Strain Name:
C57BL/6J-MtgxR4062Btlr/Mmmh
Stock Number:
040971-MU
Citation ID:
RRID:MMRRC_040971-MU
Other Names:
R4062 (G1), C57BL/6J-MtgxR4062Btlr
Major Collection:

Gene Information

Espl1
Name: extra spindle pole bodies 1, separase
Synonyms: separase, PRCE, PRCE, ESP1, SSE, Cerp
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 15
Alteration at locus: Chemically Induced
NCBI: 105988
VEGA: 15
Homologene: 32151
Ep400
Name: E1A binding protein p400
Synonyms: 1700020J09Rik, p400, mDomino
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 5
Alteration at locus: Chemically Induced
NCBI: 75560
Homologene: 38779
Wwp1
Name: WW domain containing E3 ubiquitin protein ligase 1
Synonyms: SDRP1, AIP5, Tiul1, 8030445B08Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 4
Alteration at locus: Chemically Induced
NCBI: 107568
Homologene: 21385
Hnrnpll
Name: heterogeneous nuclear ribonucleoprotein L-like
Synonyms: Hnrpll, 2510028H02Rik, 2810036L13Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 17
Alteration at locus: Chemically Induced
NCBI: 72692
Homologene: 26701
Kdm6a
Name: lysine (K)-specific demethylase 6A
Synonyms: Utx
Type: Gene
Species: Mus musculus (mouse)
Chromosome: X
Alteration at locus: Chemically Induced
NCBI: 22289
Homologene: 7586
Scamp2
Name: secretory carrier membrane protein 2
Synonyms: Sc2
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 9
Alteration at locus: Chemically Induced
NCBI: 24044
VEGA: 9
Homologene: 4163
Cdc40
Name: cell division cycle 40
Synonyms: PRP17, 1200003H23Rik, EHB3
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 10
Alteration at locus: Chemically Induced
NCBI: 71713
VEGA: 10
Homologene: 5716
Zfp292
Name: zinc finger protein 292
Synonyms: Krox-10, Zn-15, Zfp-15, 5730450D02Rik, 9430062L07Rik, Zn-16, Zfp15
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 4
Alteration at locus: Chemically Induced
NCBI: 30046
Homologene: 8493
Tenm2
Name: teneurin transmembrane protein 2
Synonyms: 9330187F13Rik, 2610040L17Rik, Ten-m2, Odz2, D3Bwg1534e
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 11
Alteration at locus: Chemically Induced
NCBI: 23964
Homologene: 22672
Gls
Name: glutaminase
Synonyms: B230365M23Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 1
Alteration at locus: Chemically Induced
NCBI: 14660
HGNC: HGNC:4331
Homologene: 22726
Mbnl1
Name: muscleblind like splicing factor 1
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 3
Alteration at locus: Chemically Induced
NCBI: 56758
HGNC: HGNC:6923
Homologene: 23186
Cd320
Name: CD320 antigen
Synonyms: 8D6, NG29, VLDL, D17Ertd716e, 425O18-1
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 17
Alteration at locus: Chemically Induced
NCBI: 54219
Homologene: 9573
Usf2
Name: upstream transcription factor 2
Synonyms: Usf-2, bHLHb12
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 7
Alteration at locus: Chemically Induced
NCBI: 22282
Homologene: 2527
Erap1
Name: endoplasmic reticulum aminopeptidase 1
Synonyms: PILSAP, Arts1, ERAAP
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 13
Alteration at locus: Chemically Induced
NCBI: 80898
VEGA: 13
Homologene: 56754
Bnip3l
Name: BCL2/adenovirus E1B interacting protein 3-like
Synonyms: Nip3L, D14Ertd719e, Nix
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 14
Alteration at locus: Chemically Induced
NCBI: 12177
HGNC: HGNC:1085
Homologene: 3195
Anxa11
Name: annexin A11
Synonyms: A830099O17Rik, Anx11
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 14
Alteration at locus: Chemically Induced
NCBI: 11744
HGNC: HGNC:535
Homologene: 22759
Fat1
Name: FAT atypical cadherin 1
Synonyms: mFat1, 2310038E12Rik, Fath
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 8
Alteration at locus: Chemically Induced
NCBI: 14107
