Loading Mouse GIF
Loading...

Strain Name:
C57BL/6J-MtgxR4015Btlr/Mmmh
Stock Number:
040952-MU
Citation ID:
RRID:MMRRC_040952-MU
Other Names:
R4015 (G1), C57BL/6J-MtgxR4015Btlr
Major Collection:

Strain Information

Tyr
Name: tyrosinase
Synonyms: skc35, Oca1
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 22173
Homologene: 30969
Ptch1
Name: patched 1
Synonyms: Ptc, Patched 1, Ptc1, A230106A15Rik, wig
Type: Gene
Species: Mouse
Chromosome: 13
NCBI: 19206
HGNC: HGNC:9585
Homologene: 223
Igf2bp2
Name: insulin-like growth factor 2 mRNA binding protein 2
Synonyms: IMP-2, C330012H03Rik, IMP2
Type: Gene
Species: Mouse
Chromosome: 16
NCBI: 319765
Homologene: 4774
Wdr70
Name: WD repeat domain 70
Synonyms: 4833422F06Rik
Type: Gene
Species: Mouse
Chromosome: 15
NCBI: 545085
VEGA: 15
Homologene: 9972
Setx
Name: senataxin
Synonyms: A930037J23Rik, Als4
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 269254
HGNC: HGNC:445
Homologene: 41003
Ddias
Name: DNA damage-induced apoptosis suppressor
Synonyms: noxin, 4632434I11Rik
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 74041
Homologene: 51655
Trio
Name: triple functional domain (PTPRF interacting)
Synonyms: 6720464I07Rik, Solo
Type: Gene
Species: Mouse
Chromosome: 15
NCBI: 223435
VEGA: 15
Homologene: 20847
Plekhm2
Name: pleckstrin homology domain containing, family M (with RUN domain) member 2
Synonyms: 2310034J19Rik
Type: Gene
Species: Mouse
Chromosome: 4
NCBI: 69582
Homologene: 19575
Abcb6
Name: ATP-binding cassette, sub-family B member 6
Synonyms: 1200005B17Rik
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 74104
HGNC: HGNC:47
Homologene: 11375
Pcdh17
Name: protocadherin 17
Synonyms: LOC219228, C030033F14Rik
Type: Gene
Species: Mouse
Chromosome: 14
NCBI: 219228
VEGA: 14
Homologene: 8700
Srcap
Name: Snf2-related CREBBP activator protein
Synonyms: F630004O05Rik, B930091H02Rik, D030022P06Rik
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 100043597
Homologene: 38213
Uggt2
Name: UDP-glucose glycoprotein glucosyltransferase 2
Synonyms: 3110001A05Rik, 1810064L21Rik, 3110027P15Rik, A230065J02Rik, Ugcgl2
Type: Gene
Species: Mouse
Chromosome: 14
NCBI: 66435
Homologene: 56875
Dnah10
Name: dynein, axonemal, heavy chain 10
Synonyms: Dnahc10
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 56087
HGNC: HGNC:2941
Homologene: 25816
Unc13b
Name: unc-13 homolog B
Synonyms: Unc13h2, Munc13-2
Type: Gene
Species: Mouse
Chromosome: 4
NCBI: 22249
Homologene: 31376
Myo3a
Name: myosin IIIA
Synonyms: 9030416P08Rik
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 667663
HGNC: HGNC:7601
Homologene: 49486
Nalcn
Name: sodium leak channel, non-selective
Synonyms: A530023G15Rik, Vgcnl1
Type: Gene
Species: Mouse
Chromosome: 14
NCBI: 338370
VEGA: 14
Homologene: 21832
Col5a2
Name: collagen, type V, alpha 2
Synonyms: 1110014L14Rik
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 12832
HGNC: HGNC:2210
Homologene: 20119
Lrp1b
Name: low density lipoprotein-related protein 1B
Synonyms: 9630004P12Rik
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 94217
HGNC: HGNC:6693
Homologene: 56810
Muc5b
Name: mucin 5, subtype B, tracheobronchial
Synonyms: MUC9, MUC5, 2300002I04Rik
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 74180
HGNC: HGNC:7516
Homologene: 136756
Cyp2b19
Name: cytochrome P450, family 2, subfamily b, polypeptide 19
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 13090
HGNC: HGNC:2615
Homologene: 104114
Sult6b2
Name: sulfotransferase family 6B, member 2
Synonyms: LOC330440, Gm766
Type: Gene
Species: Mouse
Chromosome: 6
NCBI: 330440
Homologene: 66632
Vmn1r214
Name: vomeronasal 1 receptor 214
Synonyms: V1rh5
Type: Gene
Species: Mouse
Chromosome: 13
NCBI: 171248
Homologene: 110880
Cacna1e
Name: calcium channel, voltage-dependent, R type, alpha 1E subunit
Synonyms: Cav2.3, Cchra1, alpha1E
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 12290
HGNC: HGNC:1392
Homologene: 20185
Ano3
Name: anoctamin 3
Synonyms: B230324K02Rik, Tmem16c
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 228432
Homologene: 57147
Ccdc66
Name: coiled-coil domain containing 66
Synonyms: E230015L20Rik
Type: Gene
Species: Mouse
Chromosome: 14
NCBI: 320234
VEGA: 14
Homologene: 35309
Rbm12b1
Name: RNA binding motif protein 12 B1
