Strain Name:
C57BL/6J-MtgxR4081Btlr/Mmmh
Stock Number:
040977-MU
Citation ID:
RRID:MMRRC_040977-MU
Other Names:
R4081 (G1), C57BL/6J-MtgxR4081Btlr
Major Collection:

Strain Information

Ippk
Name: inositol 1,3,4,5,6-pentakisphosphate 2-kinase
Synonyms: 1810043M15Rik
Type: Gene
Species: Mouse
Chromosome: 13
NCBI: 75678
VEGA: 13
Homologene: 41495
Myd88
Name: myeloid differentiation primary response gene 88
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 17874
HGNC: HGNC:7562
Homologene: 1849
Ptpn14
Name: protein tyrosine phosphatase, non-receptor type 14
Synonyms: PTP36, C130080N23Rik, OTTMUSG00000022087
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 19250
HGNC: HGNC:9647
Homologene: 3941
Lrp2
Name: low density lipoprotein receptor-related protein 2
Synonyms: Megalin, Gp330, D230004K18Rik, b2b1625.2Clo
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 14725
HGNC: HGNC:6694
Homologene: 20952
Gdi2
Name: GDP dissociation inhibitor 2
Synonyms: GDI beta, GDI-B, GDIB, Gdi3
Type: Gene
Species: Mouse
Chromosome: 13
NCBI: 14569
VEGA: 13
HGNC: HGNC:4227
Homologene: 37488
Ints8
Name: integrator complex subunit 8
Synonyms: D130008D20Rik, 2810013E07Rik
Type: Gene
Species: Mouse
Chromosome: 4
NCBI: 72656
Homologene: 9888
Evi5
Name: ecotropic viral integration site 5
Synonyms: NB4S
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 14020
HGNC: HGNC:3501
Homologene: 121902
Ccnf
Name: cyclin F
Synonyms: CycF, Fbxo1
Type: Gene
Species: Mouse
Chromosome: 17
NCBI: 12449
VEGA: 17
HGNC: HGNC:1591
Homologene: 1335
Itpr1
Name: inositol 1,4,5-trisphosphate receptor 1
Synonyms: P400, IP3R1, Itpr-1, Ip3r, Pcp-1, opt, InsP3R type I, Pcp1, wblo
Type: Gene
Species: Mouse
Chromosome: 6
NCBI: 16438
HGNC: HGNC:6180
Homologene: 1673
Cit
Name: citron
Synonyms: CRIK-SK, citron-N, citron kinase, Cit-k, C030025P15Rik
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 12704
HGNC: HGNC:1985
Homologene: 21404
Sox14
Name: SRY (sex determining region Y)-box 14
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 20669
Homologene: 31224
Phrf1
Name: PHD and ring finger domains 1
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 101471
Homologene: 16377
Arhgef1
Name: Rho guanine nucleotide exchange factor 1
Synonyms: Lsc, Lbcl2
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 16801
HGNC: HGNC:681
Homologene: 3454
Zfp992
Name: zinc finger protein 992
Synonyms: Gm13251
Type: Gene
Species: Mouse
Chromosome: 4
NCBI: 433791
Homologene: 133076
Cntrl
Name: centriolin
Synonyms: IB3/5, 6720467O09Rik, Ma2a8, Cep1, b2b1468Clo, Cep110
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 26920
HGNC: HGNC:1858
Homologene: 38260
Szt2
Name: SZT2 subunit of KICSTOR complex
Synonyms: seaizure threshold 2
Type: Gene
Species: Mouse
Chromosome: 4
NCBI: 230676
Homologene: 49413
Clec4b1
Name: C-type lectin domain family 4, member b1
Synonyms: 1810046I24Rik, 1810046I24Rik, DCARbeta, DCAR, mDcar2
Type: Gene
Species: Mouse
Chromosome: 6
NCBI: 69810
Homologene: 130350
Sez6l
Name: seizure related 6 homolog like
Synonyms: Acig1
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 56747
Homologene: 10895
Sohlh1
Name: spermatogenesis and oogenesis specific basic helix-loop-helix 1
Synonyms: LOC227631, NOHLH
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 227631
Homologene: 45955
Tek
Name: TEK receptor tyrosine kinase
Synonyms: Hyk, Tie2, Cd202b, tie-2
Type: Gene
Species: Mouse
Chromosome: 4
NCBI: 21687
Homologene: 397
Tab2
Name: TGF-beta activated kinase 1/MAP3K7 binding protein 2
Synonyms: Tak1 binding protein 2, 1110030N06Rik, A530078N03Rik, Map3k7ip2
Type: Gene
Species: Mouse
Chromosome: 10
NCBI: 68652
Homologene: 9019
Vwa3b
Name: von Willebrand factor A domain containing 3B
Synonyms: A230074B11Rik, 4921511C04Rik
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 70853
Homologene: 27053
Spta1
Name: spectrin alpha, erythrocytic 1
Synonyms: Spna-1, erythroid, ihj, Spna1
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 20739
Homologene: 74460
Mylk3
Name: myosin light chain kinase 3
Synonyms: D830007F02Rik
Type: Gene
Species: Mouse
Chromosome: 8
NCBI: 213435
Homologene: 35278