HGNC: HGNC:3595
Homologene: 66302
Adam17
Name: a disintegrin and metallopeptidase domain 17
Synonyms: Tace, CD156b
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 12
Alteration at locus: Chemically Induced
NCBI: 11491
HGNC: HGNC:195
Homologene: 2395
Incenp
Name: inner centromere protein
Synonyms: 2700067E22Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 19
Alteration at locus: Chemically Induced
NCBI: 16319
VEGA: 19
HGNC: HGNC:6058
Homologene: 9624
Septin9
Name: septin 9
Synonyms: Sept9, MSF1, PNUTL4, Sint1, SL3-3 integration site 1, Msf
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 11
Alteration at locus: Chemically Induced
NCBI: 53860
HGNC: HGNC:7323
Homologene: 90949
Eme2
Name: essential meiotic structure-specific endonuclease subunit 2
Synonyms: 2810013J18Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 17
Alteration at locus: Chemically Induced
NCBI: 193838
Homologene: 19180
Gorasp2
Name: golgi reassembly stacking protein 2
Synonyms: GOLPH2, 5730520M13Rik, 9430094F20Rik, p59, GRS2, GRASP55, ENSMUSG00000075299
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 2
Alteration at locus: Chemically Induced
NCBI: 70231
Homologene: 9180
Tpcn1
Name: two pore channel 1
Synonyms: 5730403B01Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 5
Alteration at locus: Chemically Induced
NCBI: 252972
Homologene: 9905
Gcdh
Name: glutaryl-Coenzyme A dehydrogenase
Synonyms: D17825
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 8
Alteration at locus: Chemically Induced
NCBI: 270076
HGNC: HGNC:4189
Homologene: 130
Clec4b1
Name: C-type lectin domain family 4, member b1
Synonyms: mDcar2, DCAR, DCARbeta, 1810046I24Rik, 1810046I24Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 6
Alteration at locus: Chemically Induced
NCBI: 69810
Homologene: 130350
Plagl1
Name: pleiomorphic adenoma gene-like 1
Synonyms: Zac1
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 10
Alteration at locus: Chemically Induced
NCBI: 22634
HGNC: HGNC:9046
Homologene: 31401
Soat2
Name: sterol O-acyltransferase 2
Synonyms: ACAT2, D15Wsu97e
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 15
Alteration at locus: Chemically Induced
NCBI: 223920
Homologene: 68355
Isl1
Name: ISL1 transcription factor, LIM/homeodomain
Synonyms: Islet 1
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 13
Alteration at locus: Chemically Induced
NCBI: 16392
HGNC: HGNC:6132
Homologene: 1661
Cyp4a10
Name: cytochrome P450, family 4, subfamily a, polypeptide 10
Synonyms: RP1, Msp-3, Cyp4a, D4Rp1
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 4
Alteration at locus: Chemically Induced
NCBI: 13117
HGNC: HGNC:2642
Homologene: 128044
Rims1
Name: regulating synaptic membrane exocytosis 1
Synonyms: RIM1a, RIM1, RIM1alpha, C030033M19Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 1
Alteration at locus: Chemically Induced
NCBI: 116837
Homologene: 128399
Obscn
Name: obscurin, cytoskeletal calmodulin and titin-interacting RhoGEF
Synonyms: LOC380698, OTTMUSG00000005786
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 11
Alteration at locus: Chemically Induced
NCBI: 380698
Homologene: 70869
Mast3
Name: microtubule associated serine/threonine kinase 3
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 8
Alteration at locus: Chemically Induced
NCBI: 546071
Homologene: 66191
Ltbp2
Name: latent transforming growth factor beta binding protein 2
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 12
Alteration at locus: Chemically Induced
NCBI: 16997
HGNC: HGNC:6715
Homologene: 369
Sh3pxd2b
Name: SH3 and PX domains 2B
Synonyms: Fad49, Tsk4, G431001E03Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 11
Alteration at locus: Chemically Induced
NCBI: 268396
Homologene: 27952
Adamtsl4
