Strain Name:
C57BL/6J-MtgxR3807Btlr/Mmmh
Stock Number:
040764-MU
Citation ID:
RRID:MMRRC_040764-MU
Other Names:
R3807 (G1), C57BL/6J-MtgxR3807Btlr
Major Collection:

Strain Information

Npr1
Name: natriuretic peptide receptor 1
Synonyms: NPRA, GC-A, NPR-A, guanylyl cyclase-A
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 3
NCBI: 18160
HGNC: HGNC:7943
Homologene: 37367
Ptch1
Name: patched 1
Synonyms: Ptc, Patched 1, Ptc1, A230106A15Rik, wig
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 13
NCBI: 19206
HGNC: HGNC:9585
Homologene: 223
Frem2
Name: Fras1 related extracellular matrix protein 2
Synonyms: 8430406N05Rik, 6030440P17Rik, my, ne, b2b1562Clo
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 3
NCBI: 242022
Homologene: 18454
Rgs11
Name: regulator of G-protein signaling 11
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 17
NCBI: 50782
HGNC: HGNC:9993
Homologene: 77719
Pkp4
Name: plakophilin 4
Synonyms: p0071, Armrp, 5031422I09Rik, 9430019K17Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 2
NCBI: 227937
HGNC: HGNC:9026
Homologene: 2689
Get4
Name: golgi to ER traffic protein 4
Synonyms: 1110007L15Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 5
NCBI: 67604
Homologene: 41080
Numa1
Name: nuclear mitotic apparatus protein 1
Synonyms: 6720401E04Rik, NuMA
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 7
NCBI: 101706
HGNC: HGNC:8059
Homologene: 38150
Psme4
Name: proteasome (prosome, macropain) activator subunit 4
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 11
NCBI: 103554
Homologene: 113742
Psmd12
Name: proteasome (prosome, macropain) 26S subunit, non-ATPase, 12
Synonyms: P55, 1500002F15Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 11
NCBI: 66997
HGNC: HGNC:9557
Homologene: 2109
Herc2
Name: HECT and RLD domain containing E3 ubiquitin protein ligase 2
Synonyms: D7H15F32S1, D15F32S1h, D7H15F37S1, rjs, jdf2
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 7
NCBI: 15204
HGNC: HGNC:4868
Homologene: 3430
Bicd1
Name: BICD cargo adaptor 1
Synonyms: B830009D06Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 6
NCBI: 12121
HGNC: HGNC:1049
Homologene: 37518
Vbp1
Name: von Hippel-Lindau binding protein 1
Type: Gene
Species: Mus musculus (mouse)
Chromosome: X
NCBI: 22327
Homologene: 2531
Arhgap42
Name: Rho GTPase activating protein 42
Synonyms: 9030420J04Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 9
NCBI: 71544
Homologene: 28446
Adat1
Name: adenosine deaminase, tRNA-specific 1
Synonyms: mADAT1
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 8
NCBI: 30947
HGNC: HGNC:228
Homologene: 8096
Dmbt1
Name: deleted in malignant brain tumors 1
Synonyms: CRP-[b], CRP-[a], ebnerin, hensin, vomeroglandin, Crpd, MUCLIN, gp300
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 7
NCBI: 12945
HGNC: HGNC:2926
Homologene: 68990
Tfrc
Name: transferrin receptor
Synonyms: CD71, Mtvr-1, Mtvr1, E430033M20Rik, 2610028K12Rik, p90, Trfr, TfR1
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 16
NCBI: 22042
Homologene: 2429
Tdp2
Name: tyrosyl-DNA phosphodiesterase 2
Synonyms: D13Ertd656e, Ttrap
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 13
NCBI: 56196
Homologene: 9591
Cttn
Name: cortactin
Synonyms: Ems1, 1110020L01Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 7
NCBI: 13043
HGNC: HGNC:3338
Homologene: 3834
Nolc1
Name: nucleolar and coiled-body phosphoprotein 1
Synonyms: P130, NOPP140, 3230402K17Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 19
NCBI: 70769
VEGA: 19
Erich1
Name: glutamate rich 1
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 8
NCBI: 234086
Homologene: 19271
Bpifb1
Name: BPI fold containing family B, member 1
Synonyms: von Ebner minor salivary protein, LPlunc1, U46068
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 2
NCBI: 228801
Homologene: 50047
Zmiz1
Name: zinc finger, MIZ-type containing 1
Synonyms: Rai17, Zimp10
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 14
NCBI: 328365
