Strain Name:
C57BL/6J-MtgxR4061Btlr/Mmmh
Stock Number:
040852-MU
Citation ID:
RRID:MMRRC_040852-MU
Other Names:
R4061 (G1), C57BL/6J-MtgxR4061Btlr
Major Collection:

Gene Information

Thbs4
Name: thrombospondin 4
Synonyms: TSP4, TSP-4
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 13
Alteration at locus: Chemically Induced
NCBI: 21828
Homologene: 20691
Cdc5l
Name: cell division cycle 5-like (S. pombe)
Synonyms: PCDC5RP, 1200002I02Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 17
Alteration at locus: Chemically Induced
NCBI: 71702
VEGA: 17
HGNC: HGNC:1743
Homologene: 13291
Sbno1
Name: strawberry notch 1
Synonyms: sno, 9330180L10Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 5
Alteration at locus: Chemically Induced
NCBI: 243272
Homologene: 10055
Hnrnpll
Name: heterogeneous nuclear ribonucleoprotein L-like
Synonyms: Hnrpll, 2510028H02Rik, 2810036L13Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 17
Alteration at locus: Chemically Induced
NCBI: 72692
Homologene: 26701
Slx4ip
Name: SLX4 interacting protein
Synonyms: 2410004I22Rik, 2210009G21Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 2
Alteration at locus: Chemically Induced
NCBI: 74243
Homologene: 49913
Gm14443
Name: predicted gene 14443
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 2
Alteration at locus: Chemically Induced
Iars2
Name: isoleucine-tRNA synthetase 2, mitochondrial
Synonyms: 2010002H18Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 1
Alteration at locus: Chemically Induced
NCBI: 381314
Homologene: 7118
Impdh2
Name: inosine monophosphate dehydrogenase 2
Synonyms: IMP dehydrogenase type II
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 9
Alteration at locus: Chemically Induced
NCBI: 23918
HGNC: HGNC:6053
Homologene: 48919
Tcp1
Name: t-complex protein 1
Synonyms: Cct1, Tcp-1, Ccta, p63, c-cpn, TRic, Tp63, CCT
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 17
Alteration at locus: Chemically Induced
NCBI: 21454
Homologene: 5656
Fat1
Name: FAT atypical cadherin 1
Synonyms: mFat1, 2310038E12Rik, Fath
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 8
Alteration at locus: Chemically Induced
NCBI: 14107
HGNC: HGNC:3595
Homologene: 66302
Tln1
Name: talin 1
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 4
Alteration at locus: Chemically Induced
NCBI: 21894
Homologene: 21267
Cab39l
Name: calcium binding protein 39-like
Synonyms: 1500031K13Rik, MO2L, 4930520C08Rik, 2810425O13Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 14
Alteration at locus: Chemically Induced
NCBI: 69008
VEGA: 14
Homologene: 69422
AU040320
Name: expressed sequence AU040320
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 4
Alteration at locus: Chemically Induced
NCBI: 100317
Homologene: 11764
Deptor
Name: DEP domain containing MTOR-interacting protein
Synonyms: Depdc6, 9130412E02Rik, D15Ertd336e, D15Ertd597e, 4731402B04Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 15
Alteration at locus: Chemically Induced
NCBI: 97998
Homologene: 32551
Csmd1
Name: CUB and Sushi multiple domains 1
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 8
Alteration at locus: Chemically Induced
NCBI: 94109
Homologene: 69536
Esyt3
Name: extended synaptotagmin-like protein 3
Synonyms: D9Ertd280e, Fam62c
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 9
Alteration at locus: Chemically Induced
NCBI: 272636
Homologene: 18626
Plagl1
Name: pleiomorphic adenoma gene-like 1
Synonyms: Zac1
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 10
Alteration at locus: Chemically Induced
NCBI: 22634
HGNC: HGNC:9046
Homologene: 31401
Muc5ac
Name: mucin 5, subtypes A and C, tracheobronchial/gastric
Synonyms: MGM, 2210005L13Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 7
Alteration at locus: Chemically Induced
NCBI: 17833
HGNC: HGNC:7515
Homologene: 137237
Pclo
Name: piccolo (presynaptic cytomatrix protein)
Synonyms: Acz, Pico
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 5
Alteration at locus: Chemically Induced
NCBI: 26875
Homologene: 69111
Myh13
Name: myosin, heavy polypeptide 13, skeletal muscle
Synonyms: MyHC-eo, extraocular myosin, EO Myosin
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 11