Name: ADAMTS-like 4
Synonyms: Tsrc1
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 3
Alteration at locus: Chemically Induced
NCBI: 229595
Homologene: 23141
Greb1l
Name: growth regulation by estrogen in breast cancer-like
Synonyms: mKIAA4095, AK220484
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 18
Alteration at locus: Chemically Induced
NCBI: 381157
Homologene: 73393
Usp13
Name: ubiquitin specific peptidase 13 (isopeptidase T-3)
Synonyms: IsoT-3, ISOT3, 2700071E21Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 3
Alteration at locus: Chemically Induced
NCBI: 72607
Homologene: 68372
Fanca
Name: Fanconi anemia, complementation group A
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 8
Alteration at locus: Chemically Induced
NCBI: 14087
HGNC: HGNC:3582
Homologene: 108
Lcp1
Name: lymphocyte cytosolic protein 1
Synonyms: L-fimbrin, D14Ertd310e, L-plastin, Pls2
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 14
Alteration at locus: Chemically Induced
NCBI: 18826
HGNC: HGNC:6528
Homologene: 80174
Dytn
Name: dystrotelin
Synonyms: LOC241073
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 1
Alteration at locus: Chemically Induced
NCBI: 241073
Homologene: 104042
Rab3il1
Name: RAB3A interacting protein (rabin3)-like 1
Synonyms: Rab3ail1, 1200014K04Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 19
Alteration at locus: Chemically Induced
NCBI: 74760
HGNC: HGNC:9780
Homologene: 40880
Alkbh2
Name: alkB homolog 2, alpha-ketoglutarate-dependent dioxygenase
Synonyms: Abh2, mABH2
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 5
Alteration at locus: Chemically Induced
NCBI: 231642
Homologene: 18393
Emilin3
Name: elastin microfibril interfacer 3
Synonyms: EMILIN-T, 1110013O17Rik, Emilin5
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 2
Alteration at locus: Chemically Induced
NCBI: 280635
Homologene: 18817
Otop2
Name: otopetrin 2
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 11
Alteration at locus: Chemically Induced
NCBI: 237987
Homologene: 27803
Trdn
Name: triadin
Synonyms: 2310045H21Rik, triadin-3, triadin-2, triadin-1, triadin 3, triadin 2, triadin 1, EG432451
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 10
Alteration at locus: Chemically Induced
NCBI: 76757
VEGA: 10
Homologene: 38137
Il18r1
Name: interleukin 18 receptor 1
Synonyms: Il18ralpha, Il1rrp
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 1
Alteration at locus: Chemically Induced
NCBI: 16182
HGNC: HGNC:5988
Homologene: 2861
Nkd2
Name: naked cuticle 2
Synonyms: 2210403L10Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 13
Alteration at locus: Chemically Induced
NCBI: 72293
Homologene: 12459
Mrps24
Name: mitochondrial ribosomal protein S24
Synonyms: Rpms24, 3110030K20Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 11
Alteration at locus: Chemically Induced
NCBI: 64660
Homologene: 57043
Zfp353-ps
Name: zinc finger protein 353, pseudogene
Synonyms: Zfp353
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 8
Alteration at locus: Chemically Induced
NCBI: 234203
Rinl
Name: Ras and Rab interactor-like
Synonyms: 9930116N10Rik, 5830482F20Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 7
Alteration at locus: Chemically Induced
NCBI: 320435
Homologene: 18556
1700019A02Rik
Name: RIKEN cDNA 1700019A02 gene
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 1
Alteration at locus: Chemically Induced
NCBI: 69397
Duoxa2
Name: dual oxidase maturation factor 2
Synonyms: Nip2, 9030623N16Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 2
Alteration at locus: Chemically Induced
NCBI: 66811
Homologene: 57037
Vmn1r118
Name: vomeronasal 1 receptor 118
Synonyms: Gm8542
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 7
Alteration at locus: Chemically Induced
