Loading Mouse GIF
Loading...

Strain Name:
C57BL/6J-MtgxR4061Btlr/Mmmh
Stock Number:
040852-MU
Citation ID:
RRID:MMRRC_040852-MU
Other Names:
R4061 (G1), C57BL/6J-MtgxR4061Btlr
Major Collection:

Strain Information

Thbs4
Name: thrombospondin 4
Synonyms: TSP-4, TSP4
Type: Gene
Species: Mouse
Chromosome: 13
NCBI: 21828
Homologene: 20691
Cdc5l
Name: cell division cycle 5-like
Synonyms: PCDC5RP, 1200002I02Rik
Type: Gene
Species: Mouse
Chromosome: 17
NCBI: 71702
VEGA: 17
HGNC: HGNC:1743
Homologene: 13291
Sbno1
Name: strawberry notch 1
Synonyms: sno, 9330180L10Rik
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 243272
Homologene: 10055
Hnrnpll
Name: heterogeneous nuclear ribonucleoprotein L-like
Synonyms: 2510028H02Rik, 2810036L13Rik, Hnrpll
Type: Gene
Species: Mouse
Chromosome: 17
NCBI: 72692
Homologene: 26701
Slx4ip
Name: SLX4 interacting protein
Synonyms: 2410004I22Rik, 2210009G21Rik
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 74243
Homologene: 49913
Iars2
Name: isoleucine-tRNA synthetase 2, mitochondrial
Synonyms: 2010002H18Rik
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 381314
Homologene: 7118
Impdh2
Name: inosine monophosphate dehydrogenase 2
Synonyms: IMP dehydrogenase type II
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 23918
HGNC: HGNC:6053
Homologene: 48919
Tcp1
Name: t-complex protein 1
Synonyms: Ccta, c-cpn, TRic, CCT, Tcp-1, Tp63, p63, Cct1
Type: Gene
Species: Mouse
Chromosome: 17
NCBI: 21454
Homologene: 5656
Fat1
Name: FAT atypical cadherin 1
Synonyms: mFat1, 2310038E12Rik, Fath
Type: Gene
Species: Mouse
Chromosome: 8
NCBI: 14107
HGNC: HGNC:3595
Homologene: 66302
Cab39l
Name: calcium binding protein 39-like
Synonyms: 2810425O13Rik, 1500031K13Rik, MO2L, 4930520C08Rik
Type: Gene
Species: Mouse
Chromosome: 14
NCBI: 69008
VEGA: 14
Homologene: 69422
Deptor
Name: DEP domain containing MTOR-interacting protein
Synonyms: 4731402B04Rik, D15Ertd336e, 9130412E02Rik, D15Ertd597e, Depdc6
Type: Gene
Species: Mouse
Chromosome: 15
NCBI: 97998
Homologene: 32551
Csmd1
Name: CUB and Sushi multiple domains 1
Type: Gene
Species: Mouse
Chromosome: 8
NCBI: 94109
Homologene: 69536
Esyt3
Name: extended synaptotagmin-like protein 3
Synonyms: D9Ertd280e, Fam62c
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 272636
Homologene: 18626
Plagl1
Name: pleiomorphic adenoma gene-like 1
Synonyms: Zac1
Type: Gene
Species: Mouse
Chromosome: 10
NCBI: 22634
HGNC: HGNC:9046
Homologene: 31401
Muc5ac
Name: mucin 5, subtypes A and C, tracheobronchial/gastric
Synonyms: MGM, 2210005L13Rik
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 17833
HGNC: HGNC:7515
Homologene: 137237
Pclo
Name: piccolo (presynaptic cytomatrix protein)
Synonyms: Acz, Pico
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 26875
Homologene: 69111
Myh13
Name: myosin, heavy polypeptide 13, skeletal muscle
Synonyms: extraocular myosin, EO Myosin, MyHC-eo
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 544791
HGNC: HGNC:7571
Homologene: 55780
Ctss
Name: cathepsin S
Synonyms: Cat S
Type: Gene
Species: Mouse
Chromosome: 3
NCBI: 13040
HGNC: HGNC:2545
Homologene: 20867
Obscn
Name: obscurin, cytoskeletal calmodulin and titin-interacting RhoGEF
Synonyms: LOC380698, OTTMUSG00000005786
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 380698
Homologene: 70869
Mast3
