Strain Name:
Stock Number:
Citation ID:
Other Names:
R3705 (G1), C57BL/6J-MtgxR3705Btlr
Major Collection:

Strain Information

Name: kinesin family member C3
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 8
NCBI: 16582
Homologene: 124421
Name: glutamate receptor, metabotropic 1
Synonyms: mGluR1, Grm1, Gprc1a, nmf373, rcw, 4930455H15Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 10
NCBI: 14816
Homologene: 649
Name: platelet-derived growth factor, C polypeptide
Synonyms: 1110064L01Rik, PDGF-C
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 3
NCBI: 54635
Homologene: 9423
Name: ATP-binding cassette, sub-family A (ABC1), member 12
Synonyms: 4832428G11Rik, 4833417A11Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 1
NCBI: 74591
Homologene: 45441
Name: protein phosphatase 1, regulatory inhibitor subunit 14C
Synonyms: 6330514J04Rik, KEPI
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 10
NCBI: 76142
VEGA: 10
Homologene: 12805
Name: B cell receptor associated protein 29
Synonyms: Bap29
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 12
NCBI: 12033
VEGA: 12
Homologene: 22411
Name: topoisomerase (DNA) I
Synonyms: Top-1, D130064I21Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 2
NCBI: 21969
Homologene: 2467
Name: nischarin
Synonyms: 1200007D05Rik, 3202002H23Rik, edsn
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 14
NCBI: 64652
Homologene: 136161
Name: family with sequence similarity 133, member B
Synonyms: 2900022K02Rik, 5830415L20Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 5
NCBI: 68152
Homologene: 85443
Name: zinc finger CCCH-type containing 4
Synonyms: LOC330474, Bwq1, Kiaa1064-hp
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 7
NCBI: 330474
Homologene: 87150
Name: histone deacetylase 4
Synonyms: 4932408F19Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 1
NCBI: 208727
Homologene: 55946
Name: bridge-like lipid transfer protein family member 1
Synonyms: Tweek, FSA, 4932438A13Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 3
NCBI: 229227
Homologene: 52105
Name: bromodomain and WD repeat domain containing 3
Synonyms: LOC236955, D030064D06Rik, Brodl
Type: Gene
Species: Mus musculus (mouse)
Chromosome: X
NCBI: 382236
Homologene: 18736
Name: dynein cytoplasmic 1 heavy chain 1
Synonyms: MAP1C, dynein heavy chain, retrograde transport, Dnec1, Loa, 9930018I23Rik, Dnchc1, Swl
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 12
NCBI: 13424
Homologene: 1053
Name: teneurin transmembrane protein 2
Synonyms: Ten-m2, D3Bwg1534e, 9330187F13Rik, 2610040L17Rik, Odz2
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 11
NCBI: 23964
Homologene: 22672
Name: pleckstrin homology like domain, family B, member 1
Synonyms: LL5A, D330037A14Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 9
NCBI: 102693
Homologene: 15903
Name: splicing factor 3b, subunit 4
Synonyms: SF3b49, Sap49, 49kDa
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 3
NCBI: 107701
Homologene: 134086
Name: Janus kinase 3
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 8
NCBI: 16453
Homologene: 181
Name: synaptic Ras GTPase activating protein 1 homolog (rat)
Synonyms: Syngap
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 17
NCBI: 240057
Homologene: 84739
Name: tryptophan hydroxylase 2
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 10
NCBI: 216343
Homologene: 27831
Name: RIO kinase 3
Synonyms: 1200013N13Rik, Sudd, D18Ertd331e, E130306C24Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 18
NCBI: 66878
VEGA: 18
Homologene: 2843
Name: DnaJ heat shock protein family (Hsp40) member C19
Synonyms: 1810055D05Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 3
NCBI: 67713
Homologene: 87176
Name: ArfGAP with SH3 domain, ankyrin repeat and PH domain 3
Synonyms: UPLC1, 9430088F20Rik, Ddefl1
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 4
NCBI: 230837