Homologene: 10667
Ryr1
Name: ryanodine receptor 1, skeletal muscle
Synonyms: calcium release channel isoform 1, Ryr, skrr
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 7
NCBI: 20190
Homologene: 68069
Lama2
Name: laminin, alpha 2
Synonyms: merosin, mer
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 10
NCBI: 16773
HGNC: HGNC:6482
Homologene: 37306
Pcdhb4
Name: protocadherin beta 4
Synonyms: Pcdhb5A, PcdhbD
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 18
NCBI: 93875
HGNC: HGNC:8690
Homologene: 62176
Sis
Name: sucrase isomaltase
Synonyms: Si-s, sucrase-isomaltase, 2010204N08Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 3
NCBI: 69983
Homologene: 37424
Garin3
Name: golgi associated RAB2 interactor 3
Synonyms: OTTMUSG00000005491, Fam71b
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 11
NCBI: 432552
Homologene: 51067
Nalcn
Name: sodium leak channel, non-selective
Synonyms: A530023G15Rik, Vgcnl1
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 14
NCBI: 338370
VEGA: 14
Homologene: 21832
Lrrc7
Name: leucine rich repeat containing 7
Synonyms: densin
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 3
NCBI: 242274
Homologene: 10817
Fer1l4
Name: fer-1 like family member 4
Synonyms: 9130402C12Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 2
NCBI: 74562
Homologene: 19075
Entpd7
Name: ectonucleoside triphosphate diphosphohydrolase 7
Synonyms: LALP1, 2810003F23Rik, 1810020C02Rik, 1810012B13Rik, Lysal2
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 19
NCBI: 93685
Homologene: 122202
Syt16
Name: synaptotagmin XVI
Synonyms: syt14r, Strep14, Syt14l
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 12
NCBI: 238266
VEGA: 12
Homologene: 12902
Fam149a
Name: family with sequence similarity 149, member A
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 8
NCBI: 212326
Homologene: 27540
Cebpz
Name: CCAAT/enhancer binding protein zeta
Synonyms: Cbf, CBF2, Cebpa-rs1
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 17
NCBI: 12607
VEGA: 17
Homologene: 4210
Zfp518a
Name: zinc finger protein 518A
Synonyms: 6330417C12Rik, 2810401C22Rik, Zfp518
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 19
NCBI: 72672
VEGA: 19
Homologene: 19378
Eri2
Name: exoribonuclease 2
Synonyms: 4933424N09Rik, Exod1
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 7
NCBI: 71151
Homologene: 12383
Eme1
Name: essential meiotic structure-specific endonuclease 1
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 11
NCBI: 268465
Homologene: 16123
Nfe2l3
Name: nuclear factor, erythroid derived 2, like 3
Synonyms: Nrf3
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 6
NCBI: 18025
HGNC: HGNC:7783
Homologene: 3168
Med14
Name: mediator complex subunit 14
Synonyms: ORF1, LOC270579, 9930001L01Rik, Trap170, Crsp2, ENSMUSG00000073278
Type: Gene
Species: Mus musculus (mouse)
Chromosome: X
NCBI: 26896
HGNC: HGNC:2370
Homologene: 22082
Hoxc9
Name: homeobox C9
Synonyms: Hox-3.2
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 15
NCBI: 15427
HGNC: HGNC:5130
Homologene: 130558
Vmn1r70
Name: vomeronasal 1 receptor 70
Synonyms: V1rl1
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 7
NCBI: 171262
Homologene: 74361
Tmem132b
Name: transmembrane protein 132B
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 5
NCBI: 208151
Homologene: 28135
Vmn1r225
Name: vomeronasal 1 receptor 225
Synonyms: V1re5
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 17
NCBI: 171228
Gm11595
Name: predicted gene 11595
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 11
NCBI: 100040276
Homologene: 124486
Ctu1
Name: cytosolic thiouridylase subunit 1
Synonyms: Atpbd3
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 7
NCBI: 233189
Homologene: 102140
Setbp1
Name: SET binding protein 1
Synonyms: Seb
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 18
NCBI: 240427
Homologene: 9192
Ccdc113
Name: coiled-coil domain containing 113
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 8