Synonyms: 3000004N20Rik, Rbm12b
Type: Gene
Species: Mouse
Chromosome: 4
NCBI: 72397
Homologene: 28658
Cfap161
Name: cilia and flagella associated protein 161
Synonyms: 1700026D08Rik
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 75556
Homologene: 12605
Coq6
Name: coenzyme Q6 monooxygenase
Synonyms: 5930427M12Rik
Type: Gene
Species: Mouse
Chromosome: 12
NCBI: 217707
Homologene: 6039
Nudt7
Name: nudix hydrolase 7
Synonyms: 1300007B24Rik, 2210404C19Rik, nudix (nucleoside diphosphate linked moiety X)-type motif 7
Type: Gene
Species: Mouse
Chromosome: 8
NCBI: 67528
HGNC: HGNC:8054
Homologene: 41564
Dctpp1
Name: dCTP pyrophosphatase 1
Synonyms: RS21-C6, 2410015N17Rik
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 66422
Homologene: 11329
Celf3
Name: CUGBP, Elav-like family member 3
Synonyms: BRUNOL1, ERDA4, CAGH4, 4930415M08Rik, Tnrc4
Type: Gene
Species: Mouse
Chromosome: 3
NCBI: 78784
Homologene: 48510
Gm10608
Name: predicted gene 10608
Synonyms: EG546165
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 546165
VEGA: 9
Cyp4a14
Name: cytochrome P450, family 4, subfamily a, polypeptide 14
Type: Gene
Species: Mouse
Chromosome: 4
NCBI: 13119
Homologene: 134697
Gm15401
Name: predicted gene 15401
Synonyms: ENSMUSG00000072999
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 6
NCBI: 100038714
Tef
Name: thyrotroph embryonic factor
Synonyms: 2310028D20Rik
Type: Gene
Species: Mouse
Chromosome: 15
NCBI: 21685
Homologene: 31140
Genetic Alterations
ENU-induced transitions at the following base pair locations (GRCm38):
  • T to C, chromosome 1 at 45,403,471 bp
  • C to T, chromosome 1 at 75,174,491 bp
  • T to C, chromosome 1 at 154,482,585 bp
  • A to G, chromosome 2 at 22,578,170 bp
  • GTGGCT to GT, chromosome 2 at 29,154,061 bp
  • A to G, chromosome 2 at 40,802,984 bp
  • A to G, chromosome 2 at 110,774,976 bp
  • T to C, chromosome 3 at 94,487,198 bp
  • T to C, chromosome 4 at 12,145,491 bp
  • G to A, chromosome 4 at 43,237,801 bp
  • G to T, chromosome 4 at 115,491,134 bp
  • G to A, chromosome 4 at 141,642,528 bp
  • A to G, chromosome 5 at 124,777,926 bp
  • A to G, chromosome 6 at 72,636,399 bp
  • T to A, chromosome 6 at 142,790,262 bp
  • T to C, chromosome 7 at 26,762,343 bp
  • C to T, chromosome 7 at 83,780,271 bp
  • A to G, chromosome 7 at 87,437,940 bp
  • T to C, chromosome 7 at 92,859,861 bp
  • G to A, chromosome 7 at 127,257,113 bp
  • C to A, chromosome 7 at 127,525,423 bp
  • G to A, chromosome 7 at 141,863,630 bp
  • C to T, chromosome 8 at 114,136,505 bp
  • CAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGA to CAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGA, chromosome 9 at 119,160,716 bp
  • A to G, chromosome 11 at 59,463,694 bp
  • A to G, chromosome 12 at 84,366,897 bp
  • G to A, chromosome 13 at 23,035,350 bp
  • T to G, chromosome 13 at 63,524,959 bp
  • T to C, chromosome 13 at 114,820,798 bp
  • A to G, chromosome 14 at 27,483,836 bp
  • T to C, chromosome 14 at 84,447,107 bp
  • T to C, chromosome 14 at 119,026,433 bp
  • T to G, chromosome 14 at 123,486,387 bp
  • A to T, chromosome 15 at 8,079,214 bp
  • C to T, chromosome 15 at 27,744,101 bp
  • T to C, chromosome 15 at 81,823,605 bp
  • T to C, chromosome 16 at 22,063,676 bp
Genotype Determination
Phenotype
G1 male heterozygous mice are viable and fertile. The G1 mice were not characterized prior to archiving.
Strain Development
C57BL/6J mice were injected with ENU, resulting in G0 mice that were bred back to C57BL/6J. Sperm was archived from G1 male mice that produced viable G2 mice.
Suggested Control Mice
Wild-type littermates or C57BL/6J mice
MMRRC Genetic QC Summary
The MMRRC Centers have developed a genetic QC pipeline using MiniMUGA array genotyping to provide additional information on strain backgrounds for MMRRC congenic and inbred strains. For more information on when data may be available, or to request genotyping for a strain of interest, please contact mmrrc@missouri.edu. Older strains may not have this information.
Donor
Bruce Beutler, M.D., University of Texas Southwestern Medical Center.
Primary Reference
MUTAGENETIX record for R4015 (G1). B. Beutler and colleagues, Center for the Genetics of Host Defense, UT Southwestern, Dallas, TX.

