Strain Name:
Stock Number:
Citation ID:
Other Names:
R4080 (G1), C57BL/6J-MtgxR4080Btlr
Major Collection:

Gene Information

Name: patched 2
Synonyms: ptc2
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 4
NCBI: 19207
Homologene: 37842
Name: scavenger receptor class B, member 1
Synonyms: D5Ertd460e, Srb1, Cd36l1, Cla-1, SRBI, SR-BI, Hlb398, Hdlq1, Chohd1, Chohd1
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 5
NCBI: 20778
Homologene: 21132
Name: unc-93 homolog B1, TLR signaling regulator
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 19
NCBI: 54445
Homologene: 41325
Name: protease, serine 12 neurotrypsin (motopsin)
Synonyms: Bssp-3, motopsin
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 3
NCBI: 19142
Homologene: 7490
Name: nuclear receptor-binding SET-domain protein 1
Synonyms: KMT3B
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 13
NCBI: 18193
VEGA: 13
Homologene: 32543
Name: protein phosphatase 2 protein activator
Synonyms: 2610042B21Rik, Ppp2r4
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 2
NCBI: 110854
Homologene: 6149
Name: leucine rich repeat containing 41
Synonyms: D730026A16Rik, MUF1, D630045E04Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 4
NCBI: 230654
Homologene: 4645
Name: NIMA (never in mitosis gene a)-related expressed kinase 6
Synonyms: 1300007C09Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 2
NCBI: 59126
Homologene: 49379
Name: trafficking protein particle complex 9
Synonyms: 4632408O18Rik, 2900005P22Rik, Nibp, TRS130, 1810044A24Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 15
NCBI: 76510
VEGA: 15
Homologene: 81931
Name: zinc finger RNA binding protein
Synonyms: C920030H05Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 15
NCBI: 22763
Homologene: 8009
Name: Sec1 family domain containing 1
Synonyms: 3110021P21Rik, STXBP1L2, RA410
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 12
NCBI: 76983
VEGA: 12
Homologene: 5650
Name: signal peptide, CUB domain, EGF-like 1
Synonyms: A630023E24Rik, 7330410C13Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 15
NCBI: 64706
Homologene: 11224
Name: cholinergic receptor, nicotinic, alpha polypeptide 2 (neuronal)
Synonyms: Acra2, Acra-2
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 14
NCBI: 110902
Homologene: 20193
Name: unc-5 netrin receptor A
Synonyms: Unc5h1
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 13
NCBI: 107448
Homologene: 41474
Name: cortactin
Synonyms: Ems1, 1110020L01Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 7
NCBI: 13043
Homologene: 3834
Name: PHD and ring finger domains 1
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 7
NCBI: 101471
Homologene: 16377
Name: Rho guanine nucleotide exchange factor (GEF) 1
Synonyms: Lsc, Lbcl2
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 7
NCBI: 16801
Homologene: 3454
Name: reduced expression 2
Synonyms: Gm13138
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 4
NCBI: 100043034
Homologene: 133076
Name: adhesion G protein-coupled receptor F3
Synonyms: LOC381628, PGR23, Gpr113
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 5
NCBI: 381628
Homologene: 17826
Name: natural killer tumor recognition sequence
Synonyms: D9Wsu172e, 5330401F18Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 9
NCBI: 18087
Homologene: 122148
Name: eukaryotic translation initiation factor 2A
Synonyms: D3Ertd194e
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 3
NCBI: 229317
Homologene: 5969
Name: cyclin-dependent kinase 12
Synonyms: 1810022J16Rik, Crk7, D11Ertd752e, Crkrs
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 11
NCBI: 69131
Homologene: 128632
Name: reversion-inducing-cysteine-rich protein with kazal motifs
Synonyms: St15
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 4
NCBI: 53614
Homologene: 9622
Name: ubiquitin protein ligase E3 component n-recognin 2
Synonyms: 9930021A08Rik, E130209G04Rik, ENSMUSG00000043296
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 17
NCBI: 224826
VEGA: 17
Homologene: 26151
Name: NOC4 like
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 5
NCBI: 100608
Homologene: 40545
Name: zinc finger protein 667
Synonyms: A830025F02Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 7
NCBI: 384763
Homologene: 23343
Name: myosin XVI
Synonyms: C230040D10Rik, Nyap3, BM140241
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 8
NCBI: 244281
Homologene: 34710
Name: heparan-alpha-glucosaminide N-acetyltransferase
Synonyms: 9430010M12Rik, D8Ertd354e, Tmem76
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 8
NCBI: 52120
Homologene: 15586
Name: spectrin alpha, erythrocytic 1
Synonyms: Spna-1, erythroid, ihj, Spna1
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 1
NCBI: 20739
Homologene: 74460
Name: myosin, heavy polypeptide 11, smooth muscle
Synonyms: smMHC, SM2, SM1
