Loading Mouse GIF
Loading...

Strain Name:
C57BL/6J-MtgxR3702Btlr/Mmmh
Stock Number:
040695-MU
Citation ID:
RRID:MMRRC_040695-MU
Other Names:
R3702 (G1), C57BL/6J-MtgxR3702Btlr
Major Collection:

Strain Information

Efnb1
Name: ephrin B1
Synonyms: Stra1, LERK-2, Cek5 ligand, Epl2, Cek5-L, EFL-3, Elk-L, Eplg2, Lerk2
Type: Gene
Species: Mus musculus (mouse)
Chromosome: X
NCBI: 13641
HGNC: HGNC:3226
Homologene: 3263
Aopep
Name: aminopeptidase O
Synonyms: ApO, 2010111I01Rik
Type: Gene
Species: Mouse
Chromosome: 13
NCBI: 72061
HGNC: HGNC:1361
Homologene: 66273
Taf3
Name: TATA-box binding protein associated factor 3
Synonyms: mTAFII140, 4933439M23Rik
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 209361
Homologene: 35415
Actr2
Name: actin related protein 2
Synonyms: 4921510D23Rik, D6Ertd746e, Arp2
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 66713
HGNC: HGNC:169
Homologene: 4181
Commd1
Name: COMM domain containing 1
Synonyms: Murr1
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 17846
Homologene: 17604
Cluh
Name: clustered mitochondria homolog
Synonyms: 1300001I01Rik
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 74148
Homologene: 9063
Fam83h
Name: family with sequence similarity 83, member H
Type: Gene
Species: Mouse
Chromosome: 15
NCBI: 105732
VEGA: 15
Homologene: 15890
Pip4k2b
Name: phosphatidylinositol-5-phosphate 4-kinase, type II, beta
Synonyms: c11, PI5P4Kbeta, Pip5k2b
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 108083
HGNC: HGNC:8998
Homologene: 2634
Cul5
Name: cullin 5
Synonyms: 4921514I20Rik, C330021I08Rik, C030032G03Rik, VACM-1, 8430423K24Rik
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 75717
HGNC: HGNC:2556
Homologene: 2597
Snap91
Name: synaptosomal-associated protein 91
Synonyms: F1-20, 91kDa, AP180
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 20616
Homologene: 8429
Tcea1
Name: transcription elongation factor A (SII) 1
Synonyms: S-II
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 21399
Homologene: 55984
Triml2
Name: tripartite motif family-like 2
Synonyms: EG622117
Type: Gene
Species: Mouse
Chromosome: 8
NCBI: 622117
Homologene: 18316
Lyn
Name: LYN proto-oncogene, Src family tyrosine kinase
Synonyms: Hck-2, Yamaguchi sarcoma viral (v-yes-1) oncogene homolog
Type: Gene
Species: Mouse
Chromosome: 4
NCBI: 17096
HGNC: HGNC:6735
Homologene: 55649
Prune2
Name: prune homolog 2
Synonyms: 6330414G02Rik, A330102H22Rik, A230083H22Rik, Olfaxin
Type: Gene
Species: Mouse
Chromosome: 19
NCBI: 353211
VEGA: 19
Homologene: 18939
Grik4
Name: glutamate receptor, ionotropic, kainate 4
Synonyms: KA1, 6330551K01Rik, GluRgamma1, KA-1
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 110637
HGNC: HGNC:4582
Homologene: 81829
Tomm40
Name: translocase of outer mitochondrial membrane 40
Synonyms: Tom40
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 53333
Homologene: 101105
Cpped1
Name: calcineurin-like phosphoesterase domain containing 1
Synonyms: C530044N13Rik
Type: Gene
Species: Mouse
Chromosome: 16
NCBI: 223978
Homologene: 10142
Elfn1
Name: leucine rich repeat and fibronectin type III, extracellular 1
Synonyms: A930017N06Rik
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 243312
Homologene: 18465
Cacna1a
Name: calcium channel, voltage-dependent, P/Q type, alpha 1A subunit
Synonyms: Cacnl1a4, alpha1A, Ccha1a, SCA6, nmf352, smrl
Type: Gene
Species: Mouse
Chromosome: 8
NCBI: 12286
HGNC: HGNC:1388
Homologene: 56383
Zbed5
Name: zinc finger BED-type containing 5
Synonyms: 2410018M08Rik, Zbed5, Chchd2l
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 71970
Homologene: 84838
Col24a1
Name: collagen, type XXIV, alpha 1
Synonyms: 5430404K19Rik
Type: Gene
Species: Mouse
Chromosome: 3
NCBI: 71355
Homologene: 65061
Tex15
Name: testis expressed gene 15 meiosis and synapsis associated
Synonyms: 2210014E14Rik
Type: Gene
Species: Mouse
Chromosome: 8
NCBI: 104271
Homologene: 12837
Lrp1
Name: low density lipoprotein receptor-related protein 1
Synonyms: CD91, A2mr, b2b1554Clo
Type: Gene
Species: Mouse
Chromosome: 10
NCBI: 16971
HGNC: HGNC:6692
Homologene: 1744
Aplp1
Name: amyloid beta precursor like protein 1
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 11803
HGNC: HGNC:597
Homologene: 68447
Fcgbpl1
Name: Fc fragment of IgG binding protein like 1
Synonyms: 9530053A07Rik
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 319482
Homologene: 130055
Hivep1
Name: human immunodeficiency virus type I enhancer binding protein 1
Synonyms: Cryabp1, alphaA-CRYBP1
Type: Gene
Species: Mouse
Chromosome: 13
NCBI: 110521
VEGA: 13
HGNC: HGNC:4920
Homologene: 1596
Cacna1i
Name: calcium channel, voltage-dependent, alpha 1I subunit
Type: Gene
Species: Mouse
Chromosome: 15