Alteration at locus: Chemically Induced
NCBI: 544791
HGNC: HGNC:7571
Homologene: 55780
Ctss
Name: cathepsin S
Synonyms: Cat S
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 3
Alteration at locus: Chemically Induced
NCBI: 13040
HGNC: HGNC:2545
Homologene: 20867
Obscn
Name: obscurin, cytoskeletal calmodulin and titin-interacting RhoGEF
Synonyms: LOC380698, OTTMUSG00000005786
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 11
Alteration at locus: Chemically Induced
NCBI: 380698
Homologene: 70869
Mast3
Name: microtubule associated serine/threonine kinase 3
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 8
Alteration at locus: Chemically Induced
NCBI: 546071
Homologene: 66191
Adam25
Name: a disintegrin and metallopeptidase domain 25 (testase 2)
Synonyms: testase 2
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 8
Alteration at locus: Chemically Induced
NCBI: 23793
HGNC: HGNC:199
Homologene: 128364
Vmn2r84
Name: vomeronasal 2, receptor 84
Synonyms: EG625068
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 10
Alteration at locus: Chemically Induced
NCBI: 625068
Homologene: 129606
Folh1
Name: folate hydrolase 1
Synonyms: prostate-specific membrane antigen, mopsm, glutamate carboxypeptidase II, GCP2
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 7
Alteration at locus: Chemically Induced
NCBI: 53320
HGNC: HGNC:3788
Homologene: 55826
Lmln
Name: leishmanolysin-like (metallopeptidase M8 family)
Synonyms: 5330415H22Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 16
Alteration at locus: Chemically Induced
NCBI: 239833
Homologene: 13198
Nfasc
Name: neurofascin
Synonyms: D430023G06Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 1
Alteration at locus: Chemically Induced
NCBI: 269116
Homologene: 24945
Olfr658
Name: olfactory receptor 658
Synonyms: GA_x6K02T2PBJ9-7273558-7272587, MOR34-5
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 7
Alteration at locus: Chemically Induced
NCBI: 259051
Homologene: 105161
Tec
Name: tec protein tyrosine kinase
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 5
Alteration at locus: Chemically Induced
NCBI: 21682
Homologene: 1302
Lrrc38
Name: leucine rich repeat containing 38
Synonyms: A230053A07Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 4
Alteration at locus: Chemically Induced
NCBI: 242735
Homologene: 77949
Spata18
Name: spermatogenesis associated 18
Synonyms: 1700067I02Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 5
Alteration at locus: Chemically Induced
NCBI: 73472
Homologene: 17057
Krt12
Name: keratin 12
Synonyms: Krt1-12, K12
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 11
Alteration at locus: Chemically Induced
NCBI: 268482
HGNC: HGNC:6414
Homologene: 188
Uap1
Name: UDP-N-acetylglucosamine pyrophosphorylase 1
Synonyms: ESTM38, SPAG2, AgX, AGX1
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 1
Alteration at locus: Chemically Induced
NCBI: 107652
Homologene: 2342
Vmn2r12
Name: vomeronasal 2, receptor 12
Synonyms: Gm6769
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 5
Alteration at locus: Chemically Induced
NCBI: 627569
Homologene: 129606
Otop2
Name: otopetrin 2
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 11
Alteration at locus: Chemically Induced
NCBI: 237987
Homologene: 27803
Vmn1r38
Name: vomeronasal 1 receptor 38
Synonyms: V1rc13
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 6
Alteration at locus: Chemically Induced
NCBI: 171186
Homologene: 110800
Olfr1086
Name: olfactory receptor 1086
Synonyms: GA_x6K02T2Q125-48168771-48167839, MOR179-2
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 2
Alteration at locus: Chemically Induced
NCBI: 258585
Homologene: 73975
Usp21
Name: ubiquitin specific peptidase 21
Synonyms: W53272, Usp16, ESTM28, Usp23
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 1
Alteration at locus: Chemically Induced
NCBI: 30941
Homologene: 56572
Il18r1
Name: interleukin 18 receptor 1
Synonyms: Il1rrp, Il18ralpha
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 1
Alteration at locus: Chemically Induced
NCBI: 16182
HGNC: HGNC:5988
Homologene: 2861
Prl7a1
Name: prolactin family 7, subfamily a, member 1
Synonyms: PLP-G, PLP-E, Prlpe, Prlpg
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 13