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 16
NCBI: 17880
VEGA: 16
Homologene: 128512
Name: zinc finger protein 469
Synonyms: LOC195209, Gm22
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 8
NCBI: 195209
Homologene: 18937
Name: sucrase isomaltase (alpha-glucosidase)
Synonyms: Si-s, sucrase-isomaltase, 2010204N08Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 3
NCBI: 69983
Homologene: 37424
Name: syntabulin (syntaxin-interacting)
Synonyms: A830027B17Rik, Golsyn/Syntabulin, 5730410E15Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 15
NCBI: 319613
VEGA: 15
Homologene: 9838
Name: complement component 7
Synonyms: LOC383055
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 15
NCBI: 109828
VEGA: 15
Homologene: 489
Name: DS cell adhesion molecule
Synonyms: 4932410A21Rik, Down syndrome cell adhesion molecule
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 16
NCBI: 13508
Homologene: 74393
Name: NLR family, apoptosis inhibitory protein 6
Synonyms: Naip-rs4A, Naip-rs4, Birc1f
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 13
NCBI: 17952
Homologene: 113589
Name: C-type lectin domain family 2, member g
Synonyms: 4632413B12Rik, Ocilrp1
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 6
NCBI: 70809
Homologene: 136309
Name: glycerol-3-phosphate acyltransferase 2, mitochondrial
Synonyms: Gpat2, A530057A03Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 2
NCBI: 215456
Homologene: 19037
Name: myosin VB
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 18
NCBI: 17919
Homologene: 49481
Name: leucine rich repeat containing 19
Synonyms: 9130022A01Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 4
NCBI: 100061
Homologene: 36410
Name: FERM and PDZ domain containing 1
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 4
NCBI: 666060
Homologene: 8939
Name: protein only RNase P catalytic subunit
Synonyms: Mrpp3, 1110008L16Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 12
NCBI: 66132
Homologene: 45935
Name: L-3-hydroxyproline dehydratase (trans-)
Synonyms: 2810055F11Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 12
NCBI: 67217
Homologene: 12100
Name: aminoadipate-semialdehyde synthase
Synonyms: LOR/SDH, Lorsdh
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 6
NCBI: 30956
Homologene: 4212
Name: discoidin, CUB and LCCL domain containing 2
Synonyms: 1700055P21Rik, Esdn, CLCP1
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 16
NCBI: 73379
Homologene: 12499
Name: SPT2 chromatin protein domain containing 1
Synonyms: 5830435K17Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 7
NCBI: 101685
Homologene: 45499
Name: a disintegrin and metallopeptidase domain 7
Synonyms: EAP1
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 14
NCBI: 11500
Homologene: 2830
Name: poly(A) binding protein, cytoplasmic 2
Synonyms: Pabp2
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 18
NCBI: 18459
Homologene: 56509
Name: olfactory receptor family 5 subfamily H member 22
Synonyms: GA_x54KRFPKG5P-55303207-55302284, MOR183-4, Olfr190
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 16
NCBI: 258392
Homologene: 131129
Name: absent in melanoma 2
Synonyms: LOC383619, Ifi210
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 1
NCBI: 383619
Homologene: 83226
Name: coiled-coil domain containing 158
Synonyms: 4932413O14Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 5
NCBI: 320696
Homologene: 18560
Name: regulator of G-protein signalling 22
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 15
NCBI: 626596
Homologene: 75047
Name: cytochrome P450, family 2, subfamily c, polypeptide 40
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 19
NCBI: 13099
Homologene: 74936
Name: potassium voltage-gated channel, subfamily H (eag-related), member 8
Synonyms: Kv12.1, ELK1, C130090D05Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 17
NCBI: 211468
Homologene: 14332
Name: contactin associated protein-like 5A
Synonyms: Caspr5-1
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 1
NCBI: 636808
Homologene: 43974
Name: kallikrein related-peptidase 14
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 7
NCBI: 317653
Homologene: 69348
Name: TXK tyrosine kinase
Synonyms: Rlk, Btkl, PTK4, A130089B16Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 5
NCBI: 22165
Homologene: 2497
Name: pleckstrin homology domain containing, family G (with RhoGef domain) member 3
Synonyms: MGC40768
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 12
NCBI: 263406
VEGA: 12
Homologene: 77478
Name: G protein-coupled receptor 137
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 19
NCBI: 107173
VEGA: 19
Homologene: 10598
Name: StAR-related lipid transfer (START) domain containing 13
Synonyms: GT650, DLC2
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 5
NCBI: 243362
Homologene: 64844