Homologene: 41190
Name: intraflagellar transport 172
Synonyms: wim, 4930553F24Rik, avc1
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 5
NCBI: 67661
Homologene: 15202
Name: cubilin (intrinsic factor-cobalamin receptor)
Synonyms: D2Wsu88e
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 2
NCBI: 65969
Homologene: 37434
Name: HFM1, ATP-dependent DNA helicase homolog
Synonyms: LOC381663, A330009G12Rik, Sec63d1, Mer3
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 5
NCBI: 330149
Homologene: 87103
Name: colony stimulating factor 3 receptor (granulocyte)
Synonyms: G-CSFR, Csfgr, Cd114
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 4
NCBI: 12986
Homologene: 601
Name: transmembrane protein 63a
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 1
NCBI: 208795
Homologene: 101673
Name: ataxin 7
Synonyms: ataxin-7, Sca7, A430107N12Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 14
NCBI: 246103
VEGA: 14
Homologene: 30967
Name: calpain 1
Synonyms: mu-calpin, Capa-1, Capa1
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 19
NCBI: 12333
VEGA: 19
Homologene: 3800
Name: 4-hydroxyphenylpyruvic acid dioxygenase
Synonyms: Hppd, Laf, Flp, Fla
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 5
NCBI: 15445
Homologene: 1620
Name: immunoglobulin-like and fibronectin type III domain containing 1
Synonyms: 9830123M21Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 1
NCBI: 226438
Homologene: 130054
Name: NIPA-like domain containing 4
Synonyms: 9530066K23Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 11
NCBI: 214112
Homologene: 133769
Name: glycoprotein (transmembrane) nmb
Synonyms: Dchil, Osteoactivin, DC-HIL
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 6
NCBI: 93695
Homologene: 1880
Name: GTP binding protein 3
Synonyms: Gtpbp3, 2410009F13Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 8
NCBI: 70359
Homologene: 6600
Name: sperm associated antigen 6-like
Synonyms: PF16, Spag6
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 16
NCBI: 50525
Homologene: 8252
Name: zinc finger RNA binding protein 2
Synonyms: 2010013I23Rik, 9130206N08Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 10
NCBI: 103406
Homologene: 88124
Name: nucleotide-binding oligomerization domain containing 2
Synonyms: F830032C23Rik, Card15, Nlrc2
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 8
NCBI: 257632
Homologene: 11156
Name: neuromedin U receptor 2
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 11
NCBI: 216749
Homologene: 49618
Name: ceramide synthase 3
Synonyms: T3L, related to TRH3, LOC233330, CerS3, 4930550L11Rik, Lass3
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 7
NCBI: 545975
Homologene: 18719
Name: leucine rich repeat containing 8D
Synonyms: 4930525N13Rik, Lrrc5, 2810473G09Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 5
NCBI: 231549
Homologene: 10004
Name: RIKEN cDNA 9930111J21 gene 1
Synonyms: 9930111J21Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 11
NCBI: 667214
Homologene: 83188
Name: 4-hydroxy-2-oxoglutarate aldolase 1
Synonyms: 0610010D20Rik, Npl2, Dhdpsl
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 19
NCBI: 67432
Homologene: 12130
Name: reculator of chromosome condensation 1 like
Synonyms: 5730496C04Rik, Wbscr16
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 5
NCBI: 94254
Homologene: 36477
Name: olfactory receptor family 5 subfamily W member 22
Synonyms: V5, Olfr4-2, GA_x6K02T2Q125-49033418-49034341, MOR177-5, Olfr153
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 2
NCBI: 110511
Homologene: 128127
Name: tubulin epsilon and delta complex 2
Synonyms: 1600002H07Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 17
NCBI: 72016
Homologene: 45943
Name: TOX high mobility group box family member 3
Synonyms: CAGF9, Tnrc9, 500-9
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 8
NCBI: 244579
Homologene: 18257