Sema6b
Name: sema domain, transmembrane domain (TM), and cytoplasmic domain, (semaphorin) 6B
Synonyms: VIb, semaZ, Sema, Seman
Type: Gene
Species: Mouse
Chromosome: 17
NCBI: 20359
VEGA: 17
Homologene: 8428
Tbx15
Name: T-box 15
Synonyms: Tbx8, de, Tbx14
Type: Gene
Species: Mouse
Chromosome: 3
NCBI: 21384
Homologene: 7967
Ptprh
Name: protein tyrosine phosphatase receptor type H
Synonyms: SAP-1
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 545902
HGNC: HGNC:9672
Homologene: 37693
Otog
Name: otogelin
Synonyms: Otgn
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 18419
HGNC: HGNC:8516
Homologene: 8421
Myh2
Name: myosin, heavy polypeptide 2, skeletal muscle, adult
Synonyms: MyHC-IIa, MHC2A, Myhs-f1, Myhs-f, Myhsf1
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 17882
HGNC: HGNC:7572
Homologene: 23019
Slco1a1
Name: solute carrier organic anion transporter family, member 1a1
Synonyms: Oatp1, Slc21a1, Oatp1a1
Type: Gene
Species: Mouse
Chromosome: 6
NCBI: 28248
Homologene: 137261
Insr
Name: insulin receptor
Synonyms: IR, CD220, 4932439J01Rik, D630014A15Rik, IR-B, IR-A
Type: Gene
Species: Mouse
Chromosome: 8
NCBI: 16337
HGNC: HGNC:6091
Homologene: 20090
Crybg1
Name: crystallin beta-gamma domain containing 1
Synonyms: Aim1
Type: Gene
Species: Mouse
Chromosome: 10
NCBI: 11630
HGNC: HGNC:356
Homologene: 18168
Cyp2d11
Name: cytochrome P450, family 2, subfamily d, polypeptide 11
Synonyms: P450-2D, Cyp2d
Type: Gene
Species: Mouse
Chromosome: 15
NCBI: 545123
VEGA: 15
Homologene: 86099
Tulp4
Name: TUB like protein 4
Synonyms: 1110057P05Rik, 2210038L17Rik
Type: Gene
Species: Mouse
Chromosome: 17
NCBI: 68842
Homologene: 32467
Rgl3
Name: ral guanine nucleotide dissociation stimulator-like 3
Synonyms: 1300003D20Rik
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 71746
VEGA: 9
Homologene: 11363
Cd53
Name: CD53 antigen
Synonyms: Ox-44, Tspan25
Type: Gene
Species: Mouse
Chromosome: 3
NCBI: 12508
HGNC: HGNC:1686
Homologene: 20152
Zfp541
Name: zinc finger protein 541
Synonyms: EG666528
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 666528
Homologene: 12991
Prorp
Name: protein only RNase P catalytic subunit
Synonyms: Mrpp3, 1110008L16Rik
Type: Gene
Species: Mouse
Chromosome: 12
NCBI: 66132
Homologene: 45935
Tex10
Name: testis expressed gene 10
Synonyms: clone 18330, 2810462N03Rik, 2610206N19Rik
Type: Gene
Species: Mouse
Chromosome: 4
NCBI: 269536
Homologene: 32361
Aass
Name: aminoadipate-semialdehyde synthase
Synonyms: LOR/SDH, Lorsdh
Type: Gene
Species: Mouse
Chromosome: 6
NCBI: 30956
Homologene: 4212
Aim2
Name: absent in melanoma 2
Synonyms: LOC383619, Ifi210
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 383619
HGNC: HGNC:357
Homologene: 83226
Ptprr
Name: protein tyrosine phosphatase receptor type R
Synonyms: PTPBR7, PTP-SL, RPTPRR
Type: Gene
Species: Mouse
Chromosome: 10
NCBI: 19279
HGNC: HGNC:9680
Homologene: 2135
Kcnh8
Name: potassium voltage-gated channel, subfamily H (eag-related), member 8
Synonyms: Kv12.1, ELK1, C130090D05Rik
Type: Gene
Species: Mouse
Chromosome: 17
NCBI: 211468
Homologene: 14332
Klk14
Name: kallikrein related-peptidase 14
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 317653
HGNC: HGNC:6362
Homologene: 69348
Vmn1r66
Name: vomeronasal 1 receptor 66
Synonyms: V1re11
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 171264
Vmn2r106
Name: vomeronasal 2, receptor 106
Synonyms: EG224576
Type: Gene
Species: Mouse
Chromosome: 17
NCBI: 224576
Homologene: 135824
Ifit1bl1
Name: interferon induced protein with tetratricpeptide repeats 1B like 1
Synonyms: Gm14446
Type: Gene
Species: Mouse
Chromosome: 19
NCBI: 667373
Homologene: 78213
Stard13
Name: StAR related lipid transfer domain containing 13
Synonyms: GT650, DLC2
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 243362
Homologene: 64844
Plod3
Name: procollagen-lysine, 2-oxoglutarate 5-dioxygenase 3
Synonyms: lysyl hydroxylase 3, LH3
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 26433
HGNC: HGNC:9083
Homologene: 843
Snph
Name: syntaphilin
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 241727
Homologene: 8817
Cpa5