NCBI: 244608
Homologene: 40927
Slc35f3
Name: solute carrier family 35, member F3
Synonyms: B230375D17Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 8
NCBI: 210027
Homologene: 62481
Or2d2b
Name: olfactory receptor family 2 subfamily D member 2B
Synonyms: EG384732, Gm10081, Olfr715b
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 7
NCBI: 384732
HGNC: HGNC:8244
Homologene: 81541
Armcx1
Name: armadillo repeat containing, X-linked 1
Synonyms: 3010033I09Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: X
NCBI: 78248
Homologene: 9589
Genetic Alterations
ENU-induced transitions at the following base pair locations (GRCm38):
  • C to A, chromosome 2 at 59,308,572 bp
  • C to A, chromosome 2 at 154,214,002 bp
  • C to T, chromosome 2 at 156,045,683 bp
  • A to T, chromosome 3 at 53,653,449 bp
  • A to T, chromosome 3 at 72,925,596 bp
  • A to T, chromosome 3 at 90,458,726 bp
  • T to C, chromosome 3 at 158,185,493 bp
  • A to T, chromosome 5 at 125,787,580 bp
  • G to T, chromosome 5 at 139,252,531 bp
  • A to T, chromosome 6 at 51,457,377 bp
  • T to A, chromosome 6 at 149,518,991 bp
  • A to G, chromosome 7 at 10,633,788 bp
  • C to T, chromosome 7 at 29,020,152 bp
  • T to C, chromosome 7 at 43,676,673 bp
  • A to G, chromosome 7 at 56,207,809 bp
  • A to T, chromosome 7 at 102,012,121 bp
  • A to G, chromosome 7 at 107,106,463 bp
  • A to T, chromosome 7 at 119,786,008 bp
  • T to A, chromosome 7 at 131,112,090 bp
  • C to T, chromosome 7 at 144,445,851 bp
  • T to C, chromosome 8 at 14,033,695 bp
  • T to A, chromosome 8 at 45,381,610 bp
  • A to T, chromosome 8 at 95,542,653 bp
  • A to T, chromosome 8 at 111,990,370 bp
  • T to A, chromosome 8 at 126,389,239 bp
  • A to G, chromosome 9 at 9,008,033 bp
  • GCCC to GCC, chromosome 10 at 27,190,665 bp
  • T to A, chromosome 11 at 30,856,027 bp
  • G to A, chromosome 11 at 46,404,953 bp
  • A to G, chromosome 11 at 94,650,592 bp
  • C to T, chromosome 11 at 99,772,554 bp
  • T to G, chromosome 11 at 107,495,765 bp
  • A to G, chromosome 12 at 74,229,398 bp
  • C to A, chromosome 13 at 24,831,793 bp
  • T to G, chromosome 13 at 63,524,959 bp
  • T to C, chromosome 14 at 25,645,649 bp
  • T to A, chromosome 14 at 123,278,187 bp
  • A to G, chromosome 15 at 102,981,684 bp
  • A to T, chromosome 16 at 32,616,826 bp
  • G to A, chromosome 17 at 20,502,852 bp
  • A to T, chromosome 17 at 26,203,500 bp
  • A to T, chromosome 17 at 78,935,418 bp
  • T to C, chromosome 18 at 37,309,314 bp
  • C to T, chromosome 18 at 78,783,322 bp
  • A to G, chromosome 19 at 40,914,797 bp
  • T to G, chromosome 19 at 43,725,540 bp
  • CCAGCAGCAGCAGCAGCAGCAGCAGC to CCAGCAGCAGCAGCAGCAGCAGCAGCAGC, chromosome 19 at 46,081,352 bp
  • CAG to CAGAAG, chromosome 19 at 46,081,359 bp
  • CAG to CAGAAG, chromosome 19 at 46,081,371 bp
  • T to C, chromosome X at 12,687,177 bp
  • T to C, chromosome X at 75,523,342 bp
  • T to C, chromosome X at 134,721,265 bp
Genotype Determination
Phenotype
G1 male heterozygous mice are viable and fertile. The G1 mice were not characterized prior to archiving.
Strain Development
C57BL/6J mice were injected with ENU, resulting in G0 mice that were bred back to C57BL/6J. Sperm was archived from G1 male mice that produced viable G2 mice.
Suggested Control Mice
Wild-type littermates or C57BL/6J mice
MMRRC Genetic QC Summary
The MMRRC Centers have developed a genetic QC pipeline using MiniMUGA array genotyping to provide additional information on strain backgrounds for MMRRC congenic and inbred strains. For more information on when data may be available, or to request genotyping for a strain of interest, please contact mmrrc@missouri.edu. Older strains may not have this information.
Donor
Bruce Beutler, M.D., University of Texas Southwestern Medical Center.
Primary Reference
MUTAGENETIX record for R3807 (G1). B. Beutler and colleagues, Center for the Genetics of Host Defense, UT Southwestern, Dallas, TX.