Name: microtubule associated serine/threonine kinase 3
Type: Gene
Species: Mouse
Chromosome: 8
NCBI: 546071
Homologene: 66191
Adam25
Name: ADAM metallopeptidase domain 25
Synonyms: testase 2
Type: Gene
Species: Mouse
Chromosome: 8
NCBI: 23793
HGNC: HGNC:199
Homologene: 128364
Vmn2r84
Name: vomeronasal 2, receptor 84
Synonyms: EG625068
Type: Gene
Species: Mouse
Chromosome: 10
NCBI: 625068
Homologene: 129606
Folh1
Name: folate hydrolase 1
Synonyms: mopsm, prostate-specific membrane antigen, glutamate carboxypeptidase II, GCP2
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 53320
Homologene: 55826
Lmln
Name: leishmanolysin-like (metallopeptidase M8 family)
Synonyms: 5330415H22Rik
Type: Gene
Species: Mouse
Chromosome: 16
NCBI: 239833
Homologene: 13198
Or52n4
Name: olfactory receptor family 52 subfamily N member 4
Synonyms: GA_x6K02T2PBJ9-7273558-7272587, MOR34-5, Olfr658
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 259051
Homologene: 105161
Tec
Name: tec protein tyrosine kinase
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 21682
Homologene: 1302
Lrrc38
Name: leucine rich repeat containing 38
Synonyms: A230053A07Rik
Type: Gene
Species: Mouse
Chromosome: 4
NCBI: 242735
Homologene: 77949
Spata18
Name: spermatogenesis associated 18
Synonyms: 1700067I02Rik
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 73472
Homologene: 17057
Krt12
Name: keratin 12
Synonyms: K12, Krt1-12
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 268482
HGNC: HGNC:6414
Homologene: 188
Uap1
Name: UDP-N-acetylglucosamine pyrophosphorylase 1
Synonyms: ESTM38, SPAG2, AGX1, AgX
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 107652
Homologene: 2342
Vmn2r12
Name: vomeronasal 2, receptor 12
Synonyms: Gm6769
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 627569
Homologene: 129606
Vmn1r38
Name: vomeronasal 1 receptor 38
Synonyms: V1rc13
Type: Gene
Species: Mouse
Chromosome: 6
NCBI: 171186
Homologene: 110800
Or5t7
Name: olfactory receptor family 5 subfamily T member 17
Synonyms: GA_x6K02T2Q125-48168771-48167839, MOR179-2, Olfr1086
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 258585
Homologene: 73975
Usp21
Name: ubiquitin specific peptidase 21
Synonyms: Usp16, ESTM28, Usp23, W53272
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 30941
Homologene: 56572
Il18r1
Name: interleukin 18 receptor 1
Synonyms: Il1rrp, Il18ralpha
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 16182
HGNC: HGNC:5988
Homologene: 2861
Prl7a1
Name: prolactin family 7, subfamily a, member 1
Synonyms: PLP-G, PLP-E, Prlpg, Prlpe
Type: Gene
Species: Mouse
Chromosome: 13
NCBI: 19113
Homologene: 136279
Gtpbp2
Name: GTP binding protein 2
Synonyms: nmf205
Type: Gene
Species: Mouse
Chromosome: 17
NCBI: 56055
HGNC: HGNC:4670
Homologene: 10420
Anks1b
Name: ankyrin repeat and sterile alpha motif domain containing 1B
Synonyms: LOC380650, C030032C09Rik, E530015N03Rik, AIDA-1b, Gm10937
Type: Gene
Species: Mouse
Chromosome: 10
NCBI: 77531
Homologene: 51570
Disp1
Name: dispatched RND transporter family member 1
Synonyms: DispA, 1190008H24Rik
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 68897
Homologene: 14133
Vmn1r118
Name: vomeronasal 1 receptor 118
Synonyms: Gm8542
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 667259
Homologene: 104166
Gm28417
Name: predicted gene 28417
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 1
