Strain Name:
C57BL/6J-MtgxR3702Btlr/Mmmh
Stock Number:
040695-MU
Citation ID:
RRID:MMRRC_040695-MU
Other Names:
R3702 (G1), C57BL/6J-MtgxR3702Btlr
Major Collection:

Gene Information

Efnb1
Name: ephrin B1
Synonyms: Elk-L, Cek5-L, Stra1, Cek5 ligand, Eplg2, LERK-2, Lerk2, EFL-3, Epl2
Type: Gene
Species: Mus musculus (mouse)
Chromosome: X
NCBI: 13641
HGNC: HGNC:3226
Homologene: 3263
Aopep
Name: aminopeptidase O
Synonyms: 2010111I01Rik, ApO
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 13
NCBI: 72061
HGNC: HGNC:1361
Homologene: 66273
Taf3
Name: TATA-box binding protein associated factor 3
Synonyms: 4933439M23Rik, mTAFII140
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 2
NCBI: 209361
Homologene: 35415
Actr2
Name: ARP2 actin-related protein 2
Synonyms: 4921510D23Rik, Arp2, D6Ertd746e
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 11
NCBI: 66713
HGNC: HGNC:169
Homologene: 4181
Commd1
Name: COMM domain containing 1
Synonyms: Murr1
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 11
NCBI: 17846
Homologene: 17604
Cluh
Name: clustered mitochondria (cluA/CLU1) homolog
Synonyms: 1300001I01Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 11
NCBI: 74148
Homologene: 9063
Fam83h
Name: family with sequence similarity 83, member H
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 15
NCBI: 105732
VEGA: 15
Homologene: 15890
Pip4k2b
Name: phosphatidylinositol-5-phosphate 4-kinase, type II, beta
Synonyms: Pip5k2b, c11, PI5P4Kbeta
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 11
NCBI: 108083
HGNC: HGNC:8998
Homologene: 2634
Cul5
Name: cullin 5
Synonyms: VACM-1, C330021I08Rik, 4921514I20Rik, C030032G03Rik, 8430423K24Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 9
NCBI: 75717
HGNC: HGNC:2556
Homologene: 2597
Snap91
Name: synaptosomal-associated protein 91
Synonyms: 91kDa, F1-20, AP180
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 9
NCBI: 20616
Homologene: 8429
Tcea1
Name: transcription elongation factor A (SII) 1
Synonyms: S-II
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 1
NCBI: 21399
Homologene: 55984
Triml2
Name: tripartite motif family-like 2
Synonyms: EG622117
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 8
NCBI: 622117
Homologene: 18316
Lyn
Name: LYN proto-oncogene, Src family tyrosine kinase
Synonyms: Yamaguchi sarcoma viral (v-yes-1) oncogene homolog, Hck-2
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 4
NCBI: 17096
HGNC: HGNC:6735
Homologene: 55649
Prune2
Name: prune homolog 2
Synonyms: A230083H22Rik, A330102H22Rik, 6330414G02Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 19
NCBI: 353211
VEGA: 19
Homologene: 18939
Grik4
Name: glutamate receptor, ionotropic, kainate 4
Synonyms: GluRgamma1, 6330551K01Rik, KA-1, KA1
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 9
NCBI: 110637
HGNC: HGNC:4582
Homologene: 81829
Tomm40
Name: translocase of outer mitochondrial membrane 40
Synonyms: Tom40
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 7
NCBI: 53333
Homologene: 101105
Cpped1
Name: calcineurin-like phosphoesterase domain containing 1
Synonyms: C530044N13Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 16
NCBI: 223978
Homologene: 10142
Elfn1
Name: leucine rich repeat and fibronectin type III, extracellular 1
Synonyms: A930017N06Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 5
NCBI: 243312
Homologene: 18465
Cacna1a
Name: calcium channel, voltage-dependent, P/Q type, alpha 1A subunit
Synonyms: Ccha1a, alpha1A, SCA6, Cacnl1a4, nmf352, smrl
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 8
NCBI: 12286
HGNC: HGNC:1388
Homologene: 56383
Zbed5
Name: zinc finger, BED type containing 5
Synonyms: 2410018M08Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 5
NCBI: 71970
Homologene: 84838
Col24a1
Name: collagen, type XXIV, alpha 1
Synonyms: 5430404K19Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 3
NCBI: 71355
Homologene: 65061
Tex15
Name: testis expressed gene 15
Synonyms: 2210014E14Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 8
NCBI: 104271
Homologene: 12837
Lrp1
Name: low density lipoprotein receptor-related protein 1
Synonyms: A2mr, b2b1554Clo, CD91
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 10
NCBI: 16971
HGNC: HGNC:6692
Homologene: 1744
Aplp1
Name: amyloid beta (A4) precursor-like protein 1
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 7
NCBI: 11803
HGNC: HGNC:597
Homologene: 68447
9530053A07Rik
Name: RIKEN cDNA 9530053A07 gene
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 7
NCBI: 319482
Homologene: 130055
Hivep1
Name: human immunodeficiency virus type I enhancer binding protein 1
Synonyms: Cryabp1, alphaA-CRYBP1
