Loading Mouse GIF
Loading...

Strain Name:
C57BL/6J-MtgxR3962Btlr/Mmmh
Stock Number:
040837-MU
Citation ID:
RRID:MMRRC_040837-MU
Other Names:
R3962 (G1), C57BL/6J-MtgxR3962Btlr
Major Collection:

Strain Information

Ltbp3
Name: latent transforming growth factor beta binding protein 3
Synonyms: Ltbp2
Type: Gene
Species: Mouse
Chromosome: 19
NCBI: 16998
VEGA: 19
HGNC: HGNC:6716
Homologene: 7405
Abca12
Name: ATP-binding cassette, sub-family A member 12
Synonyms: 4832428G11Rik, 4833417A11Rik
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 74591
Homologene: 45441
Ptpa
Name: protein phosphatase 2 protein activator
Synonyms: 2610042B21Rik, Ppp2r4
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 110854
HGNC: HGNC:9308
Homologene: 6149
Tlr6
Name: toll-like receptor 6
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 21899
Homologene: 21223
Usp32
Name: ubiquitin specific peptidase 32
Synonyms: 6430526O11Rik, 2900074J03Rik
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 237898
Homologene: 13066
Srsf3
Name: serine and arginine-rich splicing factor 3
Synonyms: X16, Sfrs3
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 17
NCBI: 20383
Homologene: 55708
Tars2
Name: threonyl-tRNA synthetase 2, mitochondrial (putative)
Synonyms: 2610024N01Rik, Tarsl1
Type: Gene
Species: Mouse
Chromosome: 3
NCBI: 71807
Homologene: 23520
Larp4
Name: La ribonucleoprotein 4
Synonyms: D330037H05Rik
Type: Gene
Species: Mouse
Chromosome: 15
NCBI: 207214
VEGA: 15
Homologene: 19173
Fbxo15
Name: F-box protein 15
Synonyms: Fbx15, ecat3
Type: Gene
Species: Mouse
Chromosome: 18
NCBI: 50764
VEGA: 18
Homologene: 17644
Ppp1r8
Name: protein phosphatase 1, regulatory subunit 8
Synonyms: 6330548N22Rik, NIPP1
Type: Gene
Species: Mouse
Chromosome: 4
NCBI: 100336
HGNC: HGNC:9296
Homologene: 8555
Ccdc15
Name: coiled-coil domain containing 15
Synonyms: A630039F14Rik
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 245902
VEGA: 9
Homologene: 28448
Minar1
Name: membrane integral NOTCH2 associated receptor 1
Synonyms: DD1, AF529169
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 209743
Homologene: 17782
Rfx2
Name: regulatory factor X, 2 (influences HLA class II expression)
Synonyms: 5430432H19Rik
Type: Gene
Species: Mouse
Chromosome: 17
NCBI: 19725
VEGA: 17
HGNC: HGNC:9983
Homologene: 30980
Bod1l
Name: biorientation of chromosomes in cell division 1-like
Synonyms: A230054D04Rik
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 665775
Homologene: 45109
Ubr3
Name: ubiquitin protein ligase E3 component n-recognin 3
Synonyms: 4833421P10Rik, A130030D10Rik, 1110059H15Rik, Zfp650
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 68795
Homologene: 52092
Cdcp1
Name: CUB domain containing protein 1
Synonyms: 9030022E12Rik, E030027H19Rik
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 109332
Homologene: 11276
Paxbp1
Name: PAX3 and PAX7 binding protein 1
Synonyms: 1810007M14Rik, Pax3/7bp, Gcfc1
Type: Gene
Species: Mouse
Chromosome: 16
NCBI: 67367
Homologene: 9604
L1td1
Name: LINE-1 type transposase domain containing 1
Synonyms: ECAT11
Type: Gene
Species: Mouse
Chromosome: 4
NCBI: 381591
Homologene: 135709
B3gnt5
Name: UDP-GlcNAc:betaGal beta-1,3-N-acetylglucosaminyltransferase 5
Type: Gene
Species: Mouse
Chromosome: 16
NCBI: 108105
Homologene: 24989
Tomm20l
Name: translocase of outer mitochondrial membrane 20-like
Synonyms: 4930553D19Rik
Type: Gene
Species: Mouse
Chromosome: 12
NCBI: 75266
VEGA: 12
Homologene: 52617
Tsc2
Name: TSC complex subunit 2
Synonyms: tuberin, Nafld, tuberous sclerosis 2
Type: Gene
Species: Mouse
Chromosome: 17
NCBI: 22084
VEGA: 17
Homologene: 462
Itga2
Name: integrin alpha 2
Synonyms: VLA-2 receptor, alpha 2 subunit, CD49B, DX5
Type: Gene
Species: Mouse
Chromosome: 13
NCBI: 16398
VEGA: 13