Name: carboxypeptidase A5
Synonyms: 4930430M09Rik
Type: Gene
Species: Mouse
Chromosome: 6
NCBI: 74649
Homologene: 62246
Cwc25
Name: CWC25 spliceosome-associated protein
Synonyms: R75228, 1300013D05Rik, Ccdc49
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 67480
Homologene: 135922
Tex11
Name: testis expressed gene 11
Synonyms: 4930565P14Rik
Type: Gene
Species: Mouse
Chromosome: X
NCBI: 83558
Homologene: 49962
Gm12531
Name: predicted gene 12531
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 3
Gm5436
Name: predicted pseudogene 5436
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 12
NCBI: 432676
VEGA: 12
Genetic Alterations
ENU-induced transitions at the following base pair locations (GRCm38):
  • C to T, chromosome 1 at 37,035,824 bp
  • T to C, chromosome 1 at 173,459,851 bp
  • A to G, chromosome 1 at 174,214,066 bp
  • T to C, chromosome 1 at 189,839,478 bp
  • A to G, chromosome 2 at 25,845,722 bp
  • C to A, chromosome 2 at 35,161,926 bp
  • A to G, chromosome 2 at 35,175,125 bp
  • T to A, chromosome 2 at 69,513,273 bp
  • T to C, chromosome 2 at 151,593,802 bp
  • A to G, chromosome 3 at 37,064,363 bp
  • A to G, chromosome 3 at 99,313,054 bp
  • T to C, chromosome 3 at 106,762,145 bp
  • A to G, chromosome 4 at 11,221,196 bp
  • T to C, chromosome 4 at 48,468,873 bp
  • A to G, chromosome 4 at 94,820,133 bp
  • A to G, chromosome 4 at 118,373,567 bp
  • C to T, chromosome 4 at 146,467,519 bp
  • A to G, chromosome 5 at 107,842,265 bp
  • T to C, chromosome 5 at 112,461,166 bp
  • G to T, chromosome 5 at 115,948,050 bp
  • G to C, chromosome 5 at 136,988,146 bp
  • C to A, chromosome 5 at 151,092,829 bp
  • A to T, chromosome 6 at 23,109,498 bp
  • T to C, chromosome 6 at 30,631,229 bp
  • T to A, chromosome 6 at 108,391,835 bp
  • T to C, chromosome 6 at 123,069,774 bp
  • T to C, chromosome 6 at 141,935,962 bp
  • T to A, chromosome 7 at 4,580,988 bp
  • A to G, chromosome 7 at 10,274,806 bp
  • G to A, chromosome 7 at 16,072,135 bp
  • G to T, chromosome 7 at 24,925,846 bp
  • G to A, chromosome 7 at 43,692,077 bp
  • T to C, chromosome 7 at 46,288,299 bp
  • T to C, chromosome 7 at 141,259,057 bp
  • A to T, chromosome 8 at 3,211,391 bp
  • G to A, chromosome 8 at 85,328,682 bp
  • T to A, chromosome 9 at 21,987,675 bp
  • T to C, chromosome 9 at 99,875,224 bp
  • G to T, chromosome 9 at 119,339,987 bp
  • G to A, chromosome 10 at 7,919,831 bp
  • A to T, chromosome 10 at 43,975,039 bp
  • A to T, chromosome 10 at 116,236,710 bp
  • T to C, chromosome 11 at 67,190,430 bp
  • G to T, chromosome 11 at 97,753,918 bp
  • G to T, chromosome 12 at 55,304,613 bp
  • T to A, chromosome 12 at 84,258,715 bp
  • T to A, chromosome 13 at 3,548,866 bp
  • T to A, chromosome 13 at 49,446,376 bp
  • A to T, chromosome 15 at 82,391,801 bp
  • C to T, chromosome 17 at 6,231,780 bp
  • A to T, chromosome 17 at 20,267,556 bp
  • T to C, chromosome 17 at 24,223,898 bp
  • GAGACCAACGAGCAGCTGATGCTTCAGA to GAGA, chromosome 17 at 52,725,906 bp
  • A to G, chromosome 17 at 56,128,307 bp
  • T to C, chromosome 19 at 34,594,640 bp
  • C to A, chromosome X at 100,933,415 bp
Genotype Determination
Phenotype
G1 male heterozygous mice are viable and fertile. The G1 mice were not characterized prior to archiving.
Strain Development
C57BL/6J mice were injected with ENU, resulting in G0 mice that were bred back to C57BL/6J. Sperm was archived from G1 male mice that produced viable G2 mice.
Suggested Control Mice
Wild-type littermates or C57BL/6J mice
MMRRC Genetic QC Summary
The MMRRC Centers have developed a genetic QC pipeline using MiniMUGA array genotyping to provide additional information on strain backgrounds for MMRRC congenic and inbred strains. For more information on when data may be available, or to request genotyping for a strain of interest, please contact mmrrc@missouri.edu. Older strains may not have this information.
Donor
Bruce Beutler, M.D., University of Texas Southwestern Medical Center.
Primary Reference
MUTAGENETIX record for R4081 (G1). B. Beutler and colleagues, Center for the Genetics of Host Defense, UT Southwestern, Dallas, TX.