Name: EH-domain containing 1
Synonyms: Past1, RME-1
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 19
NCBI: 13660
Homologene: 81678
Name: FXYD domain-containing ion transport regulator 1
Synonyms: phospholemman, PML, 0610012C17Rik, PLM, 1110006M24Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 7
NCBI: 56188
Homologene: 3691
Name: family with sequence similarity 43, member B
Synonyms: OTTMUSG00000009974
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 4
NCBI: 625638
Homologene: 45810
Name: sperm associated antigen 6
Synonyms: BC061194, Spag6l
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 2
NCBI: 381350
Homologene: 133723
Genetic Alterations
ENU-induced transitions at the following base pair locations (GRCm38):
  • T to C, chromosome 1 at 71,285,705 bp
  • A to G, chromosome 1 at 91,934,694 bp
  • T to C, chromosome 1 at 135,968,409 bp
  • G to A, chromosome 1 at 180,963,114 bp
  • T to A, chromosome 2 at 13,350,943 bp
  • A to G, chromosome 2 at 18,710,557 bp
  • A to G, chromosome 2 at 87,532,068 bp
  • G to A, chromosome 2 at 160,702,824 bp
  • A to G, chromosome 3 at 34,080,229 bp
  • T to A, chromosome 3 at 36,987,581 bp
  • T to C, chromosome 3 at 81,204,444 bp
  • T to C, chromosome 3 at 96,176,628 bp
  • A to G, chromosome 4 at 126,032,285 bp
  • TGAGGAGGAGGAGGAGGA to TGAGGAGGAGGAGGAGGAGGA, chromosome 4 at 136,241,241 bp
  • G to C, chromosome 4 at 138,395,098 bp
  • T to C, chromosome 5 at 3,561,034 bp
  • A to G, chromosome 5 at 31,261,437 bp
  • T to C, chromosome 5 at 105,813,475 bp
  • A to G, chromosome 5 at 106,892,839 bp
  • G to A, chromosome 5 at 123,181,846 bp
  • A to T, chromosome 5 at 134,154,191 bp
  • T to A, chromosome 6 at 49,051,865 bp
  • C to T, chromosome 7 at 16,429,364 bp
  • G to A, chromosome 7 at 31,053,878 bp
  • G to T, chromosome 7 at 66,786,075 bp
  • T to G, chromosome 8 at 71,492,135 bp
  • A to G, chromosome 8 at 71,681,522 bp
  • T to C, chromosome 8 at 88,653,320 bp
  • G to T, chromosome 8 at 90,248,905 bp
  • G to A, chromosome 8 at 95,104,028 bp
  • G to T, chromosome 9 at 44,694,394 bp
  • A to G, chromosome 10 at 3,423,524 bp
  • G to A, chromosome 10 at 10,782,729 bp
  • T to G, chromosome 10 at 81,246,079 bp
  • G to A, chromosome 10 at 115,119,893 bp
  • T to A, chromosome 11 at 36,068,326 bp
  • T to C, chromosome 11 at 46,161,851 bp
  • T to C, chromosome 11 at 48,947,976 bp
  • T to C, chromosome 11 at 56,040,474 bp
  • T to C, chromosome 12 at 31,617,152 bp
  • G to A, chromosome 12 at 110,640,586 bp
  • T to A, chromosome 14 at 14,103,298 bp
  • A to G, chromosome 14 at 31,176,745 bp
  • A to G, chromosome 17 at 24,216,387 bp
  • T to C, chromosome 17 at 26,960,020 bp
  • A to G, chromosome 18 at 12,148,954 bp
  • T to C, chromosome 19 at 6,007,371 bp
  • A to G, chromosome 19 at 6,298,300 bp
  • A to G, chromosome 19 at 42,046,116 bp
  • A to G, chromosome X at 108,760,415 bp
Genotype Determination
G1 male heterozygous mice are viable and fertile. The G1 mice were not characterized prior to archiving.
Strain Development
C57BL/6J mice were injected with ENU, resulting in G0 mice that were bred back to C57BL/6J. Sperm was archived from G1 male mice that produced viable G2 mice.
Suggested Control Mice
Wild-type littermates or C57BL/6J mice
MMRRC Genetic QC Summary
The MMRRC Centers have developed a genetic QC pipeline using MiniMUGA array genotyping to provide additional information on strain backgrounds for MMRRC congenic and inbred strains. For more information on when data may be available, or to request genotyping for a strain of interest, please contact Older strains may not have this information.
Bruce Beutler, M.D., University of Texas Southwestern Medical Center.
Primary Reference
MUTAGENETIX record for R3705 (G1). B. Beutler and colleagues, Center for the Genetics of Host Defense, UT Southwestern, Dallas, TX.

