Strain Name:
C57BL/6J-MtgxR4062Btlr/Mmmh
Stock Number:
040971-MU
Citation ID:
RRID:MMRRC_040971-MU
Other Names:
R4062 (G1), C57BL/6J-MtgxR4062Btlr
Major Collection:

Strain Information

Espl1
Name: extra spindle pole bodies 1, separase
Synonyms: PRCE, separase, SSE, ESP1, PRCE, Cerp
Type: Gene
Species: Mouse
Chromosome: 15
NCBI: 105988
VEGA: 15
Homologene: 32151
Ep400
Name: E1A binding protein p400
Synonyms: p400, mDomino, 1700020J09Rik
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 75560
Homologene: 38779
Wwp1
Name: WW domain containing E3 ubiquitin protein ligase 1
Synonyms: SDRP1, Tiul1, AIP5, 8030445B08Rik
Type: Gene
Species: Mouse
Chromosome: 4
NCBI: 107568
Homologene: 21385
Hnrnpll
Name: heterogeneous nuclear ribonucleoprotein L-like
Synonyms: 2510028H02Rik, 2810036L13Rik, Hnrpll
Type: Gene
Species: Mouse
Chromosome: 17
NCBI: 72692
Homologene: 26701
Kdm6a
Name: lysine (K)-specific demethylase 6A
Synonyms: Utx
Type: Gene
Species: Mus musculus (mouse)
Chromosome: X
NCBI: 22289
Homologene: 7586
Scamp2
Name: secretory carrier membrane protein 2
Synonyms: Sc2
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 24044
VEGA: 9
Homologene: 4163
Cdc40
Name: cell division cycle 40
Synonyms: PRP17, EHB3, 1200003H23Rik
Type: Gene
Species: Mouse
Chromosome: 10
NCBI: 71713
VEGA: 10
Homologene: 5716
Zfp292
Name: zinc finger protein 292
Synonyms: Zn-16, Zn-15, Krox-10, Zfp-15, 9430062L07Rik, 5730450D02Rik, Zfp15
Type: Gene
Species: Mouse
Chromosome: 4
NCBI: 30046
Homologene: 8493
Tenm2
Name: teneurin transmembrane protein 2
Synonyms: Ten-m2, D3Bwg1534e, 9330187F13Rik, 2610040L17Rik, Odz2
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 23964
Homologene: 22672
Gls
Name: glutaminase
Synonyms: B230365M23Rik
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 14660
HGNC: HGNC:4331
Homologene: 22726
Mbnl1
Name: muscleblind like splicing regulator 1
Type: Gene
Species: Mouse
Chromosome: 3
NCBI: 56758
HGNC: HGNC:6923
Homologene: 23186
Cd320
Name: CD320 antigen
Synonyms: NG29, D17Ertd716e, 8D6, VLDL, 425O18-1
Type: Gene
Species: Mouse
Chromosome: 17
NCBI: 54219
Homologene: 9573
Usf2
Name: upstream transcription factor 2
Synonyms: Usf-2, bHLHb12
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 22282
Homologene: 2527
Erap1
Name: endoplasmic reticulum aminopeptidase 1
Synonyms: PILSAP, ERAAP, Arts1
Type: Gene
Species: Mouse
Chromosome: 13
NCBI: 80898
VEGA: 13
Homologene: 56754
Bnip3l
Name: BCL2/adenovirus E1B interacting protein 3-like
Synonyms: Nix, D14Ertd719e, Nip3L
Type: Gene
Species: Mouse
Chromosome: 14
NCBI: 12177
HGNC: HGNC:1085
Homologene: 3195
Anxa11
Name: annexin A11
Synonyms: Anx11, A830099O17Rik
Type: Gene
Species: Mouse
Chromosome: 14
NCBI: 11744
HGNC: HGNC:535
Homologene: 22759
Fat1
Name: FAT atypical cadherin 1
Synonyms: mFat1, 2310038E12Rik, Fath
Type: Gene
Species: Mouse
Chromosome: 8
NCBI: 14107
HGNC: HGNC:3595
Homologene: 66302
Adam17
Name: a disintegrin and metallopeptidase domain 17
Synonyms: Tace, CD156b
Type: Gene
Species: Mouse
Chromosome: 12
NCBI: 11491
HGNC: HGNC:195
Homologene: 2395
Incenp
Name: inner centromere protein
Synonyms: 2700067E22Rik
Type: Gene
Species: Mouse