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 13
NCBI: 110521
VEGA: 13
HGNC: HGNC:4920
Homologene: 1596
Cacna1i
Name: calcium channel, voltage-dependent, alpha 1I subunit
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 15
NCBI: 239556
HGNC: HGNC:1396
Homologene: 69331
Abca5
Name: ATP-binding cassette, sub-family A (ABC1), member 5
Synonyms: B930033A02Rik, ABC13
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 11
NCBI: 217265
HGNC: HGNC:35
Homologene: 10263
Myot
Name: myotilin
Synonyms: Ttid, 5530402I04Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 18
NCBI: 58916
Homologene: 4942
Mtmr10
Name: myotubularin related protein 10
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 7
NCBI: 233315
Homologene: 9822
Zfp326
Name: zinc finger protein 326
Synonyms: 5730470H14Rik, ZAN75
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 5
NCBI: 54367
Homologene: 10297
Sh2b2
Name: SH2B adaptor protein 2
Synonyms: Aps
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 5
NCBI: 23921
Homologene: 10309
Ppig
Name: peptidyl-prolyl isomerase G (cyclophilin G)
Synonyms: SRCyp, B230312B02Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 2
NCBI: 228005
Homologene: 3520
Olfr787
Name: olfactory receptor 787
Synonyms: GA_x6K02T2PULF-11141498-11142436, MOR111-10
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 10
NCBI: 258069
Homologene: 105326
Zfp647
Name: zinc finger protein 647
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 15
NCBI: 239546
VEGA: 15
Homologene: 27805
Itgb1bp2
Name: integrin beta 1 binding protein 2
Synonyms: melusin, Chordc3
Type: Gene
Species: Mus musculus (mouse)
Chromosome: X
NCBI: 26549
HGNC: HGNC:6154
Homologene: 22708
Gm10608
Name: predicted gene 10608
Synonyms: EG546165
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 9
NCBI: 546165
VEGA: 9
AC124724.1
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 19
Obox2
Name: oocyte specific homeobox 2
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 7
NCBI: 246792
Homologene: 44937
Gm15701
Name: predicted gene 15701
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 5
Genetic Alterations
ENU-induced transitions at the following base pair locations (GRCm38):
  • T to C, chromosome 1 at 4,894,935 bp
  • G to A, chromosome 2 at 9,952,561 bp
  • T to A, chromosome 2 at 69,733,209 bp
  • C to T, chromosome 3 at 145,337,860 bp
  • A to G, chromosome 4 at 3,742,455 bp
  • A to G, chromosome 5 at 105,888,843 bp
  • G to A, chromosome 5 at 129,903,159 bp
  • A to G, chromosome 5 at 136,102,690 bp
  • A to G, chromosome 5 at 136,224,233 bp
  • A to G, chromosome 5 at 139,972,359 bp
  • G to T, chromosome 7 at 15,396,957 bp
  • G to T, chromosome 7 at 19,713,673 bp
  • G to A, chromosome 7 at 28,157,778 bp
  • T to C, chromosome 7 at 30,442,466 bp
  • T to C, chromosome 7 at 64,337,899 bp
  • T to C, chromosome 8 at 33,574,166 bp
  • T to C, chromosome 8 at 43,185,471 bp
  • T to G, chromosome 8 at 84,617,846 bp
  • T to C, chromosome 9 at 42,675,218 bp
  • T to C, chromosome 9 at 53,629,216 bp
  • G to A, chromosome 9 at 86,806,520 bp
  • CAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGA to CAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGA, chromosome 9 at 119,160,716 bp
  • C to A, chromosome 10 at 127,595,103 bp
  • A to T, chromosome 10 at 129,462,952 bp
  • C to T, chromosome 11 at 20,077,348 bp
  • T to A, chromosome 11 at 22,974,057 bp
  • A to G, chromosome 11 at 74,665,356 bp
  • A to G, chromosome 11 at 97,729,548 bp
  • C to T, chromosome 11 at 110,288,058 bp
  • T to C, chromosome 13 at 42,157,727 bp
  • A to T, chromosome 13 at 63,015,330 bp
  • C to T, chromosome 15 at 76,002,650 bp
  • G to A, chromosome 15 at 76,910,910 bp
  • A to T, chromosome 15 at 80,381,071 bp
  • G to T, chromosome 16 at 11,828,440 bp
  • T to A, chromosome 18 at 44,354,095 bp
  • A to G, chromosome 19 at 17,178,871 bp
  • T to A, chromosome 19 at 47,151,748 bp
  • T to C, chromosome X at 99,147,101 bp
  • T to C, chromosome X at 101,451,687 bp
Genotype Determination
Phenotype
G1 male heterozygous mice are viable and fertile. The G1 mice were not characterized prior to archiving.
Strain Development
C57BL/6J mice were injected with ENU, resulting in G0 mice that were bred back to C57BL/6J. Sperm was archived from G1 male mice that produced viable G2 mice.
Suggested Control Mice
Wild-type littermates or C57BL/6J mice
Donor
Bruce Beutler, M.D., University of Texas Southwestern Medical Center.
Primary Reference
MUTAGENETIX record for R3702 (G1). B. Beutler and colleagues, Center for the Genetics of Host Defense, UT Southwestern, Dallas, TX.

