2810036I15Rik
Type: Gene
Species: Mouse
Chromosome: 15
NCBI: 116838
VEGA: 15
Homologene: 81639
Eps15l1
Name: epidermal growth factor receptor pathway substrate 15-like 1
Synonyms: Eps15R, Eps15-rs, 9830147J04Rik
Type: Gene
Species: Mouse
Chromosome: 8
NCBI: 13859
Homologene: 31881
Kalrn
Name: kalirin, RhoGEF kinase
Synonyms: LOC224126, E530005C20Rik, 2210407G14Rik, Hapip
Type: Gene
Species: Mouse
Chromosome: 16
NCBI: 545156
HGNC: HGNC:4814
Homologene: 57160
Optn
Name: optineurin
Synonyms: 4930441O07Rik, TFIIIA-INTP
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 71648
Homologene: 11085
Chsy3
Name: chondroitin sulfate synthase 3
Synonyms: 4833446K15Rik
Type: Gene
Species: Mouse
Chromosome: 18
NCBI: 78923
VEGA: 18
Homologene: 28624
Muc6
Name: mucin 6, gastric
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 353328
HGNC: HGNC:7517
Homologene: 18768
Myh11
Name: myosin, heavy polypeptide 11, smooth muscle
Synonyms: SM2, SM1, smMHC
Type: Gene
Species: Mouse
Chromosome: 16
NCBI: 17880
VEGA: 16
HGNC: HGNC:7569
Homologene: 128512
Cabp2
Name: calcium binding protein 2
Type: Gene
Species: Mouse
Chromosome: 19
NCBI: 29866
HGNC: HGNC:1385
Homologene: 8487
Ptprh
Name: protein tyrosine phosphatase receptor type H
Synonyms: SAP-1
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 545902
HGNC: HGNC:9672
Homologene: 37693
Cdhr2
Name: cadherin-related family member 2
Synonyms: Pcdh24, LOC268663
Type: Gene
Species: Mouse
Chromosome: 13
NCBI: 268663
Homologene: 134510
Stxbp5l
Name: syntaxin binding protein 5-like
Synonyms: tomosyn-2, A830015P08Rik, insulin level locus 1, LLGL4, t2md1, T2dm1
Type: Gene
Species: Mouse
Chromosome: 16
NCBI: 207227
Homologene: 18173
Ripk2
Name: receptor (TNFRSF)-interacting serine-threonine kinase 2
Synonyms: CCK, D4Bwg0615e, CARDIAK, RIP2, RICK, CARD3, 2210420D18Rik
Type: Gene
Species: Mouse
Chromosome: 4
NCBI: 192656
Homologene: 37856
Tas2r143
Name: taste receptor, type 2, member 143
Synonyms: mt2r36, Tas2r43
Type: Gene
Species: Mouse
Chromosome: 6
NCBI: 387514
Homologene: 74285
Ugt1a6b
Name: UDP glucuronosyltransferase 1 family, polypeptide A6B
Synonyms: A9'
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 394435
Homologene: 85959
Meiob
Name: meiosis specific with OB domains
Synonyms: 4930528F23Rik
Type: Gene
Species: Mouse
Chromosome: 17
NCBI: 75178
VEGA: 17
Homologene: 102013
Ccdc158
Name: coiled-coil domain containing 158
Synonyms: 4932413O14Rik
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 320696
Homologene: 18560
Dtx3
Name: deltex 3, E3 ubiquitin ligase
Type: Gene
Species: Mouse
Chromosome: 10
NCBI: 80904
Homologene: 12754
Hif3a
Name: hypoxia inducible factor 3, alpha subunit
Synonyms: MOP7, bHLHe17, Nepas
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 53417
Homologene: 9646
Rft1
Name: RFT1 homolog
Type: Gene
Species: Mouse
Chromosome: 14
NCBI: 328370
Homologene: 5343
Exd2
Name: exonuclease 3'-5' domain containing 2
Synonyms: 4930539P14Rik, Exdl2
Type: Gene
Species: Mouse
Chromosome: 12
NCBI: 97827
VEGA: 12
Homologene: 10066
RP24-245M20.2
Name:
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 19
Cherp
Name: calcium homeostasis endoplasmic reticulum protein
Synonyms: DAN16, SCAF6, 5730408I11Rik, D8Wsu96e
Type: Gene
Species: Mouse
Chromosome: 8
NCBI: 27967
Homologene: 4656
Ankrd29
Name: ankyrin repeat domain 29
Synonyms: G630054C21Rik
Type: Gene
Species: Mouse
Chromosome: 18
NCBI: 225187
Homologene: 17839
Nfxl1
Name: nuclear transcription factor, X-box binding-like 1
Synonyms: D430033A06Rik, TCF9, 1700012H24Rik, LOC381696
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 100978
Homologene: 26752
Togaram1
Name: TOG array regulator of axonemal microtubules 1
Synonyms: A430041B07Rik, Fam179b
Type: Gene
Species: Mouse
Chromosome: 12
NCBI: 328108
VEGA: 12