Name: RIKEN cDNA C230029F24 gene
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 1
NCBI: 442837
Name: procollagen-lysine, 2-oxoglutarate 5-dioxygenase 3
Synonyms: lysyl hydroxylase 3, LH3
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 5
NCBI: 26433
Homologene: 843
Name: receptor accessory protein 6
Synonyms: Dp1l1
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 10
NCBI: 70335
Homologene: 133833
Name: retrotransposon Gag like 6
Synonyms: Mart6, Mar6, Ldoc1l
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 15
NCBI: 223732
VEGA: 15
Homologene: 18594
Name: olfactory receptor family 1 subfamily AD member 1
Synonyms: GA_x6K02T2QP88-4453480-4452557, MOR129-1, Olfr1377
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 11
NCBI: 258913
Homologene: 64929
Name: WAP four-disulfide core domain 1
Synonyms: 2310058A03Rik, ps20
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 8
NCBI: 67866
Homologene: 10920
Name: predicted gene, 16853
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 9
NCBI: 330902
Name: protocadherin gamma subfamily A, 4
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 18
NCBI: 93712
Homologene: 81866
Genetic Alterations
ENU-induced transitions at the following base pair locations (GRCm38):
  • G to A, chromosome 1 at 49,244,665 bp
  • A to G, chromosome 1 at 116,101,574 bp
  • T to C, chromosome 1 at 173,459,851 bp
  • A to G, chromosome 1 at 174,214,066 bp
  • T to C, chromosome 2 at 30,443,305 bp
  • A to G, chromosome 2 at 38,550,637 bp
  • T to C, chromosome 2 at 127,433,622 bp
  • C to T, chromosome 3 at 58,539,629 bp
  • T to C, chromosome 3 at 72,921,184 bp
  • A to G, chromosome 3 at 123,485,485 bp
  • T to C, chromosome 4 at 43,942,293 bp
  • T to A, chromosome 4 at 45,284,382 bp
  • T to A, chromosome 4 at 94,652,912 bp
  • C to A, chromosome 4 at 116,080,546 bp
  • C to G, chromosome 4 at 117,111,206 bp
  • T to A, chromosome 4 at 147,058,697 bp
  • G to A, chromosome 5 at 30,197,369 bp
  • G to A, chromosome 5 at 72,700,663 bp
  • A to T, chromosome 5 at 92,623,396 bp
  • A to T, chromosome 5 at 110,649,872 bp
  • G to T, chromosome 5 at 125,277,795 bp
  • G to C, chromosome 5 at 136,988,146 bp
  • C to A, chromosome 5 at 151,092,829 bp
  • A to T, chromosome 6 at 23,109,498 bp
  • C to A, chromosome 6 at 128,981,324 bp
  • T to G, chromosome 7 at 6,305,106 bp
  • G to T, chromosome 7 at 24,925,846 bp
  • G to A, chromosome 7 at 43,692,077 bp
  • T to C, chromosome 7 at 46,998,581 bp
  • T to C, chromosome 7 at 141,259,720 bp
  • T to A, chromosome 7 at 144,457,724 bp
  • A to G, chromosome 8 at 10,562,240 bp
  • A to G, chromosome 8 at 25,946,343 bp
  • T to A, chromosome 8 at 119,683,793 bp
  • T to C, chromosome 8 at 122,270,436 bp
  • A to G, chromosome 9 at 21,403,134 bp
  • A to C, chromosome 9 at 121,741,126 bp
  • G to A, chromosome 10 at 80,330,162 bp
  • G to A, chromosome 11 at 50,984,856 bp
  • C to T, chromosome 11 at 98,224,678 bp
  • A to G, chromosome 12 at 51,431,519 bp
  • G to T, chromosome 12 at 55,304,613 bp
  • A to G, chromosome 12 at 72,084,604 bp
  • G to T, chromosome 12 at 76,577,981 bp
  • A to T, chromosome 13 at 55,004,481 bp
  • A to G, chromosome 13 at 55,301,809 bp
  • A to T, chromosome 13 at 100,299,307 bp
  • G to T, chromosome 14 at 66,143,417 bp
  • C to A, chromosome 14 at 66,143,424 bp
  • T to C, chromosome 14 at 68,520,539 bp
  • T to C, chromosome 15 at 4,990,464 bp
  • G to A, chromosome 15 at 12,162,233 bp
  • C to T, chromosome 15 at 36,107,076 bp
  • T to C, chromosome 15 at 44,718,943 bp
  • T to A, chromosome 15 at 72,941,947 bp
  • T to G, chromosome 15 at 83,608,747 bp
  • T to C, chromosome 15 at 84,557,001 bp
  • C to A, chromosome 16 at 14,224,059 bp
  • T to A, chromosome 16 at 58,465,373 bp
  • A to T, chromosome 16 at 59,074,256 bp
  • A to T, chromosome 16 at 96,683,772 bp
  • A to T, chromosome 17 at 46,988,722 bp
  • GAGACCAACGAGCAGCTGATGCTTCAGA to GAGA, chromosome 17 at 52,725,906 bp
  • A to T, chromosome 18 at 37,685,779 bp
  • A to T, chromosome 18 at 39,775,530 bp
  • A to G, chromosome 18 at 74,740,488 bp
  • G to A, chromosome 19 at 3,941,959 bp
  • C to T, chromosome 19 at 6,940,423 bp
  • A to G, chromosome 19 at 39,802,529 bp
Genotype Determination
G1 male heterozygous mice are viable and fertile. The G1 mice were not characterized prior to archiving.
Strain Development
C57BL/6J mice were injected with ENU, resulting in G0 mice that were bred back to C57BL/6J. Sperm was archived from G1 male mice that produced viable G2 mice.
Suggested Control Mice
Wild-type littermates or C57BL/6J mice
Bruce Beutler, M.D., University of Texas Southwestern Medical Center.
Primary Reference
MUTAGENETIX record for R4080 (G1). B. Beutler and colleagues, Center for the Genetics of Host Defense, UT Southwestern, Dallas, TX.