Chromosome: 19
NCBI: 16319
VEGA: 19
HGNC: HGNC:6058
Homologene: 9624
Septin9
Name: septin 9
Synonyms: SL3-3 integration site 1, Sint1, Msf, MSF1, PNUTL4, Sept9
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 53860
HGNC: HGNC:7323
Homologene: 90949
Eme2
Name: essential meiotic structure-specific endonuclease subunit 2
Synonyms: 2810013J18Rik
Type: Gene
Species: Mouse
Chromosome: 17
NCBI: 193838
Homologene: 19180
Gorasp2
Name: golgi reassembly stacking protein 2
Synonyms: GRASP55, 5730520M13Rik, 9430094F20Rik, GOLPH2, GRS2, p59, ENSMUSG00000075299
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 70231
Homologene: 9180
Tpcn1
Name: two pore channel 1
Synonyms: 5730403B01Rik
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 252972
Homologene: 9905
Gcdh
Name: glutaryl-Coenzyme A dehydrogenase
Synonyms: D17825
Type: Gene
Species: Mouse
Chromosome: 8
NCBI: 270076
HGNC: HGNC:4189
Homologene: 130
Clec4b1
Name: C-type lectin domain family 4, member b1
Synonyms: 1810046I24Rik, 1810046I24Rik, DCARbeta, DCAR, mDcar2
Type: Gene
Species: Mouse
Chromosome: 6
NCBI: 69810
Homologene: 130350
Plagl1
Name: pleiomorphic adenoma gene-like 1
Synonyms: Zac1
Type: Gene
Species: Mouse
Chromosome: 10
NCBI: 22634
HGNC: HGNC:9046
Homologene: 31401
Soat2
Name: sterol O-acyltransferase 2
Synonyms: ACAT2, D15Wsu97e
Type: Gene
Species: Mouse
Chromosome: 15
NCBI: 223920
Homologene: 68355
Isl1
Name: ISL1 transcription factor, LIM/homeodomain
Synonyms: Islet 1
Type: Gene
Species: Mouse
Chromosome: 13
NCBI: 16392
HGNC: HGNC:6132
Homologene: 1661
Cyp4a10
Name: cytochrome P450, family 4, subfamily a, polypeptide 10
Synonyms: RP1, Cyp4a, D4Rp1, Msp-3
Type: Gene
Species: Mouse
Chromosome: 4
NCBI: 13117
HGNC: HGNC:2642
Homologene: 128044
Rims1
Name: regulating synaptic membrane exocytosis 1
Synonyms: RIM1, RIM1a, C030033M19Rik, RIM1alpha
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 116837
Homologene: 128399
Obscn
Name: obscurin, cytoskeletal calmodulin and titin-interacting RhoGEF
Synonyms: LOC380698, OTTMUSG00000005786
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 380698
Homologene: 70869
Mast3
Name: microtubule associated serine/threonine kinase 3
Type: Gene
Species: Mouse
Chromosome: 8
NCBI: 546071
Homologene: 66191
Ltbp2
Name: latent transforming growth factor beta binding protein 2
Type: Gene
Species: Mouse
Chromosome: 12
NCBI: 16997
HGNC: HGNC:6715
Homologene: 369
Sh3pxd2b
Name: SH3 and PX domains 2B
Synonyms: G431001E03Rik, Fad49, Tks4
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 268396
Homologene: 27952
Adamtsl4
Name: ADAMTS-like 4
Synonyms: Tsrc1
Type: Gene
Species: Mouse
Chromosome: 3
NCBI: 229595
Homologene: 23141
Greb1l
Name: growth regulation by estrogen in breast cancer-like
Synonyms: mKIAA4095, AK220484
Type: Gene
Species: Mouse
Chromosome: 18
NCBI: 381157
Homologene: 73393
Usp13
Name: ubiquitin specific peptidase 13 (isopeptidase T-3)
Synonyms: IsoT-3, ISOT3, 2700071E21Rik
Type: Gene
Species: Mouse
Chromosome: 3
NCBI: 72607
Homologene: 68372
Fanca
Name: Fanconi anemia, complementation group A
Type: Gene
Species: Mouse
Chromosome: 8
NCBI: 14087
HGNC: HGNC:3582
Homologene: 108