NCBI: 667259
Homologene: 104166
Gm28417
Name: predicted gene 28417
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 1
Alteration at locus: Chemically Induced
RP23-105H6.2
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 2
Alteration at locus: Chemically Induced
Olfr1010
Name: olfactory receptor 1010
Synonyms: GA_x6K02T2Q125-47228321-47229256, MOR213-1_p, Olfr1011, MOR213-1, MOR213-7P, GA_x6K02T2Q125-47232672-47233052
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 2
Alteration at locus: Chemically Induced
NCBI: 258255
Homologene: 45796
Genetic Alterations
ENU-induced transitions at the following base pair locations (GRCm38):
  • G to T, chromosome 1 at 22,533,583 bp
  • A to T, chromosome 1 at 34,472,930 bp
  • G to A, chromosome 1 at 40,474,936 bp
  • T to C, chromosome 1 at 52,196,748 bp
  • A to T, chromosome 1 at 53,158,769 bp
  • A to G, chromosome 1 at 63,647,447 bp
  • T to C, chromosome 2 at 70,679,513 bp
  • C to T, chromosome 2 at 85,753,791 bp
  • G to T, chromosome 2 at 122,300,577 bp
  • T to C, chromosome 2 at 160,907,796 bp
  • A to G, chromosome 2 at 169,962,325 bp
  • T to C, chromosome 3 at 32,881,423 bp
  • T to C, chromosome 3 at 60,603,755 bp
  • T to C, chromosome 3 at 95,677,554 bp
  • A to T, chromosome 4 at 19,638,644 bp
  • A to G, chromosome 4 at 34,810,863 bp
  • A to T, chromosome 4 at 115,519,701 bp
  • A to T, chromosome 5 at 110,741,981 bp
  • C to T, chromosome 5 at 114,124,226 bp
  • G to A, chromosome 5 at 120,557,897 bp
  • C to A, chromosome 6 at 123,068,484 bp
  • G to T, chromosome 7 at 20,912,008 bp
  • T to C, chromosome 7 at 28,790,715 bp
  • T to A, chromosome 7 at 30,946,986 bp
  • A to G, chromosome 8 at 42,081,689 bp
  • A to T, chromosome 8 at 45,025,481 bp
  • A to G, chromosome 8 at 70,781,194 bp
  • T to C, chromosome 8 at 84,892,453 bp
  • T to C, chromosome 8 at 123,275,172 bp
  • G to T, chromosome 9 at 57,577,262 bp
  • TGAGCCAGAGCCAGAGCCAGAGCCAGAGCCAGAGCCAGAGCCAGAGCC to TGAGCCAGAGCCAGAGCCAGAGCCAGAGCCAGAGCCAGAGCCAGAGCCAGAGCC, chromosome 10 at 13,128,771 bp
  • A to G, chromosome 10 at 33,257,087 bp
  • A to T, chromosome 10 at 40,849,852 bp
  • G to A, chromosome 11 at 5,704,676 bp
  • G to T, chromosome 11 at 32,422,263 bp
  • C to T, chromosome 11 at 36,008,655 bp
  • T to C, chromosome 11 at 59,082,710 bp
  • G to A, chromosome 11 at 115,329,375 bp
  • T to C, chromosome 11 at 117,352,265 bp
  • T to C, chromosome 12 at 21,325,457 bp
  • A to G, chromosome 12 at 84,809,144 bp
  • C to T, chromosome 13 at 73,822,690 bp
  • G to T, chromosome 13 at 74,663,536 bp
  • T to A, chromosome 13 at 116,303,090 bp
  • T to C, chromosome 14 at 25,874,674 bp
  • T to C, chromosome 14 at 67,008,738 bp
  • T to C, chromosome 14 at 75,215,180 bp
  • A to G, chromosome 15 at 102,161,091 bp
  • A to G, chromosome 15 at 102,312,989 bp
  • T to C, chromosome 17 at 24,892,576 bp
  • T to A, chromosome 17 at 33,847,517 bp
  • T to C, chromosome 17 at 80,032,772 bp
  • G to A, chromosome 18 at 10,522,150 bp
  • A to T, chromosome 19 at 9,883,778 bp
  • T to C, chromosome 19 at 10,026,624 bp
  • A to G, chromosome X at 18,250,875 bp
Genotype Determination
Phenotype
G1 male heterozygous mice are viable and fertile. The G1 mice were not characterized prior to archiving.
Strain Development
C57BL/6J mice were injected with ENU, resulting in G0 mice that were bred back to C57BL/6J. Sperm was archived from G1 male mice that produced viable G2 mice.
Suggested Control Mice
Wild-type littermates or C57BL/6J mice
Donor
Bruce Beutler, M.D., University of Texas Southwestern Medical Center.
Primary Reference
MUTAGENETIX record for R4062 (G1). B. Beutler and colleagues, Center for the Genetics of Host Defense, UT Southwestern, Dallas, TX.

