Loading Mouse GIF
Loading...

Strain Name:
C57BL/6J-MtgxR3947Btlr/Mmmh
Stock Number:
040927-MU
Citation ID:
RRID:MMRRC_040927-MU
Other Names:
R3947 (G1), C57BL/6J-MtgxR3947Btlr
Major Collection:

Strain Information

Pkd1
Name: polycystin 1, transient receptor potential channel interacting
Synonyms: polycystin-1, PC1, PC-1
Type: Gene
Species: Mouse
Chromosome: 17
NCBI: 18763
VEGA: 17
HGNC: HGNC:9008
Homologene: 250
Macf1
Name: microtubule-actin crosslinking factor 1
Synonyms: Acf7, Aclp7, trabeculin alpha
Type: Gene
Species: Mouse
Chromosome: 4
NCBI: 11426
Homologene: 136191
Wdfy3
Name: WD repeat and FYVE domain containing 3
Synonyms: Ggtb3, 2610509D04Rik, D5Ertd66e, Bwf1, Bchs, Alfy
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 72145
Homologene: 22855
Suclg2
Name: succinate-Coenzyme A ligase, GDP-forming, beta subunit
Synonyms: D6Wsu120e
Type: Gene
Species: Mouse
Chromosome: 6
NCBI: 20917
Homologene: 2854
Ttc17
Name: tetratricopeptide repeat domain 17
Synonyms: D2Bwg1005e, 9130020K17Rik
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 74569
Homologene: 10100
Tex2
Name: testis expressed gene 2
Synonyms: Taz4, Def-5, 4930568E07Rik
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 21763
Homologene: 32414
Tdrd3
Name: tudor domain containing 3
Synonyms: 4732418C03Rik
Type: Gene
Species: Mouse
Chromosome: 14
NCBI: 219249
Homologene: 12771
Acin1
Name: apoptotic chromatin condensation inducer 1
Synonyms: 2610510L13Rik, 2610036I19Rik, Acinus
Type: Gene
Species: Mouse
Chromosome: 14
NCBI: 56215
Homologene: 22853
Pgr
Name: progesterone receptor
Synonyms: NR3C3, PR, 9930019P03Rik, PR-B, PR-A, ENSMUSG00000074510
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 18667
HGNC: HGNC:8910
Homologene: 713
Iqsec3
Name: IQ motif and Sec7 domain 3
Synonyms: BRAG3, synarfGEF
Type: Gene
Species: Mouse
Chromosome: 6
NCBI: 243621
Homologene: 46091
Ino80d
Name: INO80 complex subunit D
Synonyms: A430093A21Rik
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 227195
Homologene: 9819
Fnbp1l
Name: formin binding protein 1-like
Synonyms: TOCA1, 2610318I01Rik
Type: Gene
Species: Mouse
Chromosome: 3
NCBI: 214459
Homologene: 134636
Chst15
Name: carbohydrate sulfotransferase 15
Synonyms: GalNAcS-6ST, 4631426J05Rik, MAd5, MAd5
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 77590
Homologene: 8908
Ssh2
Name: slingshot protein phosphatase 2
Synonyms: SSH-2
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 237860
Homologene: 14116
Col4a3
Name: collagen, type IV, alpha 3
Synonyms: alpha3(IV), tumstatin
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 12828
HGNC: HGNC:2204
Homologene: 68033
Avl9
Name: AVL9 cell migration associated
Synonyms: D730049P16Rik, 5830411G16Rik
Type: Gene
Species: Mouse
Chromosome: 6
NCBI: 78937
Homologene: 62425
Grk2
Name: G protein-coupled receptor kinase 2
Synonyms: beta ARK, beta ARK1, beta-AR kinase-1, beta-adrenergic receptor kinase-1, Bark-1, Adrbk-1, betaARK1, Adrbk1
Type: Gene
Species: Mouse
Chromosome: 19
NCBI: 110355
HGNC: HGNC:289
Homologene: 1223
Ryr3
Name: ryanodine receptor 3
Synonyms: calcium release channel isoform 3
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 20192
Homologene: 68151
Irak3
Name: interleukin-1 receptor-associated kinase 3
Synonyms: IRAK-M, 4833428C18Rik
Type: Gene
Species: Mouse
Chromosome: 10
NCBI: 73914
Homologene: 36215
Obscn
Name: obscurin, cytoskeletal calmodulin and titin-interacting RhoGEF
Synonyms: LOC380698, OTTMUSG00000005786
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 380698
Homologene: 70869
Nebl
Name: nebulette
Synonyms: Lnebl, 1200007O21Rik, A630080F05Rik, D830029A09Rik
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 74103
Homologene: 128431
Mtnr1a
Name: melatonin receptor 1A
Synonyms: MelR, Mel1a receptor
Type: Gene
Species: Mouse
Chromosome: 8
NCBI: 17773
HGNC: HGNC:7463
Homologene: 21207
Tmem168
Name: transmembrane protein 168
Synonyms: 5730526F17Rik, 8430437G11Rik
Type: Gene
Species: Mouse
Chromosome: 6
NCBI: 101118
Homologene: 11202
Vmn2r99
Name: vomeronasal 2, receptor 99