HGNC: HGNC:6137
Homologene: 1662
Usp2
Name: ubiquitin specific peptidase 2
Synonyms: ubp41, B930035K21Rik
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 53376
Homologene: 3098
Spmip5
Name: sperm microtubule inner protein 5
Synonyms: 1700019N19Rik
Type: Gene
Species: Mouse
Chromosome: 19
NCBI: 67507
Homologene: 12147
Itga9
Name: integrin alpha 9
Synonyms: 2610002H11Rik, D9Ertd428e, 6720458D17Rik
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 104099
HGNC: HGNC:6145
Homologene: 1664
Slc4a3
Name: solute carrier family 4 (anion exchanger), member 3
Synonyms: Ae3, A930038D23Rik
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 20536
Homologene: 129474
Klk1
Name: kallikrein 1
Synonyms: mGk-6, 0610007D04Rik, Klk6
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 16612
Homologene: 68141
Wnk2
Name: WNK lysine deficient protein kinase 2
Synonyms: ESTM15, 1810073P09Rik, X83337
Type: Gene
Species: Mouse
Chromosome: 13
NCBI: 75607
Homologene: 19155
Hrg
Name: histidine-rich glycoprotein
Synonyms: D16JH2, D18020
Type: Gene
Species: Mouse
Chromosome: 16
NCBI: 94175
HGNC: HGNC:5181
Homologene: 137650
Kif21a
Name: kinesin family member 21A
Synonyms: N-5 kinesin
Type: Gene
Species: Mouse
Chromosome: 15
NCBI: 16564
VEGA: 15
Homologene: 56761
Glmn
Name: glomulin, FKBP associated protein
Synonyms: Fap68, Fap48, 9330160J16Rik
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 170823
Homologene: 14239
Moxd2
Name: monooxygenase, DBH-like 2
Synonyms: Dbhl1
Type: Gene
Species: Mouse
Chromosome: 6
NCBI: 194357
Homologene: 77226
Gm5828
Name: predicted gene 5828
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 1
NCBI: 545306
Oasl2
Name: 2'-5' oligoadenylate synthetase-like 2
Synonyms: M1204, Mmu-OASL
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 23962
Homologene: 128369
Ercc2
Name: excision repair cross-complementing rodent repair deficiency, complementation group 2
Synonyms: XPD, Ercc-2, RCO015, Mhdarco15
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 13871
HGNC: HGNC:3434
Homologene: 344
Galk2
Name: galactokinase 2
Synonyms: Gk2, 2810017M24Rik
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 69976
HGNC: HGNC:4119
Homologene: 13654
Ptdss1
Name: phosphatidylserine synthase 1
Synonyms: PtdSer Synthase-1, PSS-1
Type: Gene
Species: Mouse
Chromosome: 13
NCBI: 19210
VEGA: 13
HGNC: HGNC:9587
Homologene: 7494
Shisa6
Name: shisa family member 6
Synonyms: LOC380702, Gm879, CKAMP52
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 380702
Homologene: 66164
V1ra8
Name: vomeronasal 1 receptor, A8
Synonyms: Vmn1r-ps33
Type: Gene
Species: Mouse
Chromosome: 6
NCBI: 113850
Tfap2d
Name: transcription factor AP-2, delta
Synonyms: Tcfap2d
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 226896
Homologene: 17700
Haus6
Name: HAUS augmin-like complex, subunit 6
Synonyms: D4Ertd27e, 6230416J20Rik
Type: Gene
Species: Mouse
Chromosome: 4
NCBI: 230376
Homologene: 9760
9930111J21Rik1
Name: RIKEN cDNA 9930111J21 gene 1
Synonyms: 9930111J21Rik
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 667214
Homologene: 83188
Fam161a
Name: family with sequence similarity 161, member A
Synonyms: 4930430E16Rik
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 73873
Homologene: 19131
Or6c207
Name: olfactory receptor family 6 subfamily C member 207
Synonyms: GA_x6K02T2PULF-10955551-10954616, MOR114-9, Olfr777
Type: Gene
Species: Mouse
Chromosome: 10
NCBI: 258537
Homologene: 27203
Hmgcs2
Name: 3-hydroxy-3-methylglutaryl-Coenzyme A synthase 2
Synonyms: mHS
Type: Gene
Species: Mouse
Chromosome: 3
NCBI: 15360
HGNC: HGNC:5008
Homologene: 38066
Fndc5
Name: fibronectin type III domain containing 5
Synonyms: PeP, 1500001L03Rik, Pxp
Type: Gene
Species: Mouse
Chromosome: 4
NCBI: 384061
Homologene: 17812
Taar8a