Colony and Husbandry Information

Colony Surveillance Program and Current Health Reports

Mice recovered from a cryo-archive will have health surveillance performed on recipient females. Health reports will be provided prior to shipment. If you require additional health status information, please email mmrrc@missouri.edu .
Coat Color
Black
MMRRC Breeding System
Random intra-strain mating
Breeding Scheme(s)
When maintaining a live colony, heterozygous mice may be bred together, bred with wild-type siblings, or bred with C57BL/6J inbred mice.
Overall Breeding Performance
Undetermined; during development, mating was done with heterozygous males; viability, fertility and other breeding statistics for heterozygous females and homozygotes are unverified, but presumably would be similar to the C57BL/6J background strain
Average litter size
Undetermined
Recommended wean age
3 weeks

Order Request Information

Limited quantities of breeder mice (recovered litter) are available from a cryoarchive; recovered litter usually available to ship in 3 to 4 months.

Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

Distribution of this strain requires submission of the MMRRC Conditions of Use (COU). A link to the COU web form will be provided via email after an order has been placed; the form should be completed then or the email forwarded to your institutional official for completion.

The donor or their institution limits the distribution to non-profit institutions only.

Additional charges may apply for any special requests. Shipping costs are in addition to the basic distribution/resuscitation fees. Information on shipping costs and any additional charges will be provided by the supplying MMRRC facility.

Click button to Request this one strain. (Use the MMRRC Catalog Search to request more than one strain.)
MMRRC Item # Description Distribution Fee / Unit (US $)
*Shipping & Handling not included*
Units Notes
040764-MU-RESUS Litter recovered from cryo-archive $5,475.00 / Non-Profit Litter Recovered litter4; additional fees for any special requests.
Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

Some MMRRC strains were submitted by the donor as cryopreserved germplasm, and because these strains were not cryopreserved by the MMRRC, we have not assessed the quality, nor genotype, of this material. Our expertise in reviving mice from various qualities of frozen sperm and embryos, using methods like IVF and ICSI, gives us confidence in successful recoveries in most cases. However, due to the uncertain quality of these samples, we'll limit revival attempts to two per order. Additional attempts are available for a fee, on top of standard charges, if requested. It's important to note that some strains may lack the expected mutation, so we can't assure successful order fulfillment until we attempt to revive the strain.

1 The distribution fee covers the expense of rederiving mice from a live mouse; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

2 An aliquot contains a sufficient number of embryos (in one or more vials or straws and based on the transfer success rate of the MMRRC facility) to transfer into one to three recipients. The MMRRC makes no guarantee concerning embryo transfer success experienced in the recipient investigator's laboratory. Neither gender nor genotype ratios are guaranteed.

3 An aliquot is one straw or vial with sufficient sperm to recover at least one litter of mice, as per provided protocols, when performed at the MMRRC facility. The MMRRC makes no guarantee concerning the success of these procedures when performed outside the MMRRC facilities.

4 The distribution fee covers the expense of resuscitating mice from the cryo-archive; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

To request material from the MMRRC: Please fill out our on-line request form (accessible from the catalog search results page, or click the Request this Strain button in the fees section). If you have questions or need assistance completing this form, you may call Customer Service at (800) 910-2291 (in USA or Canada) or (530) 757-5710 (international calls). Before you call, please have with you: the MMRRC item number, quantity needed, Bill-to and Ship-to contact information.