Colony and Husbandry Information

Colony Surveillance Program and Current Health Reports

Mice recovered from a cryo-archive will have health surveillance performed on recipient females. Health reports will be provided prior to shipment. If you require additional health status information, please email mmrrc@missouri.edu.
Coat Color
Black
MMRRC Breeding System
Random intra-strain mating
Breeding Scheme(s)
When maintaining a live colony, heterozygous mice may be bred together, bred with wild-type siblings, or bred with C57BL/6J inbred mice.
Overall Breeding Performance
Undetermined; during development, mating was done with heterozygous males; viability, fertility and other breeding statistics for heterozygous females and homozygotes are unverified, but presumably would be similar to the C57BL/6J background strain
Average litter size
Undetermined
Recommended wean age
3 weeks

Order Request Information

Limited quantities of breeder mice (recovered litter) are available from a cryoarchive; recovered litter usually available to ship in 3 to 4 months.

Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

Distribution of this strain requires submission of the MMRRC Conditions of Use (COU). A link to the COU web form will be provided via email after an order has been placed; the form should be completed then or the email forwarded to your institutional official for completion.

The donor or their institution limits the distribution to non-profit institutions only.

Additional charges may apply for any special requests. Shipping costs are in addition to the basic distribution/resuscitation fees. Information on shipping costs and any additional charges will be provided by the supplying MMRRC facility.

Click button to Request this one strain. (Use the MMRRC Catalog Search to request more than one strain.)
MMRRC Item # Description Distribution Fee / Unit (US $)
*Shipping & Handling not included*
Units Notes
040977-MU-RESUS Litter recovered from cryo-archive $5,475.00 / Non-Profit Litter Recovered litter4; additional fees for any special requests.
Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

Some MMRRC strains were submitted by the donor as cryopreserved germplasm, and because these strains were not cryopreserved by the MMRRC, we have not assessed the quality, nor genotype, of this material. Our expertise in reviving mice from various qualities of frozen sperm and embryos, using methods like IVF and ICSI, gives us confidence in successful recoveries in most cases. However, due to the uncertain quality of these samples, we'll limit revival attempts to two per order. Additional attempts are available for a fee, on top of standard charges, if requested. It's important to note that some strains may lack the expected mutation, so we can't assure successful order fulfillment until we attempt to revive the strain.

1 The distribution fee covers the expense of rederiving mice from a live mouse; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

2 An aliquot contains a sufficient number of embryos (in one or more vials or straws and based on the transfer success rate of the MMRRC facility) to transfer into one to three recipients. The MMRRC makes no guarantee concerning embryo transfer success experienced in the recipient investigator's laboratory. Neither gender nor genotype ratios are guaranteed.

3 An aliquot is one straw or vial with sufficient sperm to recover at least one litter of mice, as per provided protocols, when performed at the MMRRC facility. The MMRRC makes no guarantee concerning the success of these procedures when performed outside the MMRRC facilities.

4 The distribution fee covers the expense of resuscitating mice from the cryo-archive; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

To request material from the MMRRC: Please fill out our on-line request form (accessible from the catalog search results page, or click the Request this Strain button in the fees section). If you have questions or need assistance completing this form, you may call Customer Service at (800) 910-2291 (in USA or Canada) or (530) 757-5710 (international calls). Before you call, please have with you: the MMRRC item number, quantity needed, Bill-to and Ship-to contact information.