Synonyms: EG665376
Type: Gene
Species: Mouse
Chromosome: 17
NCBI: 665376
Homologene: 115024
Cfap43
Name: cilia and flagella associated protein 43
Synonyms: 4930428C11Rik, 4632415N18Rik, 4930463G05Rik, D19Ertd652e, Wdr96
Type: Gene
Species: Mouse
Chromosome: 19
NCBI: 100048534
Homologene: 36425
Rbm20
Name: RNA binding motif protein 20
Synonyms: 2010003H22Rik, 1110018J23Rik
Type: Gene
Species: Mouse
Chromosome: 19
NCBI: 73713
Homologene: 28386
Or2g1
Name: olfactory receptor family 2 subfamily G member 1
Synonyms: MOR256-9, GA_x6K02T2PSCP-2255106-2256035, Olfr123
Type: Gene
Species: Mouse
Chromosome: 17
NCBI: 258623
Homologene: 105169
Disc1
Name: disrupted in schizophrenia 1
Type: Gene
Species: Mouse
Chromosome: 8
NCBI: 244667
HGNC: HGNC:2888
Homologene: 10257
Dyrk4
Name: dual-specificity tyrosine phosphorylation regulated kinase 4
Synonyms: Dyrk4b, Dyrk4a
Type: Gene
Species: Mouse
Chromosome: 6
NCBI: 101320
HGNC: HGNC:3095
Homologene: 37858
Gm10608
Name: predicted gene 10608
Synonyms: EG546165
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 546165
VEGA: 9
Adgrg4
Name: adhesion G protein-coupled receptor G4
Synonyms: LOC236798, PGR17, Gpr112
Type: Gene
Species: Mus musculus (mouse)
Chromosome: X
NCBI: 236798
Homologene: 72131
Pex11g
Name: peroxisomal biogenesis factor 11 gamma
Synonyms: Pex11gamma, 1810049N02Rik, 1810022F11Rik, Pex11c
Type: Gene
Species: Mouse
Chromosome: 8
NCBI: 69129
Homologene: 12298
Genetic Alterations
ENU-induced transitions at the following base pair locations (GRCm38):
  • G to T, chromosome 1 at 63,074,503 bp
  • T to A, chromosome 1 at 82,715,332 bp
  • A to T, chromosome 2 at 17,378,106 bp
  • A to G, chromosome 2 at 94,376,146 bp
  • C to G, chromosome 2 at 112,675,873 bp
  • G to T, chromosome 3 at 122,544,579 bp
  • T to C, chromosome 4 at 123,380,420 bp
  • T to C, chromosome 5 at 101,870,036 bp
  • C to A, chromosome 6 at 13,583,052 bp
  • T to C, chromosome 6 at 56,728,665 bp
  • T to A, chromosome 6 at 86,446,186 bp
  • G to T, chromosome 6 at 95,579,238 bp
  • A to T, chromosome 6 at 121,387,824 bp
  • A to G, chromosome 6 at 126,885,305 bp
  • T to A, chromosome 7 at 132,247,875 bp
  • G to A, chromosome 8 at 3,465,787 bp
  • T to C, chromosome 8 at 45,087,520 bp
  • A to G, chromosome 8 at 125,088,135 bp
  • A to G, chromosome 9 at 8,961,452 bp
  • TACACACACACACACACACACACACACACACACACACACACACACACACACACACA to TACACACACACACACACACACACACACACACACACACACACACACACACA, chromosome 9 at 119,160,662 bp
  • T to A, chromosome 10 at 120,170,373 bp
  • T to C, chromosome 11 at 59,131,646 bp
  • A to G, chromosome 11 at 77,398,256 bp
  • C to T, chromosome 11 at 106,520,003 bp
  • T to A, chromosome 14 at 54,679,333 bp
  • A to T, chromosome 14 at 87,506,599 bp
  • T to C, chromosome 17 at 19,378,990 bp
  • T to A, chromosome 17 at 24,578,037 bp
  • A to T, chromosome 17 at 37,796,115 bp
  • C to T, chromosome 18 at 74,695,403 bp
  • G to A, chromosome 19 at 4,292,417 bp
  • G to T, chromosome 19 at 47,765,979 bp
  • T to C, chromosome 19 at 53,813,337 bp
  • C to T, chromosome X at 56,917,754 bp
Genotype Determination
Phenotype
G1 male heterozygous mice are viable and fertile. The G1 mice were not characterized prior to archiving.
Strain GQC Summary
The MMRRC Centers have developed a Strain GQC pipeline using MiniMUGA array genotyping to provide additional information on strain backgrounds for MMRRC strains. For more information on whether data may be available, or to request genotyping for a strain of interest, please contact MMRRC_GeneticQC@med.unc.edu. Older strains may not have this information available.
Suggested Control Mice
Littermates of all relevant genotypes.
Donor
Bruce Beutler, M.D., University of Texas Southwestern Medical Center.
Primary Reference
MUTAGENETIX record for R3947 (G1). B. Beutler and colleagues, Center for the Genetics of Host Defense, UT Southwestern, Dallas, TX.
Strain Development
C57BL/6J mice were injected with ENU, resulting in G0 mice that were bred back to C57BL/6J. Sperm was archived from G1 male mice that produced viable G2 mice.