Lcp1
Name: lymphocyte cytosolic protein 1
Synonyms: L-fimbrin, Pls2, D14Ertd310e, L-plastin
Type: Gene
Species: Mouse
Chromosome: 14
NCBI: 18826
HGNC: HGNC:6528
Homologene: 80174
Dytn
Name: dystrotelin
Synonyms: LOC241073
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 241073
Homologene: 104042
Rab3il1
Name: RAB3A interacting protein (rabin3)-like 1
Synonyms: 1200014K04Rik, Rab3ail1
Type: Gene
Species: Mouse
Chromosome: 19
NCBI: 74760
HGNC: HGNC:9780
Homologene: 40880
Alkbh2
Name: alkB homolog 2, alpha-ketoglutarate-dependent dioxygenase
Synonyms: Abh2, mABH2
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 231642
Homologene: 18393
Emilin3
Name: elastin microfibril interfacer 3
Synonyms: Emilin5, 1110013O17Rik, EMILIN-T
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 280635
Homologene: 18817
Otop2
Name: otopetrin 2
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 237987
Homologene: 27803
Trdn
Name: triadin
Synonyms: 2310045H21Rik, triadin-3, triadin-2, triadin-1, triadin 3, triadin 2, triadin 1, EG432451
Type: Gene
Species: Mouse
Chromosome: 10
NCBI: 76757
VEGA: 10
Homologene: 38137
Il18r1
Name: interleukin 18 receptor 1
Synonyms: Il1rrp, Il18ralpha
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 16182
HGNC: HGNC:5988
Homologene: 2861
Nkd2
Name: naked cuticle 2
Synonyms: 2210403L10Rik
Type: Gene
Species: Mouse
Chromosome: 13
NCBI: 72293
Homologene: 12459
Mrps24
Name: mitochondrial ribosomal protein S24
Synonyms: Rpms24, 3110030K20Rik
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 64660
Homologene: 57043
Zfp353-ps
Name: zinc finger protein 353, pseudogene
Synonyms: Zfp353
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 8
NCBI: 234203
Rinl
Name: Ras and Rab interactor-like
Synonyms: 9930116N10Rik, 5830482F20Rik
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 320435
Homologene: 18556
1700019A02Rik
Name: RIKEN cDNA 1700019A02 gene
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 69397
Duoxa2
Name: dual oxidase maturation factor 2
Synonyms: 9030623N16Rik, Nip2
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 66811
Homologene: 57037
Vmn1r118
Name: vomeronasal 1 receptor 118
Synonyms: Gm8542
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 667259
Homologene: 104166
Gm28417
Name: predicted gene 28417
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 1
NCBI: 118567734
RP23-105H6.2
Name:
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 2
Or9g10
Name: olfactory receptor family 9 subfamily G member 10
Synonyms: GA_x6K02T2Q125-47232672-47233052, GA_x6K02T2Q125-47228321-47229256, MOR213-7P, MOR213-1, MOR213-1_p, Olfr1010, Olfr1011
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 2
NCBI: 258255
Homologene: 45796
Genetic Alterations
ENU-induced transitions at the following base pair locations (GRCm38):
  • G to T, chromosome 1 at 22,533,583 bp
  • A to T, chromosome 1 at 34,472,930 bp
  • G to A, chromosome 1 at 40,474,936 bp
  • T to C, chromosome 1 at 52,196,748 bp
  • A to T, chromosome 1 at 53,158,769 bp
  • A to G, chromosome 1 at 63,647,447 bp
  • T to C, chromosome 2 at 70,679,513 bp
  • C to T, chromosome 2 at 85,753,791 bp