NCBI: 239556
HGNC: HGNC:1396
Homologene: 69331
Abca5
Name: ATP-binding cassette, sub-family A member 5
Synonyms: ABC13, B930033A02Rik
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 217265
HGNC: HGNC:35
Homologene: 10263
Myot
Name: myotilin
Synonyms: 5530402I04Rik, Ttid
Type: Gene
Species: Mouse
Chromosome: 18
NCBI: 58916
Homologene: 4942
Mtmr10
Name: myotubularin related protein 10
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 233315
Homologene: 9822
Zfp326
Name: zinc finger protein 326
Synonyms: ZAN75, 5730470H14Rik
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 54367
Homologene: 10297
Sh2b2
Name: SH2B adaptor protein 2
Synonyms: Aps
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 23921
Homologene: 10309
Ppig
Name: peptidyl-prolyl isomerase G (cyclophilin G)
Synonyms: SRCyp, B230312B02Rik
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 228005
Homologene: 3520
Or6c5c
Name: olfactory receptor family 6 subfamily C member 5C
Synonyms: GA_x6K02T2PULF-11141498-11142436, MOR111-10, Olfr787
Type: Gene
Species: Mouse
Chromosome: 10
NCBI: 258069
Homologene: 105326
Zfp647
Name: zinc finger protein 647
Type: Gene
Species: Mouse
Chromosome: 15
NCBI: 239546
VEGA: 15
Homologene: 27805
Itgb1bp2
Name: integrin beta 1 binding protein 2
Synonyms: melusin, Chordc3
Type: Gene
Species: Mus musculus (mouse)
Chromosome: X
NCBI: 26549
HGNC: HGNC:6154
Homologene: 22708
Gm10608
Name: predicted gene 10608
Synonyms: EG546165
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 546165
VEGA: 9
AC124724.1
Name:
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 19
Obox2
Name: oocyte specific homeobox 2
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 246792
Homologene: 44937
Gm15701
Name: predicted gene 15701
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 5
Genetic Alterations
ENU-induced transitions at the following base pair locations (GRCm38):
  • T to C, chromosome 1 at 4,894,935 bp
  • G to A, chromosome 2 at 9,952,561 bp
  • T to A, chromosome 2 at 69,733,209 bp
  • C to T, chromosome 3 at 145,337,860 bp
  • A to G, chromosome 4 at 3,742,455 bp
  • A to G, chromosome 5 at 105,888,843 bp
  • G to A, chromosome 5 at 129,903,159 bp
  • A to G, chromosome 5 at 136,102,690 bp
  • A to G, chromosome 5 at 136,224,233 bp
  • A to G, chromosome 5 at 139,972,359 bp
  • G to T, chromosome 7 at 15,396,957 bp
  • G to T, chromosome 7 at 19,713,673 bp
  • G to A, chromosome 7 at 28,157,778 bp
  • T to C, chromosome 7 at 30,442,466 bp
  • T to C, chromosome 7 at 64,337,899 bp
  • T to C, chromosome 8 at 33,574,166 bp
  • T to C, chromosome 8 at 43,185,471 bp
  • T to G, chromosome 8 at 84,617,846 bp
  • T to C, chromosome 9 at 42,675,218 bp
  • T to C, chromosome 9 at 53,629,216 bp
  • G to A, chromosome 9 at 86,806,520 bp
  • CAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGA to CAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGA, chromosome 9 at 119,160,716 bp
  • C to A, chromosome 10 at 127,595,103 bp
  • A to T, chromosome 10 at 129,462,952 bp
  • C to T, chromosome 11 at 20,077,348 bp
  • T to A, chromosome 11 at 22,974,057 bp
  • A to G, chromosome 11 at 74,665,356 bp
  • A to G, chromosome 11 at 97,729,548 bp
  • C to T, chromosome 11 at 110,288,058 bp
  • T to C, chromosome 13 at 42,157,727 bp
  • A to T, chromosome 13 at 63,015,330 bp
  • C to T, chromosome 15 at 76,002,650 bp
  • G to A, chromosome 15 at 76,910,910 bp
  • A to T, chromosome 15 at 80,381,071 bp
  • G to T, chromosome 16 at 11,828,440 bp
  • T to A, chromosome 18 at 44,354,095 bp
  • A to G, chromosome 19 at 17,178,871 bp
  • T to A, chromosome 19 at 47,151,748 bp
  • T to C, chromosome X at 99,147,101 bp
  • T to C, chromosome X at 101,451,687 bp
Genotype Determination
Phenotype
G1 male heterozygous mice are viable and fertile. The G1 mice were not characterized prior to archiving.
Strain GQC Summary
The MMRRC Centers have developed a Strain GQC pipeline using MiniMUGA array genotyping to provide additional information on strain backgrounds for MMRRC strains. For more information on whether data may be available, or to request genotyping for a strain of interest, please contact MMRRC_GeneticQC@med.unc.edu. Older strains may not have this information available.
Suggested Control Mice
Littermates of all relevant genotypes.
Donor
Bruce Beutler, M.D., University of Texas Southwestern Medical Center.
Primary Reference
MUTAGENETIX record for R3702 (G1). B. Beutler and colleagues, Center for the Genetics of Host Defense, UT Southwestern, Dallas, TX.
Strain Development
C57BL/6J mice were injected with ENU, resulting in G0 mice that were bred back to C57BL/6J. Sperm was archived from G1 male mice that produced viable G2 mice.


