Strain Name:
C57BL/6J-MtgxR3927Btlr/Mmmh
Stock Number:
040822-MU
Citation ID:
RRID:MMRRC_040822-MU
Other Names:
R3927 (G1), C57BL/6J-MtgxR3927Btlr
Major Collection:

Strain Information

Epha2
Name: Eph receptor A2
Synonyms: Eck, Sek2, Myk2, Sek-2
Type: Gene
Species: Mouse
Chromosome: 4
NCBI: 13836
HGNC: HGNC:3386
Homologene: 20929
Ppp1r9a
Name: protein phosphatase 1, regulatory subunit 9A
Synonyms: NRB, neurabin-I, 2810430P21Rik, A230094E16Rik, Neurabin I, 4930518N04Rik
Type: Gene
Species: Mouse
Chromosome: 6
NCBI: 243725
Homologene: 14247
Helz
Name: helicase with zinc finger domain
Synonyms: 3110078M01Rik, 9630002H22Rik, 9430093I07Rik
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 78455
Homologene: 8918
Eif4b
Name: eukaryotic translation initiation factor 4B
Synonyms: 2310046H11Rik
Type: Gene
Species: Mouse
Chromosome: 15
NCBI: 75705
VEGA: 15
HGNC: HGNC:3285
Homologene: 83162
Xrn2
Name: 5'-3' exoribonuclease 2
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 24128
Homologene: 6927
Cog3
Name: component of oligomeric golgi complex 3
Type: Gene
Species: Mouse
Chromosome: 14
NCBI: 338337
VEGA: 14
Homologene: 5854
Sap130
Name: Sin3A associated protein
Synonyms: 2610304F09Rik
Type: Gene
Species: Mouse
Chromosome: 18
NCBI: 269003
VEGA: 18
Homologene: 11577
Slc33a1
Name: solute carrier family 33 (acetyl-CoA transporter), member 1
Synonyms: D630022N01Rik, Acatn
Type: Gene
Species: Mouse
Chromosome: 3
NCBI: 11416
HGNC: HGNC:95
Homologene: 3476
Zzef1
Name: zinc finger, ZZ-type with EF hand domain 1
Synonyms: 8430405D05Rik, C130099L13Rik
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 195018
Homologene: 9027
Zzz3
Name: zinc finger, ZZ domain containing 3
Synonyms: 6430567E01Rik, 3110065C23Rik
Type: Gene
Species: Mouse
Chromosome: 3
NCBI: 108946
Homologene: 9182
Ube3b
Name: ubiquitin protein ligase E3B
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 117146
Homologene: 13775
Tubb4a
Name: tubulin, beta 4A class IVA
Synonyms: Tubb, Tubb4
Type: Gene
Species: Mouse
Chromosome: 17
NCBI: 22153
VEGA: 17
Homologene: 55952
Bend5
Name: BEN domain containing 5
Synonyms: 2310026E23Rik
Type: Gene
Species: Mouse
Chromosome: 4
NCBI: 67621
Homologene: 41574
Avpr1a
Name: arginine vasopressin receptor 1A
Synonyms: V1aR
Type: Gene
Species: Mouse
Chromosome: 10
NCBI: 54140
HGNC: HGNC:895
Homologene: 568
Baz1a
Name: bromodomain adjacent to zinc finger domain 1A
Synonyms: Wcrf180, Acf1, Gtl5
Type: Gene
Species: Mouse
Chromosome: 12
NCBI: 217578
HGNC: HGNC:960
Homologene: 45654
Unkl
Name: unkempt family like zinc finger
Synonyms: 1300004G08Rik
Type: Gene
Species: Mouse
Chromosome: 17
NCBI: 74154
Homologene: 62673
Plxna2
Name: plexin A2
Synonyms: OCT, Plxn2, 2810428A13Rik, PlexA2
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 18845
HGNC: HGNC:9100
Homologene: 56427
Zfhx4
Name: zinc finger homeodomain 4
Synonyms: Zfh4, Zfh-4, C130041O22Rik
Type: Gene
Species: Mouse
Chromosome: 3
NCBI: 80892
Homologene: 23477
Fig4
Name: FIG4 phosphoinositide 5-phosphatase
Synonyms: A530089I17Rik
Type: Gene
Species: Mouse
Chromosome: 10
NCBI: 103199
VEGA: 10
Homologene: 6713
Ryr3
Name: ryanodine receptor 3
Synonyms: calcium release channel isoform 3
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 20192
Homologene: 68151
Meis3
Name: Meis homeobox 3
Synonyms: Mrg2
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 17537
Homologene: 7425
Hal
Name: histidine ammonia lyase
Synonyms: histidase, Hsd
Type: Gene
Species: Mouse
Chromosome: 10
NCBI: 15109
HGNC: HGNC:4806
Homologene: 68229
Clstn3
Name: calsyntenin 3
Synonyms: Cst-3, alcadein-beta, CSTN3, Clstn3b
Type: Gene
Species: Mouse
Chromosome: 6
NCBI: 232370
Homologene: 22836
Tmc5
Name: transmembrane channel-like gene family 5
Synonyms: 4932443L08Rik
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 74424
Homologene: 11713
Plekhh1
Name: pleckstrin homology domain containing, family H (with MyTH4 domain) member 1
Synonyms: D630024D12Rik
Type: Gene
Species: Mouse
Chromosome: 12
NCBI: 211945
VEGA: 12
Homologene: 121939
Nod1
Name: nucleotide-binding oligomerization domain containing 1
Synonyms: Card4, Nlrc1, F830007N14Rik
Type: Gene
Species: Mouse
Chromosome: 6
NCBI: 107607
Homologene: 4440
Cyp2j6
Name: cytochrome P450, family 2, subfamily j, polypeptide 6
Type: Gene
Species: Mouse
Chromosome: 4
NCBI: 13110
HGNC: HGNC:2634
Homologene: 68091
Abtb2
Name: ankyrin repeat and BTB domain containing 2
Synonyms: BPOZ-2
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 99382