  • G to T, chromosome 2 at 122,300,577 bp
  • T to C, chromosome 2 at 160,907,796 bp
  • A to G, chromosome 2 at 169,962,325 bp
  • T to C, chromosome 3 at 32,881,423 bp
  • T to C, chromosome 3 at 60,603,755 bp
  • T to C, chromosome 3 at 95,677,554 bp
  • A to T, chromosome 4 at 19,638,644 bp
  • A to G, chromosome 4 at 34,810,863 bp
  • A to T, chromosome 4 at 115,519,701 bp
  • A to T, chromosome 5 at 110,741,981 bp
  • C to T, chromosome 5 at 114,124,226 bp
  • G to A, chromosome 5 at 120,557,897 bp
  • C to A, chromosome 6 at 123,068,484 bp
  • G to T, chromosome 7 at 20,912,008 bp
  • T to C, chromosome 7 at 28,790,715 bp
  • T to A, chromosome 7 at 30,946,986 bp
  • A to G, chromosome 8 at 42,081,689 bp
  • A to T, chromosome 8 at 45,025,481 bp
  • A to G, chromosome 8 at 70,781,194 bp
  • T to C, chromosome 8 at 84,892,453 bp
  • T to C, chromosome 8 at 123,275,172 bp
  • G to T, chromosome 9 at 57,577,262 bp
  • TGAGCCAGAGCCAGAGCCAGAGCCAGAGCCAGAGCCAGAGCCAGAGCC to TGAGCCAGAGCCAGAGCCAGAGCCAGAGCCAGAGCCAGAGCCAGAGCCAGAGCC, chromosome 10 at 13,128,771 bp
  • A to G, chromosome 10 at 33,257,087 bp
  • A to T, chromosome 10 at 40,849,852 bp
  • G to A, chromosome 11 at 5,704,676 bp
  • G to T, chromosome 11 at 32,422,263 bp
  • C to T, chromosome 11 at 36,008,655 bp
  • T to C, chromosome 11 at 59,082,710 bp
  • G to A, chromosome 11 at 115,329,375 bp
  • T to C, chromosome 11 at 117,352,265 bp
  • T to C, chromosome 12 at 21,325,457 bp
  • A to G, chromosome 12 at 84,809,144 bp
  • C to T, chromosome 13 at 73,822,690 bp
  • G to T, chromosome 13 at 74,663,536 bp
  • T to A, chromosome 13 at 116,303,090 bp
  • T to C, chromosome 14 at 25,874,674 bp
  • T to C, chromosome 14 at 67,008,738 bp
  • T to C, chromosome 14 at 75,215,180 bp
  • A to G, chromosome 15 at 102,161,091 bp
  • A to G, chromosome 15 at 102,312,989 bp
  • T to C, chromosome 17 at 24,892,576 bp
  • T to A, chromosome 17 at 33,847,517 bp
  • T to C, chromosome 17 at 80,032,772 bp
  • G to A, chromosome 18 at 10,522,150 bp
  • A to T, chromosome 19 at 9,883,778 bp
  • T to C, chromosome 19 at 10,026,624 bp
  • A to G, chromosome X at 18,250,875 bp
Genotype Determination
Phenotype
G1 male heterozygous mice are viable and fertile. The G1 mice were not characterized prior to archiving.
Strain Development
C57BL/6J mice were injected with ENU, resulting in G0 mice that were bred back to C57BL/6J. Sperm was archived from G1 male mice that produced viable G2 mice.
Suggested Control Mice
Wild-type littermates or C57BL/6J mice
MMRRC Genetic QC Summary
The MMRRC Centers have developed a genetic QC pipeline using MiniMUGA array genotyping to provide additional information on strain backgrounds for MMRRC congenic and inbred strains. For more information on when data may be available, or to request genotyping for a strain of interest, please contact mmrrc@missouri.edu. Older strains may not have this information.
Donor
Bruce Beutler, M.D., University of Texas Southwestern Medical Center.
Primary Reference
MUTAGENETIX record for R4062 (G1). B. Beutler and colleagues, Center for the Genetics of Host Defense, UT Southwestern, Dallas, TX.