Disclaimer: If MMRRC Strain Genetic Quality Control (GQC; based on MiniMUGA genotyping and analysis) has been completed for this strain, the information might differ from the genetic background information provided by the submitter. MiniMUGA genetic analysis is done on a strain’s tissue samples taken when archived by or ordered from the assigned MMRRC Center.

Colony and Husbandry Information

Colony Surveillance Program and Current Health Reports

Mice recovered from a cryo-archive will have health surveillance performed on recipient females. Health reports will be provided prior to shipment. If you require additional health status information, please email mmrrc@missouri.edu.
Coat Color
Black
MMRRC Breeding System
Random intra-strain mating
Breeding Scheme(s)
When maintaining a live colony, heterozygous mice may be bred together, bred with wild-type siblings, or bred with C57BL/6J inbred mice.
Overall Breeding Performance
Undetermined; during development, mating was done with heterozygous males; viability, fertility and other breeding statistics for heterozygous females and homozygotes are unverified, but presumably would be similar to the C57BL/6J background strain
Average litter size
Undetermined
Recommended wean age
3 weeks

Order Request Information

Limited quantities of breeder mice (recovered litter) are available from a cryoarchive; recovered litter usually available to ship in 3 to 4 months.

Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

Distribution of this strain requires submission of the MMRRC Conditions of Use (COU). A link to the COU web form will be provided via email after an order has been placed; the form should be completed then or the email forwarded to your institutional official for completion.

The donor or their institution limits the distribution to non-profit institutions only.

Additional charges may apply for any special requests. Shipping costs are in addition to the basic distribution/resuscitation fees. Information on shipping costs and any additional charges will be provided by the supplying MMRRC facility.

Click button to Request this one strain. (Use the MMRRC Catalog Search to request more than one strain.)
MMRRC Item # Description Distribution Fee / Unit (US $)
*Shipping & Handling not included*
Units Notes
040695-MU-RESUS Litter recovered from cryo-archive $5,475.00 / Non-Profit Litter Recovered litter4; additional fees for any special requests.
Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

Some MMRRC strains were submitted by the donor as cryopreserved germplasm, and because these strains were not cryopreserved by the MMRRC, we have not assessed the quality, nor genotype, of this material. Our expertise in reviving mice from various qualities of frozen sperm and embryos, using methods like IVF and ICSI, gives us confidence in successful recoveries in most cases. However, due to the uncertain quality of these samples, we'll limit revival attempts to two per order. Additional attempts are available for a fee, on top of standard charges, if requested. It's important to note that some strains may lack the expected mutation, so we can't assure successful order fulfillment until we attempt to revive the strain.

1 The distribution fee covers the expense of rederiving mice from a live mouse; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

2 An aliquot contains a sufficient number of embryos (in one or more vials or straws and based on the transfer success rate of the MMRRC facility) to transfer into one to three recipients. The MMRRC makes no guarantee concerning embryo transfer success experienced in the recipient investigator's laboratory. Neither gender nor genotype ratios are guaranteed.

3 An aliquot is one straw or vial with sufficient sperm to recover at least one litter of mice, as per provided protocols, when performed at the MMRRC facility. The MMRRC makes no guarantee concerning the success of these procedures when performed outside the MMRRC facilities.

4 The distribution fee covers the expense of resuscitating mice from the cryo-archive; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

To request material from the MMRRC: Please fill out our on-line request form (accessible from the catalog search results page, or click the Request this Strain button in the fees section). If you have questions or need assistance completing this form, you may call Customer Service at (800) 910-2291 (in USA or Canada) or (530) 757-5710 (international calls). Before you call, please have with you: the MMRRC item number, quantity needed, Bill-to and Ship-to contact information.


Title

Text