Loading Mouse GIF
Loading...

Strain Name:
C57BL/6J-MtgxR3697Btlr/Mmmh
Stock Number:
040691-MU
Citation ID:
RRID:MMRRC_040691-MU
Other Names:
R3697 (G1), C57BL/6J-MtgxR3697Btlr
Major Collection:

Strain Information

Nedd4
Name: neural precursor cell expressed, developmentally down-regulated 4
Synonyms: Nedd4-1, Nedd4, Nedd4a, E430025J12Rik
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 17999
HGNC: HGNC:7727
Homologene: 134533
Cnmd
Name: chondromodulin
Synonyms: Chondromodulin 1, ChM-I, Bricd3, Chmd, Lect1
Type: Gene
Species: Mouse
Chromosome: 14
NCBI: 16840
Homologene: 5095
Miga1
Name: mitoguardin 1
Synonyms: C030011O14Rik, Mita1, Fam73a
Type: Gene
Species: Mouse
Chromosome: 3
NCBI: 215708
Homologene: 18369
Nup205
Name: nucleoporin 205
Synonyms: 3830404O05Rik
Type: Gene
Species: Mouse
Chromosome: 6
NCBI: 70699
Homologene: 45971
G3bp1
Name: G3BP stress granule assembly factor 1
Synonyms: GAP SH3 binding protein
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 27041
Homologene: 38096
Aldh4a1
Name: aldehyde dehydrogenase 4 family, member A1
Synonyms: Ahd-1, Ssdh1, ALDH4, A930035F14Rik, Ahd1, P5CDH
Type: Gene
Species: Mouse
Chromosome: 4
NCBI: 212647
HGNC: HGNC:406
Homologene: 6081
Nop56
Name: NOP56 ribonucleoprotein
Synonyms: NOP56, 56kDa with KKE/D repeat, 2310044F10Rik, Nol5a
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 67134
Homologene: 4660
Gls
Name: glutaminase
Synonyms: B230365M23Rik
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 14660
HGNC: HGNC:4331
Homologene: 22726
Ppfia1
Name: protein tyrosine phosphatase, receptor type, f polypeptide (PTPRF), interacting protein (liprin), alpha 1
Synonyms: liprin, C030014K08Rik, Liprin-alpha1
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 233977
HGNC: HGNC:9245
Homologene: 20802
Ermard
Name: ER membrane associated RNA degradation
Synonyms: 2410011O22Rik, 2210404J11Rik
Type: Gene
Species: Mouse
Chromosome: 17
NCBI: 381062
Homologene: 19936
Il6st
Name: interleukin 6 signal transducer
Synonyms: gp130, CD130, D13Ertd699e, 5133400A03Rik
Type: Gene
Species: Mouse
Chromosome: 13
NCBI: 16195
HGNC: HGNC:6021
Homologene: 1645
Emc1
Name: ER membrane protein complex subunit 1
Synonyms: C230096C10Rik
Type: Gene
Species: Mouse
Chromosome: 4
NCBI: 230866
Homologene: 9002
Lemd3
Name: LEM domain containing 3
Synonyms: Man1
Type: Gene
Species: Mouse
Chromosome: 10
NCBI: 380664
Homologene: 8633
Col4a4
Name: collagen, type IV, alpha 4
Synonyms: [a]4(IV), E130010M05Rik
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 12829
HGNC: HGNC:2206
Homologene: 20071
Clcn3
Name: chloride channel, voltage-sensitive 3
Synonyms: Clc3
Type: Gene
Species: Mouse
Chromosome: 8
NCBI: 12725
HGNC: HGNC:2021
Homologene: 20435
Pglyrp3
Name: peptidoglycan recognition protein 3
Synonyms: LOC242100
Type: Gene
Species: Mouse
Chromosome: 3
NCBI: 242100
Homologene: 71559
Rfx6
Name: regulatory factor X, 6
Synonyms: 4930572O07Rik, Rfxdc1
Type: Gene
Species: Mouse
Chromosome: 10
NCBI: 320995
Homologene: 18318
Arhgef4
Name: Rho guanine nucleotide exchange factor 4
Synonyms: 9330140K16Rik, Asef, C230030N03Rik
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 226970
HGNC: HGNC:684
Homologene: 49414
Phlpp2
Name: PH domain and leucine rich repeat protein phosphatase 2
Synonyms: C130044A18Rik, Phlppl
Type: Gene
Species: Mouse
Chromosome: 8
NCBI: 244650
Homologene: 71015
Vmn1r216
Name: vomeronasal 1 receptor 216
Synonyms: V1ri10
Type: Gene
Species: Mouse
Chromosome: 13
NCBI: 171279
Homologene: 110880
Rgs22
Name: regulator of G-protein signalling 22
Type: Gene
Species: Mouse
Chromosome: 15
NCBI: 626596
Homologene: 75047
Sp6
Name: trans-acting transcription factor 6
Synonyms: Klf14, 1110025J03Rik, epiprofin, Epfn
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 83395
Homologene: 19879
Serpinb8
Name: serine (or cysteine) peptidase inhibitor, clade B, member 8
Synonyms: ovalbumin, CAP-2, CAP2, Spi8, NK10
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 20725
HGNC: HGNC:8952
Homologene: 74445
Nid1
Name: nidogen 1
Synonyms: entactin, entactin 1, nidogen-1, entactin-1
Type: Gene
Species: Mouse
Chromosome: 13
NCBI: 18073
VEGA: 13
HGNC: HGNC:7821