Alteration at locus: Chemically Induced
NCBI: 19113
Homologene: 136279
Gtpbp2
Name: GTP binding protein 2
Synonyms: nmf205
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 17
Alteration at locus: Chemically Induced
NCBI: 56055
HGNC: HGNC:4670
Homologene: 10420
Anks1b
Name: ankyrin repeat and sterile alpha motif domain containing 1B
Synonyms: C030032C09Rik, Gm10937, LOC380650, AIDA-1b, E530015N03Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 10
Alteration at locus: Chemically Induced
NCBI: 77531
Homologene: 51570
Disp1
Name: dispatched RND transporter family member 1
Synonyms: 1190008H24Rik, DispA
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 1
Alteration at locus: Chemically Induced
NCBI: 68897
Homologene: 14133
1700019A02Rik
Name: RIKEN cDNA 1700019A02 gene
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 1
Alteration at locus: Chemically Induced
NCBI: 69397
Vmn1r118
Name: vomeronasal 1 receptor 118
Synonyms: Gm8542
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 7
Alteration at locus: Chemically Induced
NCBI: 667259
Homologene: 104166
Gm28417
Name: predicted gene 28417
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 1
Alteration at locus: Chemically Induced
RP23-105H6.2
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 2
Alteration at locus: Chemically Induced
Genetic Alterations
ENU-induced transitions at the following base pair locations (GRCm38):
  • A to T, chromosome 1 at 34,472,930 bp
  • G to A, chromosome 1 at 40,474,936 bp
  • A to T, chromosome 1 at 53,158,769 bp
  • T to C, chromosome 1 at 132,597,845 bp
  • T to C, chromosome 1 at 170,158,846 bp
  • G to A, chromosome 1 at 171,285,401 bp
  • A to G, chromosome 1 at 183,087,700 bp
  • A to T, chromosome 1 at 185,303,386 bp
  • T to A, chromosome 2 at 86,676,818 bp
  • T to A, chromosome 2 at 137,005,017 bp
  • A to G, chromosome 2 at 169,962,325 bp
  • G to A, chromosome 2 at 175,169,609 bp
  • C to T, chromosome 3 at 95,543,034 bp
  • T to A, chromosome 4 at 43,549,177 bp
  • T to A, chromosome 4 at 126,835,695 bp
  • T to A, chromosome 4 at 143,350,506 bp
  • A to G, chromosome 5 at 14,540,566 bp
  • C to T, chromosome 5 at 72,823,409 bp
  • A to G, chromosome 5 at 73,671,166 bp
  • A to T, chromosome 5 at 109,092,192 bp
  • A to T, chromosome 5 at 124,388,572 bp
  • A to T, chromosome 6 at 66,776,848 bp
  • G to T, chromosome 7 at 20,912,008 bp
  • T to A, chromosome 7 at 86,756,962 bp
  • T to A, chromosome 7 at 104,644,473 bp
  • A to G, chromosome 7 at 141,811,130 bp
  • A to G, chromosome 8 at 15,945,158 bp
  • A to G, chromosome 8 at 40,753,782 bp
  • A to T, chromosome 8 at 45,025,481 bp
  • A to G, chromosome 8 at 70,781,194 bp
  • C to T, chromosome 9 at 99,320,838 bp
  • A to G, chromosome 9 at 108,562,804 bp
  • TGAGCCAGAGCCAGAGCCAGAGCCAGAGCCAGAGCCAGAGCCAGAGCC to TGAGCCAGAGCCAGAGCCAGAGCCAGAGCCAGAGCCAGAGCCAGAGCCAGAGCC, chromosome 10 at 13,128,771 bp
  • A to G, chromosome 10 at 90,307,622 bp
  • T to A, chromosome 10 at 130,386,029 bp
  • G to A, chromosome 11 at 59,008,532 bp
  • A to T, chromosome 11 at 67,330,889 bp
  • A to T, chromosome 11 at 99,416,015 bp
  • G to A, chromosome 11 at 115,329,375 bp
  • T to C, chromosome 13 at 27,635,849 bp
  • A to G, chromosome 13 at 92,776,097 bp
  • A to G, chromosome 14 at 59,499,607 bp
  • A to T, chromosome 15 at 55,208,781 bp
  • C to A, chromosome 16 at 33,066,391 bp
  • A to G, chromosome 17 at 12,920,863 bp
  • C to T, chromosome 17 at 45,410,890 bp
  • G to A, chromosome 17 at 46,167,327 bp
  • T to C, chromosome 17 at 80,032,772 bp
Genotype Determination
Phenotype
G1 male heterozygous mice are viable and fertile. The G1 mice were not characterized prior to archiving.
Strain Development
C57BL/6J mice were injected with ENU, resulting in G0 mice that were bred back to C57BL/6J. Sperm was archived from G1 male mice that produced viable G2 mice.
Suggested Control Mice
Wild-type littermates or C57BL/6J mice
Donor
Bruce Beutler, M.D., University of Texas Southwestern Medical Center.
Primary Reference
MUTAGENETIX record for R4061 (G1). B. Beutler and colleagues, Center for the Genetics of Host Defense, UT Southwestern, Dallas, TX.