Colony and Husbandry Information

Colony Surveillance Program and Current Health Reports

Mice recovered from a cryo-archive will have health surveillance performed on recipient females. Health reports will be provided prior to shipment. If you require additional health status information, please email .
Coat Color
MMRRC Breeding System
Random intra-strain mating
Breeding Scheme(s)
When maintaining a live colony, heterozygous mice may be bred together, bred with wild-type siblings, or bred with C57BL/6J inbred mice.
Overall Breeding Performance
Undetermined; during development, mating was done with heterozygous males; viability, fertility and other breeding statistics for heterozygous females and homozygotes are unverified, but presumably would be similar to the C57BL/6J background strain
Average litter size
Recommended wean age
3 weeks

Order Request Information

Limited quantities of breeder mice (recovered litter) are available from a cryoarchive; recovered litter usually available to ship in 3 to 4 months.

Cryopreserved material may be available upon request, please inquire to for more information.

Distribution of this strain requires submission of the MMRRC Conditions of Use (COU). A link to the COU web form will be provided via email after an order has been placed; the form should be completed then or the email forwarded to your institutional official for completion.

The donor or their institution limits the distribution to non-profit institutions only.

Additional charges may apply for any special requests. Shipping costs are in addition to the basic distribution/resuscitation fees. Information on shipping costs and any additional charges will be provided by the supplying MMRRC facility.

Click button to Request this one strain. (Use the MMRRC Catalog Search to request more than one strain.)
MMRRC Item # Description Distribution Fee / Unit (US $)
*Shipping & Handling not included*
Units Notes
040856-MU-RESUS Litter recovered from cryo-archive $5,475.00 / Non-Profit Litter Recovered litter4; additional fees for any special requests.
Cryopreserved material may be available upon request, please inquire to for more information.

Some MMRRC strains were submitted by the donor as cryopreserved germplasm, and because these strains were not cryopreserved by the MMRRC, we have not assessed the quality of this material. We have extensive experience with recovery of mice from cryopreserved sperm and embryos of varying quality, including using techniques such as IVF and ICSI, and are confident that we will have success in most, if not all, cases. However, because of the unknown quality of these frozen samples, we will restrict recovery efforts to two attempts for each order. Subsequent attempts can be performed on a fee-for-service basis, in addition to the standard fees, upon request.

1 The distribution fee covers the expense of rederiving mice from a live mouse; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

2 An aliquot contains a sufficient number of embryos (in one or more vials or straws and based on the transfer success rate of the MMRRC facility) to transfer into one to three recipients. The MMRRC makes no guarantee concerning embryo transfer success experienced in the recipient investigator's laboratory. Neither gender nor genotype ratios are guaranteed.

3 An aliquot is one straw or vial with sufficient sperm to recover at least one litter of mice, as per provided protocols, when performed at the MMRRC facility. The MMRRC makes no guarantee concerning the success of these procedures when performed outside the MMRRC facilities.

4 The distribution fee covers the expense of resuscitating mice from the cryo-archive; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

To request material from the MMRRC: Please fill out our on-line request form (accessible from the catalog search results page, or click the Request this Strain button in the fees section). If you have questions or need assistance completing this form, you may call Customer Service at (800) 910-2291 (in USA or Canada) or (530) 757-5710 (international calls). Before you call, please have with you: the MMRRC item number, quantity needed, Bill-to and Ship-to contact information.