Homologene: 1878
Gm16380
Name: predicted pseudogene 16380
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 9
NCBI: 100038996
VEGA: 9
Il12a
Name: interleukin 12a
Synonyms: IL-12p35, p35
Type: Gene
Species: Mouse
Chromosome: 3
NCBI: 16159
HGNC: HGNC:5969
Homologene: 681
Rtp3
Name: receptor transporter protein 3
Synonyms: Tmem7
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 235636
Homologene: 135957
Kcnd3
Name: potassium voltage-gated channel, Shal-related family, member 3
Synonyms: potassium channel Kv4.3M, potassium channel Kv4.3L, Kv4.3
Type: Gene
Species: Mouse
Chromosome: 3
NCBI: 56543
HGNC: HGNC:6239
Homologene: 21036
Itga3
Name: integrin alpha 3
Synonyms: VLA-3 alpha 3, alpha3-integrin
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 16400
HGNC: HGNC:6139
Homologene: 21129
Vmn1r15
Name: vomeronasal 1 receptor 15
Synonyms: V1rc6
Type: Gene
Species: Mouse
Chromosome: 6
NCBI: 113863
Homologene: 123826
Nckipsd
Name: NCK interacting protein with SH3 domain
Synonyms: WISH, SPIN90, AF3P21, ORF1, DIP1, Wasbp
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 80987
Homologene: 9514
Zfp414
Name: zinc finger protein 414
Synonyms: 0610030H11Rik
Type: Gene
Species: Mouse
Chromosome: 17
NCBI: 328801
Homologene: 12264
Tmem45a
Name: transmembrane protein 45a
Synonyms: C630002M10Rik
Type: Gene
Species: Mouse
Chromosome: 16
NCBI: 56277
Homologene: 41215
Bckdk
Name: branched chain ketoacid dehydrogenase kinase
Synonyms: BCKD-kinase
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 12041
Homologene: 37642
Genetic Alterations
ENU-induced transitions at the following base pair locations (GRCm38):
  • A to G, chromosome 1 at 34,722,440 bp
  • C to T, chromosome 1 at 52,199,764 bp
  • A to T, chromosome 1 at 82,541,237 bp
  • A to T, chromosome 1 at 107,607,146 bp
  • C to A, chromosome 2 at 130,277,587 bp
  • TCAC to TC, chromosome 3 at 68,697,987 bp
  • T to A, chromosome 3 at 92,028,174 bp
  • C to T, chromosome 3 at 105,658,766 bp
  • T to C, chromosome 3 at 152,322,436 bp
  • T to G, chromosome 4 at 139,365,386 bp
  • A to G, chromosome 4 at 139,642,251 bp
  • A to G, chromosome 6 at 35,188,711 bp
  • A to T, chromosome 6 at 57,258,336 bp
  • C to A, chromosome 7 at 127,905,418 bp
  • A to G, chromosome 7 at 144,488,683 bp
  • T to C, chromosome 8 at 60,913,123 bp
  • T to C, chromosome 8 at 109,907,486 bp
  • A to G, chromosome 9 at 53,884,452 bp
  • T to C, chromosome 9 at 72,740,187 bp
  • G to A, chromosome 9 at 108,811,121 bp
  • T to A, chromosome 9 at 110,987,194 bp
  • A to G, chromosome 10 at 51,711,903 bp
  • CCCTCCTCCTCCTCCTCCTCC to CCCTCCTCCTCCTCCTCC, chromosome 10 at 120,978,527 bp
  • T to C, chromosome 11 at 55,496,259 bp
  • T to C, chromosome 11 at 95,062,725 bp
  • C to A, chromosome 11 at 97,021,754 bp
  • G to A, chromosome 13 at 13,486,759 bp
  • G to A, chromosome 13 at 23,099,679 bp
  • T to G, chromosome 13 at 112,504,382 bp
  • C to A, chromosome 14 at 79,637,981 bp
  • C to T, chromosome 15 at 36,099,892 bp
  • G to A, chromosome 16 at 56,825,655 bp
  • T to C, chromosome 17 at 15,053,376 bp
  • CAAACTCTTCCGA to CAAACTCTTCCGAAACTCTTCCGA, chromosome 17 at 33,630,577 bp
Genotype Determination
Phenotype
G1 male heterozygous mice are viable and fertile. The G1 mice were not characterized prior to archiving.
Strain GQC Summary
The MMRRC Centers have developed a Strain GQC pipeline using MiniMUGA array genotyping to provide additional information on strain backgrounds for MMRRC strains. For more information on whether data may be available, or to request genotyping for a strain of interest, please contact MMRRC_GeneticQC@med.unc.edu. Older strains may not have this information available.
Suggested Control Mice
Littermates of all relevant genotypes.
Donor
Bruce Beutler, M.D., University of Texas Southwestern Medical Center.
Primary Reference
MUTAGENETIX record for R3697 (G1). B. Beutler and colleagues, Center for the Genetics of Host Defense, UT Southwestern, Dallas, TX.
Strain Development
C57BL/6J mice were injected with ENU, resulting in G0 mice that were bred back to C57BL/6J. Sperm was archived from G1 male mice that produced viable G2 mice.