Homologene: 15904
Axdnd1
Name: axonemal dynein light chain domain containing 1
Synonyms: LOC381304, 9430070O13Rik
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 77352
Homologene: 52328
Tmem217
Name: transmembrane protein 217
Synonyms: EG622644, 4933413N12Rik
Type: Gene
Species: Mouse
Chromosome: 17
NCBI: 71138
VEGA: 17
Homologene: 51671
Ufsp2
Name: UFM1-specific peptidase 2
Synonyms: 1810047C23Rik
Type: Gene
Species: Mouse
Chromosome: 8
NCBI: 192169
Homologene: 10151
Or6n2
Name: olfactory receptor family 6 subfamily N member 2
Synonyms: Olfr430, MOR105-5P, GA_x6K02T2P20D-21108443-21107490
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 258713
Homologene: 17362
Alpk1
Name: alpha-kinase 1
Synonyms: 8430410J10Rik
Type: Gene
Species: Mouse
Chromosome: 3
NCBI: 71481
Homologene: 11849
Slc37a2
Name: solute carrier family 37 (glycerol-3-phosphate transporter), member 2
Synonyms: Slc37a1, cI-2, G3PP, ci2
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 56857
Homologene: 41357
Smr2
Name: submaxillary gland androgen regulated protein 2
Synonyms: MSG2
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 20600
Pacsin3
Name: protein kinase C and casein kinase substrate in neurons 3
Synonyms: 6330413E15Rik, 4921507A02Rik
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 80708
HGNC: HGNC:8572
Homologene: 41117
Ubqln5
Name: ubiquilin 5
Synonyms: 4931431F19Rik
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 70980
Homologene: 78030
Spinkl
Name: serine protease inhibitor, Kazal type-like
Synonyms: 9530002K18Rik
Type: Gene
Species: Mouse
Chromosome: 18
NCBI: 77424
VEGA: 18
Homologene: 128818
Genetic Alterations
ENU-induced transitions at the following base pair locations (GRCm38):
  • A to G, chromosome 1 at 156,419,270 bp
  • A to T, chromosome 1 at 174,069,312 bp
  • G to A, chromosome 1 at 194,746,157 bp
  • C to T, chromosome 2 at 91,262,941 bp
  • A to G, chromosome 2 at 103,708,218 bp
  • C to G, chromosome 2 at 112,675,873 bp
  • T to A, chromosome 2 at 147,038,189 bp
  • C to T, chromosome 3 at 5,403,358 bp
  • A to G, chromosome 3 at 63,963,724 bp
  • T to C, chromosome 3 at 127,677,716 bp
  • T to C, chromosome 3 at 152,455,862 bp
  • T to C, chromosome 4 at 96,553,288 bp
  • A to G, chromosome 4 at 111,448,605 bp
  • T to C, chromosome 4 at 141,306,550 bp
  • T to A, chromosome 5 at 88,088,259 bp
  • T to C, chromosome 5 at 114,415,680 bp
  • A to G, chromosome 6 at 5,057,531 bp
  • G to T, chromosome 6 at 54,944,917 bp
  • T to C, chromosome 6 at 124,451,368 bp
  • A to G, chromosome 7 at 16,177,494 bp
  • A to G, chromosome 7 at 104,128,471 bp
  • T to A, chromosome 7 at 118,652,655 bp
  • T to A, chromosome 8 at 45,983,686 bp
  • G to A, chromosome 9 at 37,235,507 bp
  • GATTTATTTATTTATTTATTTATTTATTTATTTATTTATT to GATTTATTTATTTATTTATTTATTTATTTATTTATTTATTTATT, chromosome 9 at 88,582,989 bp
  • A to G, chromosome 10 at 41,263,139 bp
  • T to C, chromosome 10 at 93,514,026 bp
  • A to G, chromosome 10 at 122,449,711 bp
  • T to C, chromosome 11 at 72,858,382 bp
  • A to G, chromosome 11 at 107,685,292 bp
  • A to G, chromosome 12 at 54,921,143 bp
  • T to A, chromosome 12 at 79,053,648 bp
  • A to G, chromosome 14 at 75,743,558 bp
  • G to A, chromosome 15 at 102,084,310 bp
  • C to T, chromosome 17 at 25,229,329 bp
  • A to G, chromosome 17 at 29,526,703 bp
  • A to G, chromosome 17 at 57,080,967 bp
  • A to T, chromosome 18 at 31,674,382 bp
  • T to A, chromosome 18 at 44,169,163 bp
Genotype Determination
Phenotype
G1 male heterozygous mice are viable and fertile. The G1 mice were not characterized prior to archiving.
Strain Development
C57BL/6J mice were injected with ENU, resulting in G0 mice that were bred back to C57BL/6J. Sperm was archived from G1 male mice that produced viable G2 mice.
Suggested Control Mice
Wild-type littermates or C57BL/6J mice
MMRRC Genetic QC Summary
The MMRRC Centers have developed a genetic QC pipeline using MiniMUGA array genotyping to provide additional information on strain backgrounds for MMRRC congenic and inbred strains. For more information on when data may be available, or to request genotyping for a strain of interest, please contact mmrrc@missouri.edu. Older strains may not have this information.
Donor
Bruce Beutler, M.D., University of Texas Southwestern Medical Center.
Primary Reference
MUTAGENETIX record for R3927 (G1). B. Beutler and colleagues, Center for the Genetics of Host Defense, UT Southwestern, Dallas, TX.