Colony and Husbandry Information

Colony Surveillance Program and Current Health Reports

Mice recovered from a cryo-archive will have health surveillance performed on recipient females. Health reports will be provided prior to shipment. If you require additional health status information, please email mmrrc@missouri.edu .
Coat Color
Black
MMRRC Breeding System
Random intra-strain mating
Breeding Scheme(s)
When maintaining a live colony, heterozygous mice may be bred together, bred with wild-type siblings, or bred with C57BL/6J inbred mice.
Overall Breeding Performance
Undetermined; during development, mating was done with heterozygous males; viability, fertility and other breeding statistics for heterozygous females and homozygotes are unverified, but presumably would be similar to the C57BL/6J background strain
Average litter size
Undetermined
Recommended wean age
3 weeks

Order Request Information

Limited quantities of breeder mice (recovered litter) are available from a cryoarchive; recovered litter usually available to ship in 3 to 4 months.

Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

Distribution of this strain requires submission of the MMRRC Conditions of Use (COU). A link to the COU web form will be provided via email after an order has been placed; the form should be completed then or the email forwarded to your institutional official for completion.

The donor or their institution limits the distribution to non-profit institutions only.

Additional charges may apply for any special requests. Shipping costs are in addition to the basic distribution/resuscitation fees. Information on shipping costs and any additional charges will be provided by the supplying MMRRC facility.

Click button to Request this one strain. (Use the MMRRC Catalog Search to request more than one strain.)
MMRRC Item # Description Distribution Fee / Unit (US $) Units Notes
040852-MU-RESUS Litter recovered from cryo-archive $5,475.00 / Non-Profit Litter Recovered litter1; additional fees for any special requests.
Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

Some MMRRC strains were submitted by the donor as cryopreserved germplasm, and because these strains were not cryopreserved by the MMRRC, we have not assessed the quality of this material. We have extensive experience with recovery of mice from cryopreserved sperm and embryos of varying quality, including using techniques such as IVF and ICSI, and are confident that we will have success in most, if not all, cases. However, because of the unknown quality of these frozen samples, we will restrict recovery efforts to two attempts for each order. Subsequent attempts can be performed on a fee-for-service basis, in addition to the standard fees, upon request.

1 The distribution fee covers the expense of resuscitating mice from the cryo-archive; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

2 An aliquot is one straw or vial with sufficient sperm to recover at least one litter of mice, as per provided protocols, when performed at the MMRRC facility. The MMRRC makes no guarantee concerning the success of these procedures when performed outside the MMRRC facilities.

3 An aliquot contains a sufficient number of embryos (in one or more vials or straws and based on the transfer success rate of the MMRRC facility) to transfer into one to three recipients. The MMRRC makes no guarantee concerning embryo transfer success experienced in the recipient investigator's laboratory. Neither gender nor genotype ratios are guaranteed.

To request material from the MMRRC: Please fill out our on-line request form (accessible from the catalog search results page, or click the Request this Strain button in the fees section). If you have questions or need assistance completing this form, you may call Customer Service at (800) 910-2291 (in USA or Canada) or (530) 757-5710 (international calls). Before you call, please have with you: the MMRRC item number, quantity needed, Bill-to and Ship-to contact information.