Colony and Husbandry Information

Colony Surveillance Program and Current Health Reports

Mice recovered from a cryo-archive will have health surveillance performed on recipient females. Health reports will be provided prior to shipment. If you require additional health status information, please email mmrrc@missouri.edu .
Coat Color
Black
MMRRC Breeding System
Random intra-strain mating
Breeding Scheme(s)
When maintaining a live colony, heterozygous mice may be bred together, bred with wild-type siblings, or bred with C57BL/6J inbred mice.
Overall Breeding Performance
Undetermined; during development, mating was done with heterozygous males; viability, fertility and other breeding statistics for heterozygous females and homozygotes are unverified, but presumably would be similar to the C57BL/6J background strain
Average litter size
Undetermined
Recommended wean age
3 weeks

Order Request Information

Limited quantities of breeder mice (recovered litter) are available from a cryoarchive; recovered litter usually available to ship in 3 to 4 months.

Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

Distribution of this strain requires submission of the MMRRC Conditions of Use (COU). A link to the COU web form will be provided via email after an order has been placed; the form should be completed then or the email forwarded to your institutional official for completion.

The donor or their institution limits the distribution to non-profit institutions only.

Additional charges may apply for any special requests. Shipping costs are in addition to the basic distribution/resuscitation fees. Information on shipping costs and any additional charges will be provided by the supplying MMRRC facility.

Click button to Request this one strain. (Use the MMRRC Catalog Search to request more than one strain.)
MMRRC Item # Description Distribution Fee / Unit (US $) Units Notes
040971-MU-RESUS Litter recovered from cryo-archive $5,475.00 / Non-Profit Litter Recovered litter1; additional fees for any special requests.
Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

Some MMRRC strains were submitted by the donor as cryopreserved germplasm, and because these strains were not cryopreserved by the MMRRC, we have not assessed the quality of this material. We have extensive experience with recovery of mice from cryopreserved sperm and embryos of varying quality, including using techniques such as IVF and ICSI, and are confident that we will have success in most, if not all, cases. However, because of the unknown quality of these frozen samples, we will restrict recovery efforts to two attempts for each order. Subsequent attempts can be performed on a fee-for-service basis, in addition to the standard fees, upon request.

1 The distribution fee covers the expense of resuscitating mice from the cryo-archive; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

2 An aliquot is one straw or vial with sufficient sperm to recover at least one litter of mice, as per provided protocols, when performed at the MMRRC facility. The MMRRC makes no guarantee concerning the success of these procedures when performed outside the MMRRC facilities.

3 An aliquot contains a sufficient number of embryos (in one or more vials or straws and based on the transfer success rate of the MMRRC facility) to transfer into one to three recipients. The MMRRC makes no guarantee concerning embryo transfer success experienced in the recipient investigator's laboratory. Neither gender nor genotype ratios are guaranteed.

To request material from the MMRRC: Please fill out our on-line request form (accessible from the catalog search results page, or click the Request this Strain button in the fees section). If you have questions or need assistance completing this form, you may call Customer Service at (800) 910-2291 (in USA or Canada) or (530) 757-5710 (international calls). Before you call, please have with you: the MMRRC item number, quantity needed, Bill-to and Ship-to contact information.