Homologene: 15025
Ces2e
Name: carboxylesterase 2E
Synonyms: 9030624L02Rik, Ces5
Type: Gene
Species: Mouse
Chromosome: 8
NCBI: 234673
HGNC: HGNC:1864
Homologene: 86210
Or5b112
Name: olfactory receptor family 5 subfamily B member 112
Synonyms: Olfr1466, MOR202-12, GA_x6K02T2RE5P-3672907-3673839
Type: Gene
Species: Mouse
Chromosome: 19
NCBI: 258689
HGNC: HGNC:8324
Homologene: 133677
Pigw
Name: phosphatidylinositol glycan anchor biosynthesis, class W
Synonyms: Gwt1, 2610044A17Rik
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 70325
Homologene: 6243
Crygs
Name: crystallin, gamma S
Synonyms: Opj
Type: Gene
Species: Mouse
Chromosome: 16
NCBI: 12970
VEGA: 16
HGNC: HGNC:2417
Homologene: 40695
Mageb4
Name: MAGE family member B4
Synonyms: CN716893, Mage-b4, mMage-b4
Type: Gene
Species: Mus musculus (mouse)
Chromosome: X
NCBI: 434903
Homologene: 134515
2010106E10Rik
Name: RIKEN cDNA 2010106E10 gene
Type: Gene
Species: Mus musculus (mouse)
Chromosome: X
NCBI: 67715
Homologene: 12179
Genetic Alterations
ENU-induced transitions at the following base pair locations (GRCm38):
  • A to G, chromosome 1 at 14,229,501 bp
  • A to G, chromosome 1 at 88,107,794 bp
  • G to A, chromosome 2 at 5,052,978 bp
  • A to T, chromosome 3 at 95,078,187 bp
  • A to T, chromosome 4 at 16,127,695 bp
  • T to C, chromosome 5 at 34,654,438 bp
  • T to C, chromosome 5 at 72,540,611 bp
  • T to C, chromosome 5 at 92,610,045 bp
  • G to A, chromosome 6 at 42,400,976 bp
  • G to T, chromosome 7 at 4,554,235 bp
  • T to C, chromosome 7 at 17,041,074 bp
  • A to G, chromosome 7 at 141,648,681 bp
  • A to G, chromosome 8 at 72,399,060 bp
  • TTGCTGCTGCTGCTGCTGCTG to TTGCTGCTGCTGCTGCTG, chromosome 8 at 72,467,911 bp
  • T to C, chromosome 8 at 85,546,620 bp
  • A to G, chromosome 8 at 104,928,811 bp
  • T to A, chromosome 10 at 62,822,775 bp
  • T to A, chromosome 10 at 111,269,436 bp
  • T to C, chromosome 10 at 127,191,424 bp
  • A to G, chromosome 11 at 84,878,383 bp
  • A to T, chromosome 12 at 64,983,509 bp
  • A to G, chromosome 12 at 80,480,693 bp
  • A to G, chromosome 13 at 54,726,416 bp
  • T to A, chromosome 14 at 30,690,451 bp
  • A to T, chromosome 15 at 39,478,575 bp
  • C to T, chromosome 15 at 74,856,008 bp
  • C to A, chromosome 16 at 14,217,949 bp
  • C to T, chromosome 16 at 22,805,551 bp
  • T to A, chromosome 16 at 34,357,315 bp
  • A to T, chromosome 16 at 37,241,346 bp
  • A to G, chromosome 17 at 24,827,922 bp
  • T to C, chromosome 17 at 78,656,992 bp
  • G to A, chromosome 18 at 12,254,700 bp
  • A to T, chromosome 18 at 59,176,008 bp
  • A to G, chromosome 19 at 4,083,593 bp
  • A to G, chromosome 19 at 4,787,383 bp
  • T to C, chromosome 19 at 13,342,529 bp
  • G to T, chromosome X at 86,252,394 bp
  • A to T, chromosome X at 112,556,315 bp
Genotype Determination
Phenotype
G1 male heterozygous mice are viable and fertile. The G1 mice were not characterized prior to archiving.
Strain Development
C57BL/6J mice were injected with ENU, resulting in G0 mice that were bred back to C57BL/6J. Sperm was archived from G1 male mice that produced viable G2 mice.
Suggested Control Mice
Wild-type littermates or C57BL/6J mice
MMRRC Genetic QC Summary
The MMRRC Centers have developed a genetic QC pipeline using MiniMUGA array genotyping to provide additional information on strain backgrounds for MMRRC congenic and inbred strains. For more information on when data may be available, or to request genotyping for a strain of interest, please contact mmrrc@missouri.edu. Older strains may not have this information.
Donor
Bruce Beutler, M.D., University of Texas Southwestern Medical Center.
Primary Reference
MUTAGENETIX record for R3693 (G1). B. Beutler and colleagues, Center for the Genetics of Host Defense, UT Southwestern, Dallas, TX.