Name: trace amine-associated receptor 8A
Synonyms: LOC215859
Type: Gene
Species: Mouse
Chromosome: 10
NCBI: 215859
Homologene: 77586
Platr26
Name: pluripotency associated transcript 26
Synonyms: LOC381371, Gm1631
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 2
NCBI: 381371
Gm5082
Name: predicted gene 5082
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 13
VEGA: 13
Genetic Alterations
ENU-induced transitions at the following base pair locations (GRCm38):
  • C to T, chromosome 1 at 16,768,644 bp
  • A to G, chromosome 1 at 19,118,965 bp
  • A to T, chromosome 1 at 71,274,515 bp
  • A to G, chromosome 1 at 75,556,754 bp
  • A to G, chromosome 2 at 30,435,660 bp
  • GTCATTCATTCATTCATTCATTCATT to GTCATTCATTCATTCATTCATTCATTCATT, chromosome 2 at 69,971,021 bp
  • A to T, chromosome 2 at 71,719,505 bp
  • A to T, chromosome 2 at 125,893,373 bp
  • A to G, chromosome 3 at 95,754,756 bp
  • G to A, chromosome 3 at 98,291,038 bp
  • C to T, chromosome 4 at 86,611,804 bp
  • T to C, chromosome 4 at 98,737,449 bp
  • T to C, chromosome 4 at 129,139,895 bp
  • C to A, chromosome 4 at 132,834,628 bp
  • C to T, chromosome 5 at 35,812,175 bp
  • T to G, chromosome 5 at 41,808,721 bp
  • T to A, chromosome 5 at 64,954,985 bp
  • A to T, chromosome 5 at 107,561,045 bp
  • A to G, chromosome 5 at 114,897,747 bp
  • T to A, chromosome 6 at 40,885,397 bp
  • A to G, chromosome 6 at 90,203,484 bp
  • T to C, chromosome 7 at 19,394,342 bp
  • C to A, chromosome 7 at 28,898,222 bp
  • A to G, chromosome 7 at 44,229,549 bp
  • G to T, chromosome 9 at 37,320,486 bp
  • A to G, chromosome 9 at 44,075,657 bp
  • G to A, chromosome 9 at 89,601,910 bp
  • G to A, chromosome 9 at 118,628,186 bp
  • T to C, chromosome 9 at 123,182,381 bp
  • A to G, chromosome 10 at 24,077,156 bp
  • A to T, chromosome 10 at 129,268,666 bp
  • T to C, chromosome 11 at 23,023,507 bp
  • T to C, chromosome 11 at 48,947,976 bp
  • G to A, chromosome 11 at 60,479,828 bp
  • A to G, chromosome 11 at 66,217,476 bp
  • A to T, chromosome 11 at 85,022,317 bp
  • T to C, chromosome 12 at 71,117,578 bp
  • T to C, chromosome 13 at 41,656,418 bp
  • C to A, chromosome 13 at 49,070,977 bp
  • A to G, chromosome 13 at 66,994,011 bp
  • A to T, chromosome 13 at 114,839,518 bp
  • T to A, chromosome 15 at 90,985,409 bp
  • C to A, chromosome 15 at 100,012,145 bp
  • A to G, chromosome 16 at 19,769,048 bp
  • G to A, chromosome 16 at 22,956,075 bp
  • T to C, chromosome 16 at 91,025,709 bp
  • G to A, chromosome 17 at 24,621,166 bp
  • C to T, chromosome 17 at 29,036,456 bp
  • T to C, chromosome 17 at 56,785,302 bp
  • A to G, chromosome 18 at 84,959,247 bp
  • G to A, chromosome 19 at 5,754,022 bp
  • T to C, chromosome 19 at 7,458,145 bp
  • A to G, chromosome 19 at 58,789,109 bp
Genotype Determination
Phenotype
G1 male heterozygous mice are viable and fertile. The G1 mice were not characterized prior to archiving.
Strain Development
C57BL/6J mice were injected with ENU, resulting in G0 mice that were bred back to C57BL/6J. Sperm was archived from G1 male mice that produced viable G2 mice.
Suggested Control Mice
Wild-type littermates or C57BL/6J mice
MMRRC Genetic QC Summary
The MMRRC Centers have developed a genetic QC pipeline using MiniMUGA array genotyping to provide additional information on strain backgrounds for MMRRC congenic and inbred strains. For more information on when data may be available, or to request genotyping for a strain of interest, please contact mmrrc@missouri.edu. Older strains may not have this information.
Donor
Bruce Beutler, M.D., University of Texas Southwestern Medical Center.
Primary Reference
MUTAGENETIX record for R3962 (G1). B. Beutler and colleagues, Center for the Genetics of Host Defense, UT Southwestern, Dallas, TX.