Colony and Husbandry Information

Colony Surveillance Program and Current Health Reports

Mice recovered from a cryo-archive will have health surveillance performed on recipient females. Health reports will be provided prior to shipment. If you require additional health status information, please email mmrrc@missouri.edu.
Coat Color
Black
MMRRC Breeding System
Random intra-strain mating
Breeding Scheme(s)
When maintaining a live colony, heterozygous mice may be bred together, bred with wild-type siblings, or bred with C57BL/6J inbred mice.
Overall Breeding Performance
Undetermined; during development, mating was done with heterozygous males; viability, fertility and other breeding statistics for heterozygous females and homozygotes are unverified, but presumably would be similar to the C57BL/6J background strain
Average litter size
Undetermined
Recommended wean age
3 weeks

Order Request Information

Limited quantities of breeder mice (recovered litter) are available from a cryoarchive; recovered litter usually available to ship in 3 to 4 months.

Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

Distribution of this strain requires submission of the MMRRC Conditions of Use (COU). A link to the COU web form will be provided via email after an order has been placed; the form should be completed then or the email forwarded to your institutional official for completion.

The donor or their institution limits the distribution to non-profit institutions only.

Additional charges may apply for any special requests. Shipping costs are in addition to the basic distribution/resuscitation fees. Information on shipping costs and any additional charges will be provided by the supplying MMRRC facility.

Click button to Request this one strain. (Use the MMRRC Catalog Search to request more than one strain.)
MMRRC Item # Description Distribution Fee / Unit (US $)
*Shipping & Handling not included*
Units Notes
040952-MU-RESUS Litter recovered from cryo-archive $5,475.00 / Non-Profit Litter Recovered litter4; additional fees for any special requests.
Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

Some MMRRC strains were submitted by the donor as cryopreserved germplasm, and because these strains were not cryopreserved by the MMRRC, we have not assessed the quality, nor genotype, of this material. Our expertise in reviving mice from various qualities of frozen sperm and embryos, using methods like IVF and ICSI, gives us confidence in successful recoveries in most cases. However, due to the uncertain quality of these samples, we'll limit revival attempts to two per order. Additional attempts are available for a fee, on top of standard charges, if requested. It's important to note that some strains may lack the expected mutation, so we can't assure successful order fulfillment until we attempt to revive the strain.

1 The distribution fee covers the expense of rederiving mice from a live mouse; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

2 An aliquot contains a sufficient number of embryos (in one or more vials or straws and based on the transfer success rate of the MMRRC facility) to transfer into one to three recipients. The MMRRC makes no guarantee concerning embryo transfer success experienced in the recipient investigator's laboratory. Neither gender nor genotype ratios are guaranteed.

3 An aliquot is one straw or vial with sufficient sperm to recover at least one litter of mice, as per provided protocols, when performed at the MMRRC facility. The MMRRC makes no guarantee concerning the success of these procedures when performed outside the MMRRC facilities.

4 The distribution fee covers the expense of resuscitating mice from the cryo-archive; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

To request material from the MMRRC: Please fill out our on-line request form (accessible from the catalog search results page, or click the Request this Strain button in the fees section). If you have questions or need assistance completing this form, you may call Customer Service at (800) 910-2291 (in USA or Canada) or (530) 757-5710 (international calls). Before you call, please have with you: the MMRRC item number, quantity needed, Bill-to and Ship-to contact information.