NCBI: 118567734
RP23-105H6.2
Name:
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 2
Genetic Alterations
ENU-induced transitions at the following base pair locations (GRCm38):
  • A to T, chromosome 1 at 34,472,930 bp
  • G to A, chromosome 1 at 40,474,936 bp
  • A to T, chromosome 1 at 53,158,769 bp
  • T to C, chromosome 1 at 132,597,845 bp
  • T to C, chromosome 1 at 170,158,846 bp
  • G to A, chromosome 1 at 171,285,401 bp
  • A to G, chromosome 1 at 183,087,700 bp
  • A to T, chromosome 1 at 185,303,386 bp
  • T to A, chromosome 2 at 86,676,818 bp
  • T to A, chromosome 2 at 137,005,017 bp
  • A to G, chromosome 2 at 169,962,325 bp
  • G to A, chromosome 2 at 175,169,609 bp
  • C to T, chromosome 3 at 95,543,034 bp
  • T to A, chromosome 4 at 43,549,177 bp
  • T to A, chromosome 4 at 126,835,695 bp
  • T to A, chromosome 4 at 143,350,506 bp
  • A to G, chromosome 5 at 14,540,566 bp
  • C to T, chromosome 5 at 72,823,409 bp
  • A to G, chromosome 5 at 73,671,166 bp
  • A to T, chromosome 5 at 109,092,192 bp
  • A to T, chromosome 5 at 124,388,572 bp
  • A to T, chromosome 6 at 66,776,848 bp
  • G to T, chromosome 7 at 20,912,008 bp
  • T to A, chromosome 7 at 86,756,962 bp
  • T to A, chromosome 7 at 104,644,473 bp
  • A to G, chromosome 7 at 141,811,130 bp
  • A to G, chromosome 8 at 15,945,158 bp
  • A to G, chromosome 8 at 40,753,782 bp
  • A to T, chromosome 8 at 45,025,481 bp
  • A to G, chromosome 8 at 70,781,194 bp
  • C to T, chromosome 9 at 99,320,838 bp
  • A to G, chromosome 9 at 108,562,804 bp
  • TGAGCCAGAGCCAGAGCCAGAGCCAGAGCCAGAGCCAGAGCCAGAGCC to TGAGCCAGAGCCAGAGCCAGAGCCAGAGCCAGAGCCAGAGCCAGAGCCAGAGCC, chromosome 10 at 13,128,771 bp
  • A to G, chromosome 10 at 90,307,622 bp
  • T to A, chromosome 10 at 130,386,029 bp
  • G to A, chromosome 11 at 59,008,532 bp
  • A to T, chromosome 11 at 67,330,889 bp
  • A to T, chromosome 11 at 99,416,015 bp
  • G to A, chromosome 11 at 115,329,375 bp
  • T to C, chromosome 13 at 27,635,849 bp
  • A to G, chromosome 13 at 92,776,097 bp
  • A to G, chromosome 14 at 59,499,607 bp
  • A to T, chromosome 15 at 55,208,781 bp
  • C to A, chromosome 16 at 33,066,391 bp
  • A to G, chromosome 17 at 12,920,863 bp
  • C to T, chromosome 17 at 45,410,890 bp
  • G to A, chromosome 17 at 46,167,327 bp
  • T to C, chromosome 17 at 80,032,772 bp
Genotype Determination
Phenotype
G1 male heterozygous mice are viable and fertile. The G1 mice were not characterized prior to archiving.
Strain GQC Summary
The MMRRC Centers have developed a Strain GQC pipeline using MiniMUGA array genotyping to provide additional information on strain backgrounds for MMRRC strains. For more information on whether data may be available, or to request genotyping for a strain of interest, please contact MMRRC_GeneticQC@med.unc.edu. Older strains may not have this information available.
Suggested Control Mice
Littermates of all relevant genotypes.
Donor
Bruce Beutler, M.D., University of Texas Southwestern Medical Center.
Primary Reference
MUTAGENETIX record for R4061 (G1). B. Beutler and colleagues, Center for the Genetics of Host Defense, UT Southwestern, Dallas, TX.
Strain Development
C57BL/6J mice were injected with ENU, resulting in G0 mice that were bred back to C57BL/6J. Sperm was archived from G1 male mice that produced viable G2 mice.