Colony and Husbandry Information

Colony Surveillance Program and Current Health Reports

Mice recovered from a cryo-archive will have health surveillance performed on recipient females. Health reports will be provided prior to shipment. If you require additional health status information, please email mmrrc@missouri.edu.
Coat Color
Black
MMRRC Breeding System
Random intra-strain mating
Breeding Scheme(s)
When maintaining a live colony, heterozygous mice may be bred together, bred with wild-type siblings, or bred with C57BL/6J inbred mice.
Overall Breeding Performance
Undetermined; during development, mating was done with heterozygous males; viability, fertility and other breeding statistics for heterozygous females and homozygotes are unverified, but presumably would be similar to the C57BL/6J background strain
Average litter size
Undetermined
Recommended wean age
3 weeks

Order Request Information

Limited quantities of breeder mice (recovered litter) are available from a cryoarchive; recovered litter usually available to ship in 3 to 4 months.

Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

Distribution of this strain requires submission of the MMRRC Conditions of Use (COU). A link to the COU web form will be provided via email after an order has been placed; the form should be completed then or the email forwarded to your institutional official for completion.

The donor or their institution limits the distribution to non-profit institutions only.

Additional charges may apply for any special requests. Shipping costs are in addition to the basic distribution/resuscitation fees. Information on shipping costs and any additional charges will be provided by the supplying MMRRC facility.

Click button to Request this one strain. (Use the MMRRC Catalog Search to request more than one strain.)
MMRRC Item # Description Distribution Fee / Unit (US $)
*Shipping & Handling not included*
Units Notes
040837-MU-RESUS Litter recovered from cryo-archive $5,475.00 / Non-Profit Litter Recovered litter4; additional fees for any special requests.
Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

Some MMRRC strains were submitted by the donor as cryopreserved germplasm, and because these strains were not cryopreserved by the MMRRC, we have not assessed the quality, nor genotype, of this material. Our expertise in reviving mice from various qualities of frozen sperm and embryos, using methods like IVF and ICSI, gives us confidence in successful recoveries in most cases. However, due to the uncertain quality of these samples, we'll limit revival attempts to two per order. Additional attempts are available for a fee, on top of standard charges, if requested. It's important to note that some strains may lack the expected mutation, so we can't assure successful order fulfillment until we attempt to revive the strain.

1 The distribution fee covers the expense of rederiving mice from a live mouse; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

2 An aliquot contains a sufficient number of embryos (in one or more vials or straws and based on the transfer success rate of the MMRRC facility) to transfer into one to three recipients. The MMRRC makes no guarantee concerning embryo transfer success experienced in the recipient investigator's laboratory. Neither gender nor genotype ratios are guaranteed.

3 An aliquot is one straw or vial with sufficient sperm to recover at least one litter of mice, as per provided protocols, when performed at the MMRRC facility. The MMRRC makes no guarantee concerning the success of these procedures when performed outside the MMRRC facilities.

4 The distribution fee covers the expense of resuscitating mice from the cryo-archive; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

To request material from the MMRRC: Please fill out our on-line request form (accessible from the catalog search results page, or click the Request this Strain button in the fees section). If you have questions or need assistance completing this form, you may call Customer Service at (800) 910-2291 (in USA or Canada) or (530) 757-5710 (international calls). Before you call, please have with you: the MMRRC item number, quantity needed, Bill-to and Ship-to contact information.