Colony and Husbandry Information

Colony Surveillance Program and Current Health Reports

Mice recovered from a cryo-archive will have health surveillance performed on recipient females. Health reports will be provided prior to shipment. If you require additional health status information, please email mmrrc@missouri.edu .
Coat Color
Black
MMRRC Breeding System
Random intra-strain mating
Breeding Scheme(s)
When maintaining a live colony, heterozygous mice may be bred together, bred with wild-type siblings, or bred with C57BL/6J inbred mice.
Overall Breeding Performance
Undetermined; during development, mating was done with heterozygous males; viability, fertility and other breeding statistics for heterozygous females and homozygotes are unverified, but presumably would be similar to the C57BL/6J background strain
Average litter size
Undetermined
Recommended wean age
3 weeks

Order Request Information

Limited quantities of breeder mice (recovered litter) are available from a cryoarchive; recovered litter usually available to ship in 3 to 4 months.

Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

Distribution of this strain requires submission of the MMRRC Conditions of Use (COU). A link to the COU web form will be provided via email after an order has been placed; the form should be completed then or the email forwarded to your institutional official for completion.

The donor or their institution limits the distribution to non-profit institutions only.

Additional charges may apply for any special requests. Shipping costs are in addition to the basic distribution/resuscitation fees. Information on shipping costs and any additional charges will be provided by the supplying MMRRC facility.

Click button to Request this one strain. (Use the MMRRC Catalog Search to request more than one strain.)
MMRRC Item # Description Distribution Fee / Unit (US $) Units Notes
040695-MU-RESUS Litter recovered from cryo-archive $5,475.00 / Non-Profit Litter Recovered litter4; additional fees for any special requests.
Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

Some MMRRC strains were submitted by the donor as cryopreserved germplasm, and because these strains were not cryopreserved by the MMRRC, we have not assessed the quality of this material. We have extensive experience with recovery of mice from cryopreserved sperm and embryos of varying quality, including using techniques such as IVF and ICSI, and are confident that we will have success in most, if not all, cases. However, because of the unknown quality of these frozen samples, we will restrict recovery efforts to two attempts for each order. Subsequent attempts can be performed on a fee-for-service basis, in addition to the standard fees, upon request.

1 The distribution fee covers the expense of rederiving mice from a live mouse; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

2 An aliquot contains a sufficient number of embryos (in one or more vials or straws and based on the transfer success rate of the MMRRC facility) to transfer into one to three recipients. The MMRRC makes no guarantee concerning embryo transfer success experienced in the recipient investigator's laboratory. Neither gender nor genotype ratios are guaranteed.

3 An aliquot is one straw or vial with sufficient sperm to recover at least one litter of mice, as per provided protocols, when performed at the MMRRC facility. The MMRRC makes no guarantee concerning the success of these procedures when performed outside the MMRRC facilities.

4 The distribution fee covers the expense of resuscitating mice from the cryo-archive; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

To request material from the MMRRC: Please fill out our on-line request form (accessible from the catalog search results page, or click the Request this Strain button in the fees section). If you have questions or need assistance completing this form, you may call Customer Service at (800) 910-2291 (in USA or Canada) or (530) 757-5710 (international calls). Before you call, please have with you: the MMRRC item number, quantity needed, Bill-to and Ship-to contact information.