Colony and Husbandry Information

Colony Surveillance Program and Current Health Reports

Mice recovered from a cryo-archive will have health surveillance performed on recipient females. Health reports will be provided prior to shipment. If you require additional health status information, please email mmrrc@missouri.edu.
Coat Color
Black
MMRRC Breeding System
Random intra-strain mating
Breeding Scheme(s)
When maintaining a live colony, heterozygous mice may be bred together, bred with wild-type siblings, or bred with C57BL/6J inbred mice.
Overall Breeding Performance
Undetermined; during development, mating was done with heterozygous males; viability, fertility and other breeding statistics for heterozygous females and homozygotes are unverified, but presumably would be similar to the C57BL/6J background strain
Average litter size
Undetermined
Recommended wean age
3 weeks

Order Request Information

Limited quantities of breeder mice (recovered litter) are available from a cryoarchive; recovered litter usually available to ship in 3 to 4 months.

Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

Distribution of this strain requires submission of the MMRRC Conditions of Use (COU). A link to the COU web form will be provided via email after an order has been placed; the form should be completed then or the email forwarded to your institutional official for completion.

The donor or their institution limits the distribution to non-profit institutions only.

Additional charges may apply for any special requests. Shipping costs are in addition to the basic distribution/resuscitation fees. Information on shipping costs and any additional charges will be provided by the supplying MMRRC facility.

Click button to Request this one strain. (Use the MMRRC Catalog Search to request more than one strain.)
MMRRC Item # Description Distribution Fee / Unit (US $)
*Shipping & Handling not included*
Units Notes
040971-MU-RESUS Litter recovered from cryo-archive $5,475.00 / Non-Profit Litter Recovered litter4; additional fees for any special requests.
Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

Some MMRRC strains were submitted by the donor as cryopreserved germplasm, and because these strains were not cryopreserved by the MMRRC, we have not assessed the quality, nor genotype, of this material. Our expertise in reviving mice from various qualities of frozen sperm and embryos, using methods like IVF and ICSI, gives us confidence in successful recoveries in most cases. However, due to the uncertain quality of these samples, we'll limit revival attempts to two per order. Additional attempts are available for a fee, on top of standard charges, if requested. It's important to note that some strains may lack the expected mutation, so we can't assure successful order fulfillment until we attempt to revive the strain.

1 The distribution fee covers the expense of rederiving mice from a live mouse; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

2 An aliquot contains a sufficient number of embryos (in one or more vials or straws and based on the transfer success rate of the MMRRC facility) to transfer into one to three recipients. The MMRRC makes no guarantee concerning embryo transfer success experienced in the recipient investigator's laboratory. Neither gender nor genotype ratios are guaranteed.

3 An aliquot is one straw or vial with sufficient sperm to recover at least one litter of mice, as per provided protocols, when performed at the MMRRC facility. The MMRRC makes no guarantee concerning the success of these procedures when performed outside the MMRRC facilities.

4 The distribution fee covers the expense of resuscitating mice from the cryo-archive; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

To request material from the MMRRC: Please fill out our on-line request form (accessible from the catalog search results page, or click the Request this Strain button in the fees section). If you have questions or need assistance completing this form, you may call Customer Service at (800) 910-2291 (in USA or Canada) or (530) 757-5710 (international calls). Before you call, please have with you: the MMRRC item number, quantity needed, Bill-to and Ship-to contact information.