Colony and Husbandry Information

Colony Surveillance Program and Current Health Reports

Mice recovered from a cryo-archive will have health surveillance performed on recipient females. Health reports will be provided prior to shipment. If you require additional health status information, please email .
Coat Color
MMRRC Breeding System
Random intra-strain mating
Breeding Scheme(s)
When maintaining a live colony, heterozygous mice may be bred together, bred with wild-type siblings, or bred with C57BL/6J inbred mice.
Overall Breeding Performance
Undetermined; during development, mating was done with heterozygous males; viability, fertility and other breeding statistics for heterozygous females and homozygotes are unverified, but presumably would be similar to the C57BL/6J background strain
Average litter size
Recommended wean age
3 weeks

Order Request Information

Limited quantities of breeder mice (recovered litter) are available from a cryoarchive; recovered litter usually available to ship in 3 to 4 months.

Cryopreserved material may be available upon request, please inquire to for more information.

Distribution of this strain requires submission of the MMRRC Conditions of Use (COU). A link to the COU web form will be provided via email after an order has been placed; the form should be completed then or the email forwarded to your institutional official for completion.

The donor or their institution limits the distribution to non-profit institutions only.

Additional charges may apply for any special requests. Shipping costs are in addition to the basic distribution/resuscitation fees. Information on shipping costs and any additional charges will be provided by the supplying MMRRC facility.

Click button to Request this one strain. (Use the MMRRC Catalog Search to request more than one strain.)
MMRRC Item # Description Distribution Fee / Unit (US $)
*Shipping & Handling not included*
Units Notes
040698-MU-RESUS Litter recovered from cryo-archive $5,475.00 / Non-Profit Litter Recovered litter4; additional fees for any special requests.
Cryopreserved material may be available upon request, please inquire to for more information.

Some MMRRC strains were submitted by the donor as cryopreserved germplasm, and because these strains were not cryopreserved by the MMRRC, we have not assessed the quality of this material. We have extensive experience with recovery of mice from cryopreserved sperm and embryos of varying quality, including using techniques such as IVF and ICSI, and are confident that we will have success in most, if not all, cases. However, because of the unknown quality of these frozen samples, we will restrict recovery efforts to two attempts for each order. Subsequent attempts can be performed on a fee-for-service basis, in addition to the standard fees, upon request.

1 The distribution fee covers the expense of rederiving mice from a live mouse; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

2 An aliquot contains a sufficient number of embryos (in one or more vials or straws and based on the transfer success rate of the MMRRC facility) to transfer into one to three recipients. The MMRRC makes no guarantee concerning embryo transfer success experienced in the recipient investigator's laboratory. Neither gender nor genotype ratios are guaranteed.

3 An aliquot is one straw or vial with sufficient sperm to recover at least one litter of mice, as per provided protocols, when performed at the MMRRC facility. The MMRRC makes no guarantee concerning the success of these procedures when performed outside the MMRRC facilities.

4 The distribution fee covers the expense of resuscitating mice from the cryo-archive; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

To request material from the MMRRC: Please fill out our on-line request form (accessible from the catalog search results page, or click the Request this Strain button in the fees section). If you have questions or need assistance completing this form, you may call Customer Service at (800) 910-2291 (in USA or Canada) or (530) 757-5710 (international calls). Before you call, please have with you: the MMRRC item number, quantity needed, Bill-to and Ship-to contact information.