Disclaimer: If MMRRC Strain Genetic Quality Control (GQC; based on MiniMUGA genotyping and analysis) has been completed for this strain, the information might differ from the genetic background information provided by the submitter. MiniMUGA genetic analysis is done on a strain’s tissue samples taken when archived by or ordered from the assigned MMRRC Center.

Colony and Husbandry Information

Colony Surveillance Program and Current Health Reports

Mice recovered from a cryo-archive will have health surveillance performed on recipient females. Health reports will be provided prior to shipment. If you require additional health status information, please email mmrrc@missouri.edu.
Coat Color
Black
MMRRC Breeding System
Random intra-strain mating
Breeding Scheme(s)
When maintaining a live colony, heterozygous mice may be bred together, bred with wild-type siblings, or bred with C57BL/6J inbred mice.
Overall Breeding Performance
Undetermined; during development, mating was done with heterozygous males; viability, fertility and other breeding statistics for heterozygous females and homozygotes are unverified, but presumably would be similar to the C57BL/6J background strain
Average litter size
Undetermined
Recommended wean age
3 weeks

Order Request Information

Limited quantities of breeder mice (recovered litter) are available from a cryoarchive; recovered litter usually available to ship in 3 to 4 months.

Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

Distribution of this strain requires submission of the MMRRC Conditions of Use (COU). A link to the COU web form will be provided via email after an order has been placed; the form should be completed then or the email forwarded to your institutional official for completion.

The donor or their institution limits the distribution to non-profit institutions only.

Additional charges may apply for any special requests. Shipping costs are in addition to the basic distribution/resuscitation fees. Information on shipping costs and any additional charges will be provided by the supplying MMRRC facility.

Click button to Request this one strain. (Use the MMRRC Catalog Search to request more than one strain.)
MMRRC Item # Description Distribution Fee / Unit (US $)
*Shipping & Handling not included*
Units Notes
040691-MU-RESUS Litter recovered from cryo-archive $5,475.00 / Non-Profit Litter Recovered litter4; additional fees for any special requests.
Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

Some MMRRC strains were submitted by the donor as cryopreserved germplasm, and because these strains were not cryopreserved by the MMRRC, we have not assessed the quality, nor genotype, of this material. Our expertise in reviving mice from various qualities of frozen sperm and embryos, using methods like IVF and ICSI, gives us confidence in successful recoveries in most cases. However, due to the uncertain quality of these samples, we'll limit revival attempts to two per order. Additional attempts are available for a fee, on top of standard charges, if requested. It's important to note that some strains may lack the expected mutation, so we can't assure successful order fulfillment until we attempt to revive the strain.

1 The distribution fee covers the expense of rederiving mice from a live mouse; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

2 An aliquot contains a sufficient number of embryos (in one or more vials or straws and based on the transfer success rate of the MMRRC facility) to transfer into one to three recipients. The MMRRC makes no guarantee concerning embryo transfer success experienced in the recipient investigator's laboratory. Neither gender nor genotype ratios are guaranteed.

3 An aliquot is one straw or vial with sufficient sperm to recover at least one litter of mice, as per provided protocols, when performed at the MMRRC facility. The MMRRC makes no guarantee concerning the success of these procedures when performed outside the MMRRC facilities.

4 The distribution fee covers the expense of resuscitating mice from the cryo-archive; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

To request material from the MMRRC: Please fill out our on-line request form (accessible from the catalog search results page, or click the Request this Strain button in the fees section). If you have questions or need assistance completing this form, you may call Customer Service at (800) 910-2291 (in USA or Canada) or (530) 757-5710 (international calls). Before you call, please have with you: the MMRRC item number, quantity needed, Bill-to and Ship-to contact information.