Loading Mouse GIF
Loading...

Strain Name:
C57BL/6J-MtgxR4080Btlr/Mmmh
Stock Number:
040856-MU
Citation ID:
RRID:MMRRC_040856-MU
Other Names:
R4080 (G1), C57BL/6J-MtgxR4080Btlr
Major Collection:

Strain Information

Ptch2
Name: patched 2
Synonyms: ptc2
Type: Gene
Species: Mouse
Chromosome: 4
NCBI: 19207
HGNC: HGNC:9586
Homologene: 37842
Scarb1
Name: scavenger receptor class B, member 1
Synonyms: D5Ertd460e, Srb1, Cd36l1, Cla-1, SRBI, SR-BI, Hlb398, Hdlq1, Chohd1, Chohd1
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 20778
HGNC: HGNC:1664
Homologene: 21132
Unc93b1
Name: unc-93 homolog B1, TLR signaling regulator
Type: Gene
Species: Mouse
Chromosome: 19
NCBI: 54445
Homologene: 41325
Prss12
Name: serine protease 12 neurotrypsin (motopsin)
Synonyms: Bssp-3, motopsin
Type: Gene
Species: Mouse
Chromosome: 3
NCBI: 19142
HGNC: HGNC:9477
Homologene: 7490
Nsd1
Name: nuclear receptor-binding SET-domain protein 1
Synonyms: KMT3B
Type: Gene
Species: Mouse
Chromosome: 13
NCBI: 18193
VEGA: 13
Homologene: 32543
Ptpa
Name: protein phosphatase 2 protein activator
Synonyms: 2610042B21Rik, Ppp2r4
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 110854
HGNC: HGNC:9308
Homologene: 6149
Lrrc41
Name: leucine rich repeat containing 41
Synonyms: D730026A16Rik, MUF1, D630045E04Rik
Type: Gene
Species: Mouse
Chromosome: 4
NCBI: 230654
Homologene: 4645
Genetic Alterations
ENU-induced transitions at the following base pair locations (GRCm38):
  • G to A, chromosome 1 at 49,244,665 bp
  • A to G, chromosome 1 at 116,101,574 bp
  • T to C, chromosome 1 at 173,459,851 bp
  • A to G, chromosome 1 at 174,214,066 bp
  • T to C, chromosome 2 at 30,443,305 bp
  • A to G, chromosome 2 at 38,550,637 bp
  • T to C, chromosome 2 at 127,433,622 bp
  • C to T, chromosome 3 at 58,539,629 bp
  • T to C, chromosome 3 at 72,921,184 bp
  • A to G, chromosome 3 at 123,485,485 bp
  • T to C, chromosome 4 at 43,942,293 bp
  • T to A, chromosome 4 at 45,284,382 bp
  • T to A, chromosome 4 at 94,652,912 bp
  • C to A, chromosome 4 at 116,080,546 bp
  • C to G, chromosome 4 at 117,111,206 bp
  • T to A, chromosome 4 at 147,058,697 bp
  • G to A, chromosome 5 at 30,197,369 bp
  • G to A, chromosome 5 at 72,700,663 bp
  • A to T, chromosome 5 at 92,623,396 bp
  • A to T, chromosome 5 at 110,649,872 bp
  • G to T, chromosome 5 at 125,277,795 bp
  • G to C, chromosome 5 at 136,988,146 bp
  • C to A, chromosome 5 at 151,092,829 bp
  • A to T, chromosome 6 at 23,109,498 bp
  • C to A, chromosome 6 at 128,981,324 bp
  • T to G, chromosome 7 at 6,305,106 bp
  • G to T, chromosome 7 at 24,925,846 bp
  • G to A, chromosome 7 at 43,692,077 bp
  • T to C, chromosome 7 at 46,998,581 bp
  • T to C, chromosome 7 at 141,259,720 bp
  • T to A, chromosome 7 at 144,457,724 bp
  • A to G, chromosome 8 at 10,562,240 bp
  • A to G, chromosome 8 at 25,946,343 bp
  • T to A, chromosome 8 at 119,683,793 bp
  • T to C, chromosome 8 at 122,270,436 bp
  • A to G, chromosome 9 at 21,403,134 bp
  • A to C, chromosome 9 at 121,741,126 bp
  • G to A, chromosome 10 at 80,330,162 bp
  • G to A, chromosome 11 at 50,984,856 bp
  • C to T, chromosome 11 at 98,224,678 bp
  • A to G, chromosome 12 at 51,431,519 bp
  • G to T, chromosome 12 at 55,304,613 bp
  • A to G, chromosome 12 at 72,084,604 bp
  • G to T, chromosome 12 at 76,577,981 bp
  • A to T, chromosome 13 at 55,004,481 bp
  • A to G, chromosome 13 at 55,301,809 bp
  • A to T, chromosome 13 at 100,299,307 bp
  • G to T, chromosome 14 at 66,143,417 bp
  • C to A, chromosome 14 at 66,143,424 bp
  • T to C, chromosome 14 at 68,520,539 bp
  • T to C, chromosome 15 at 4,990,464 bp
  • G to A, chromosome 15 at 12,162,233 bp
  • C to T, chromosome 15 at 36,107,076 bp
  • T to C, chromosome 15 at 44,718,943 bp
  • T to A, chromosome 15 at 72,941,947 bp
  • T to G, chromosome 15 at 83,608,747 bp
  • T to C, chromosome 15 at 84,557,001 bp
  • C to A, chromosome 16 at 14,224,059 bp
  • T to A, chromosome 16 at 58,465,373 bp
  • A to T, chromosome 16 at 59,074,256 bp
  • A to T, chromosome 16 at 96,683,772 bp
  • A to T, chromosome 17 at 46,988,722 bp
  • GAGACCAACGAGCAGCTGATGCTTCAGA to GAGA, chromosome 17 at 52,725,906 bp
  • A to T, chromosome 18 at 37,685,779 bp
  • A to T, chromosome 18 at 39,775,530 bp
  • A to G, chromosome 18 at 74,740,488 bp
  • G to A, chromosome 19 at 3,941,959 bp
  • C to T, chromosome 19 at 6,940,423 bp
  • A to G, chromosome 19 at 39,802,529 bp
Genotype Determination
Phenotype
G1 male heterozygous mice are viable and fertile. The G1 mice were not characterized prior to archiving.
Strain GQC Summary
Gene Specific Genotyping:

To request gene-specific and other genotyping services for a strain, please contact the distribution MMRRC Center for more information.

Background Genetic Quality:

The MMRRC has developed a Genetic Quality Control pipeline using the MiniMUGA array to provide additional information to identify and validate genetic backgrounds of MMRRC strains. For more information on whether genetic background data is available, please contact MMRRC_GeneticQC@med.unc.edu. Note: that MiniMUGA genetic background data is not available on all strains, but can be ordered if desired.

Suggested Control Mice
Littermates of all relevant genotypes.
Submitter
Bruce Beutler, M.D., University of Texas Southwestern Medical Center.
Primary Reference
MUTAGENETIX record for R4080 (G1). B. Beutler and colleagues, Center for the Genetics of Host Defense, UT Southwestern, Dallas, TX.
Strain Development
C57BL/6J mice were injected with ENU, resulting in G0 mice that were bred back to C57BL/6J. Sperm was archived from G1 male mice that produced viable G2 mice.


Disclaimer: If MMRRC Strain Genetic Quality Control (GQC; based on MiniMUGA genotyping and analysis) has been completed for this strain, the information might differ from the genetic background information provided by the submitter. MiniMUGA genetic analysis is done on a strain’s tissue samples taken when archived by or ordered from the assigned MMRRC Center.

Colony and Husbandry Information

Colony Surveillance Program and Current Health Reports

Mice recovered from a cryo-archive will have health surveillance performed on recipient females. Health reports will be provided prior to shipment. If you require additional health status information, please email mmrrc@missouri.edu.
Coat Color
Black
MMRRC Breeding System
Random intra-strain mating
Breeding Scheme(s)
When maintaining a live colony, heterozygous mice may be bred together, bred with wild-type siblings, or bred with C57BL/6J inbred mice.
Overall Breeding Performance
Undetermined; during development, mating was done with heterozygous males; viability, fertility and other breeding statistics for heterozygous females and homozygotes are unverified, but presumably would be similar to the C57BL/6J background strain
Average litter size
Undetermined
Recommended wean age
3 weeks

Order Information

Limited quantities of breeder mice (recovered litter) are available from a cryoarchive; recovered litter usually available to ship in 3 to 4 months.

Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

Distribution of this strain requires submission of the MMRRC Conditions of Use (COU). A link to the COU web form will be provided via email after an order has been placed; the form should be completed then or the email forwarded to your institutional official for completion.

The submitter or their institution limits the distribution to non-profit institutions only.

Additional charges may apply for any special requests. Shipping costs are in addition to the basic distribution/resuscitation fees. Information on shipping costs and any additional charges will be provided by the supplying MMRRC facility.

Click button to Request this one strain. (Use the MMRRC Catalog Search to request more than one strain.)
MMRRC Item # Description Distribution Fee / Unit (US $)
*Shipping & Handling not included*
Units Notes
040856-MU-RESUS Litter recovered from cryo-archive $5,475.00 / Non-Profit Litter Recovered litter4; additional fees for any special requests.
Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

Some MMRRC strains were submitted by the submitter as cryopreserved germplasm, and because these strains were not cryopreserved by the MMRRC, we have not assessed the quality, nor genotype, of this material. Our expertise in reviving mice from various qualities of frozen sperm and embryos, using methods like IVF and ICSI, gives us confidence in successful recoveries in most cases. However, due to the uncertain quality of these samples, we'll limit revival attempts to two per order. Additional attempts are available for a fee, on top of standard charges, if requested. It's important to note that some strains may lack the expected mutation, so we can't assure successful order fulfillment until we attempt to revive the strain.

1 The distribution fee covers the expense of rederiving mice from a live mouse; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

2 An aliquot contains a sufficient number of embryos (in one or more vials or straws and based on the transfer success rate of the MMRRC facility) to transfer into one to three recipients. The MMRRC makes no guarantee concerning embryo transfer success experienced in the recipient investigator's laboratory. Neither gender nor genotype ratios are guaranteed.

3 An aliquot is one straw or vial with sufficient sperm to recover at least one litter of mice, as per provided protocols, when performed at the MMRRC facility. The MMRRC makes no guarantee concerning the success of these procedures when performed outside the MMRRC facilities.

4 The distribution fee covers the expense of resuscitating mice from the cryo-archive; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

To request material from the MMRRC: Please fill out our on-line request form (accessible from the catalog search results page, or click the Request this Strain button in the fees section). If you have questions or need assistance completing this form, you may call Customer Service at (800) 910-2291 (in USA or Canada) or (530) 757-5710 (international calls). Before you call, please have with you: the MMRRC item number, quantity needed, Bill-to and Ship-to contact information.