Disclaimer: If MMRRC Strain Genetic Quality Control (GQC; based on MiniMUGA genotyping and analysis) has been completed for this strain, the information might differ from the genetic background information provided by the submitter. MiniMUGA genetic analysis is done on a strain’s tissue samples taken when archived by or ordered from the assigned MMRRC Center.

Colony and Husbandry Information

Colony Surveillance Program and Current Health Reports

Mice recovered from a cryo-archive will have health surveillance performed on recipient females. Health reports will be provided prior to shipment. If you require additional health status information, please email mmrrc@missouri.edu.
Coat Color
Black
MMRRC Breeding System
Random intra-strain mating
Breeding Scheme(s)
When maintaining a live colony, heterozygous mice may be bred together, bred with wild-type siblings, or bred with C57BL/6J inbred mice.
Overall Breeding Performance
Undetermined; during development, mating was done with heterozygous males; viability, fertility and other breeding statistics for heterozygous females and homozygotes are unverified, but presumably would be similar to the C57BL/6J background strain
Average litter size
Undetermined
Recommended wean age
3 weeks

Order Request Information

Limited quantities of breeder mice (recovered litter) are available from a cryoarchive; recovered litter usually available to ship in 3 to 4 months.

Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

Distribution of this strain requires submission of the MMRRC Conditions of Use (COU). A link to the COU web form will be provided via email after an order has been placed; the form should be completed then or the email forwarded to your institutional official for completion.

The donor or their institution limits the distribution to non-profit institutions only.

Additional charges may apply for any special requests. Shipping costs are in addition to the basic distribution/resuscitation fees. Information on shipping costs and any additional charges will be provided by the supplying MMRRC facility.

Click button to Request this one strain. (Use the MMRRC Catalog Search to request more than one strain.)
MMRRC Item # Description Distribution Fee / Unit (US $)
*Shipping & Handling not included*
Units Notes
040927-MU-RESUS Litter recovered from cryo-archive $5,475.00 / Non-Profit Litter Recovered litter4; additional fees for any special requests.
Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

Some MMRRC strains were submitted by the donor as cryopreserved germplasm, and because these strains were not cryopreserved by the MMRRC, we have not assessed the quality, nor genotype, of this material. Our expertise in reviving mice from various qualities of frozen sperm and embryos, using methods like IVF and ICSI, gives us confidence in successful recoveries in most cases. However, due to the uncertain quality of these samples, we'll limit revival attempts to two per order. Additional attempts are available for a fee, on top of standard charges, if requested. It's important to note that some strains may lack the expected mutation, so we can't assure successful order fulfillment until we attempt to revive the strain.

1 The distribution fee covers the expense of rederiving mice from a live mouse; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

2 An aliquot contains a sufficient number of embryos (in one or more vials or straws and based on the transfer success rate of the MMRRC facility) to transfer into one to three recipients. The MMRRC makes no guarantee concerning embryo transfer success experienced in the recipient investigator's laboratory. Neither gender nor genotype ratios are guaranteed.

3 An aliquot is one straw or vial with sufficient sperm to recover at least one litter of mice, as per provided protocols, when performed at the MMRRC facility. The MMRRC makes no guarantee concerning the success of these procedures when performed outside the MMRRC facilities.

4 The distribution fee covers the expense of resuscitating mice from the cryo-archive; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

To request material from the MMRRC: Please fill out our on-line request form (accessible from the catalog search results page, or click the Request this Strain button in the fees section). If you have questions or need assistance completing this form, you may call Customer Service at (800) 910-2291 (in USA or Canada) or (530) 757-5710 (international calls). Before you call, please have with you: the MMRRC item number, quantity needed, Bill-to and Ship-to contact information.