Colony and Husbandry Information

Colony Surveillance Program and Current Health Reports

Mice recovered from a cryo-archive will have health surveillance performed on recipient females. Health reports will be provided prior to shipment. If you require additional health status information, please email mmrrc@missouri.edu.
Coat Color
Black
MMRRC Breeding System
Random intra-strain mating
Breeding Scheme(s)
When maintaining a live colony, heterozygous mice may be bred together, bred with wild-type siblings, or bred with C57BL/6J inbred mice.
Overall Breeding Performance
Undetermined; during development, mating was done with heterozygous males; viability, fertility and other breeding statistics for heterozygous females and homozygotes are unverified, but presumably would be similar to the C57BL/6J background strain
Average litter size
Undetermined
Recommended wean age
3 weeks

Order Request Information

Limited quantities of breeder mice (recovered litter) are available from a cryoarchive; recovered litter usually available to ship in 3 to 4 months.

Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

Distribution of this strain requires submission of the MMRRC Conditions of Use (COU). A link to the COU web form will be provided via email after an order has been placed; the form should be completed then or the email forwarded to your institutional official for completion.

The donor or their institution limits the distribution to non-profit institutions only.

Additional charges may apply for any special requests. Shipping costs are in addition to the basic distribution/resuscitation fees. Information on shipping costs and any additional charges will be provided by the supplying MMRRC facility.

Click button to Request this one strain. (Use the MMRRC Catalog Search to request more than one strain.)
MMRRC Item # Description Distribution Fee / Unit (US $)
*Shipping & Handling not included*
Units Notes
040822-MU-RESUS Litter recovered from cryo-archive $5,475.00 / Non-Profit Litter Recovered litter4; additional fees for any special requests.
Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

Some MMRRC strains were submitted by the donor as cryopreserved germplasm, and because these strains were not cryopreserved by the MMRRC, we have not assessed the quality, nor genotype, of this material. Our expertise in reviving mice from various qualities of frozen sperm and embryos, using methods like IVF and ICSI, gives us confidence in successful recoveries in most cases. However, due to the uncertain quality of these samples, we'll limit revival attempts to two per order. Additional attempts are available for a fee, on top of standard charges, if requested. It's important to note that some strains may lack the expected mutation, so we can't assure successful order fulfillment until we attempt to revive the strain.

1 The distribution fee covers the expense of rederiving mice from a live mouse; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

2 An aliquot contains a sufficient number of embryos (in one or more vials or straws and based on the transfer success rate of the MMRRC facility) to transfer into one to three recipients. The MMRRC makes no guarantee concerning embryo transfer success experienced in the recipient investigator's laboratory. Neither gender nor genotype ratios are guaranteed.

3 An aliquot is one straw or vial with sufficient sperm to recover at least one litter of mice, as per provided protocols, when performed at the MMRRC facility. The MMRRC makes no guarantee concerning the success of these procedures when performed outside the MMRRC facilities.

4 The distribution fee covers the expense of resuscitating mice from the cryo-archive; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

To request material from the MMRRC: Please fill out our on-line request form (accessible from the catalog search results page, or click the Request this Strain button in the fees section). If you have questions or need assistance completing this form, you may call Customer Service at (800) 910-2291 (in USA or Canada) or (530) 757-5710 (international calls). Before you call, please have with you: the MMRRC item number, quantity needed, Bill-to and Ship-to contact information.