Disclaimer: If MMRRC Strain Genetic Quality Control (GQC; based on MiniMUGA genotyping and analysis) has been completed for this strain, the information might differ from the genetic background information provided by the submitter. MiniMUGA genetic analysis is done on a strain’s tissue samples taken when archived by or ordered from the assigned MMRRC Center.

Colony and Husbandry Information

Colony Surveillance Program and Current Health Reports

Mice recovered from a cryo-archive will have health surveillance performed on recipient females. Health reports will be provided prior to shipment. If you require additional health status information, please email mmrrc@missouri.edu.
Coat Color
Black
MMRRC Breeding System
Random intra-strain mating
Breeding Scheme(s)
When maintaining a live colony, heterozygous mice may be bred together, bred with wild-type siblings, or bred with C57BL/6J inbred mice.
Overall Breeding Performance
Undetermined; during development, mating was done with heterozygous males; viability, fertility and other breeding statistics for heterozygous females and homozygotes are unverified, but presumably would be similar to the C57BL/6J background strain
Average litter size
Undetermined
Recommended wean age
3 weeks

Order Request Information

Limited quantities of breeder mice (recovered litter) are available from a cryoarchive; recovered litter usually available to ship in 3 to 4 months.

Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

Distribution of this strain requires submission of the MMRRC Conditions of Use (COU). A link to the COU web form will be provided via email after an order has been placed; the form should be completed then or the email forwarded to your institutional official for completion.

The donor or their institution limits the distribution to non-profit institutions only.

Additional charges may apply for any special requests. Shipping costs are in addition to the basic distribution/resuscitation fees. Information on shipping costs and any additional charges will be provided by the supplying MMRRC facility.

Click button to Request this one strain. (Use the MMRRC Catalog Search to request more than one strain.)
MMRRC Item # Description Distribution Fee / Unit (US $)
*Shipping & Handling not included*
Units Notes
040852-MU-RESUS Litter recovered from cryo-archive $5,475.00 / Non-Profit Litter Recovered litter4; additional fees for any special requests.
Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

Some MMRRC strains were submitted by the donor as cryopreserved germplasm, and because these strains were not cryopreserved by the MMRRC, we have not assessed the quality, nor genotype, of this material. Our expertise in reviving mice from various qualities of frozen sperm and embryos, using methods like IVF and ICSI, gives us confidence in successful recoveries in most cases. However, due to the uncertain quality of these samples, we'll limit revival attempts to two per order. Additional attempts are available for a fee, on top of standard charges, if requested. It's important to note that some strains may lack the expected mutation, so we can't assure successful order fulfillment until we attempt to revive the strain.

1 The distribution fee covers the expense of rederiving mice from a live mouse; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

2 An aliquot contains a sufficient number of embryos (in one or more vials or straws and based on the transfer success rate of the MMRRC facility) to transfer into one to three recipients. The MMRRC makes no guarantee concerning embryo transfer success experienced in the recipient investigator's laboratory. Neither gender nor genotype ratios are guaranteed.

3 An aliquot is one straw or vial with sufficient sperm to recover at least one litter of mice, as per provided protocols, when performed at the MMRRC facility. The MMRRC makes no guarantee concerning the success of these procedures when performed outside the MMRRC facilities.

4 The distribution fee covers the expense of resuscitating mice from the cryo-archive; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

To request material from the MMRRC: Please fill out our on-line request form (accessible from the catalog search results page, or click the Request this Strain button in the fees section). If you have questions or need assistance completing this form, you may call Customer Service at (800) 910-2291 (in USA or Canada) or (530) 757-5710 (international calls). Before you call, please have with you: the MMRRC item number, quantity needed, Bill-to and Ship-to contact information.