Colony and Husbandry Information

Colony Surveillance Program and Current Health Reports

Mice recovered from a cryo-archive will have health surveillance performed on recipient females. Health reports will be provided prior to shipment. If you require additional health status information, please email mmrrc@missouri.edu.
Coat Color
Black
MMRRC Breeding System
Random intra-strain mating
Breeding Scheme(s)
When maintaining a live colony, heterozygous mice may be bred together, bred with wild-type siblings, or bred with C57BL/6J inbred mice.
Overall Breeding Performance
Undetermined; during development, mating was done with heterozygous males; viability, fertility and other breeding statistics for heterozygous females and homozygotes are unverified, but presumably would be similar to the C57BL/6J background strain
Average litter size
Undetermined
Recommended wean age
3 weeks

Order Request Information

Limited quantities of breeder mice (recovered litter) are available from a cryoarchive; recovered litter usually available to ship in 3 to 4 months.

Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

Distribution of this strain requires submission of the MMRRC Conditions of Use (COU). A link to the COU web form will be provided via email after an order has been placed; the form should be completed then or the email forwarded to your institutional official for completion.

The donor or their institution limits the distribution to non-profit institutions only.

Additional charges may apply for any special requests. Shipping costs are in addition to the basic distribution/resuscitation fees. Information on shipping costs and any additional charges will be provided by the supplying MMRRC facility.

Click button to Request this one strain. (Use the MMRRC Catalog Search to request more than one strain.)
MMRRC Item # Description Distribution Fee / Unit (US $)
*Shipping & Handling not included*
Units Notes
040688-MU-RESUS Litter recovered from cryo-archive $5,475.00 / Non-Profit Litter Recovered litter4; additional fees for any special requests.
Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

Some MMRRC strains were submitted by the donor as cryopreserved germplasm, and because these strains were not cryopreserved by the MMRRC, we have not assessed the quality, nor genotype, of this material. Our expertise in reviving mice from various qualities of frozen sperm and embryos, using methods like IVF and ICSI, gives us confidence in successful recoveries in most cases. However, due to the uncertain quality of these samples, we'll limit revival attempts to two per order. Additional attempts are available for a fee, on top of standard charges, if requested. It's important to note that some strains may lack the expected mutation, so we can't assure successful order fulfillment until we attempt to revive the strain.

1 The distribution fee covers the expense of rederiving mice from a live mouse; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

2 An aliquot contains a sufficient number of embryos (in one or more vials or straws and based on the transfer success rate of the MMRRC facility) to transfer into one to three recipients. The MMRRC makes no guarantee concerning embryo transfer success experienced in the recipient investigator's laboratory. Neither gender nor genotype ratios are guaranteed.

3 An aliquot is one straw or vial with sufficient sperm to recover at least one litter of mice, as per provided protocols, when performed at the MMRRC facility. The MMRRC makes no guarantee concerning the success of these procedures when performed outside the MMRRC facilities.

4 The distribution fee covers the expense of resuscitating mice from the cryo-archive; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

To request material from the MMRRC: Please fill out our on-line request form (accessible from the catalog search results page, or click the Request this Strain button in the fees section). If you have questions or need assistance completing this form, you may call Customer Service at (800) 910-2291 (in USA or Canada) or (530) 757-5710 (international calls). Before you call, please have with you: the MMRRC item number, quantity needed, Bill-to and Ship-to contact information.