Strain Name:
C57BL/6J-MtgxR4081Btlr/Mmmh
Stock Number:
040977-MU
Citation ID:
RRID:MMRRC_040977-MU
Other Names:
R4081 (G1), C57BL/6J-MtgxR4081Btlr
Major Collection:

Strain Information

Ippk
Name: inositol 1,3,4,5,6-pentakisphosphate 2-kinase
Synonyms: 1810043M15Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 13
NCBI: 75678
VEGA: 13
Homologene: 41495
Myd88
Name: myeloid differentiation primary response gene 88
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 9
NCBI: 17874
HGNC: HGNC:7562
Homologene: 1849
Ptpn14
Name: protein tyrosine phosphatase, non-receptor type 14
Synonyms: C130080N23Rik, OTTMUSG00000022087, PTP36
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 1
NCBI: 19250
HGNC: HGNC:9647
Homologene: 3941
Lrp2
Name: low density lipoprotein receptor-related protein 2
Synonyms: b2b1625.2Clo, Gp330, D230004K18Rik, Megalin
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 2
NCBI: 14725
HGNC: HGNC:6694
Homologene: 20952
Gdi2
Name: guanosine diphosphate (GDP) dissociation inhibitor 2
Synonyms: GDIB, Gdi3, GDI beta, GDI-B
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 13
NCBI: 14569
VEGA: 13
HGNC: HGNC:4227
Homologene: 37488
Ints8
Name: integrator complex subunit 8
Synonyms: D130008D20Rik, 2810013E07Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 4
NCBI: 72656
Homologene: 9888
Evi5
Name: ecotropic viral integration site 5
Synonyms: NB4S
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 5
NCBI: 14020
HGNC: HGNC:3501
Homologene: 121902
Ccnf
Name: cyclin F
Synonyms: CycF, Fbxo1
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 17
NCBI: 12449
VEGA: 17
HGNC: HGNC:1591
Homologene: 1335
Itpr1
Name: inositol 1,4,5-trisphosphate receptor 1
Synonyms: Itpr-1, opt, wblo, InsP3R type I, P400, Ip3r, Pcp1, Pcp-1, IP3R1
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 6
NCBI: 16438
HGNC: HGNC:6180
Homologene: 1673
Cit
Name: citron
Synonyms: citron kinase, C030025P15Rik, citron-N, CRIK-SK, Cit-k
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 5
NCBI: 12704
HGNC: HGNC:1985
Homologene: 21404
Sox14
Name: SRY (sex determining region Y)-box 14
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 9
NCBI: 20669
Homologene: 31224
Phrf1
Name: PHD and ring finger domains 1
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 7
NCBI: 101471
Homologene: 16377
Arhgef1
Name: Rho guanine nucleotide exchange factor (GEF) 1
Synonyms: Lbcl2, Lsc
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 7
NCBI: 16801
HGNC: HGNC:681
Homologene: 3454
Zfp992
Name: zinc finger protein 992
Synonyms: Gm13251
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 4
NCBI: 433791
Homologene: 133076
Cntrl
Name: centriolin
Synonyms: IB3/5, Cep110, b2b1468Clo, Ma2a8, Cep1, 6720467O09Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 2
NCBI: 26920
HGNC: HGNC:1858
Homologene: 38260
Szt2
Name: SZT2 subunit of KICSTOR complex
Synonyms: seaizure threshold 2
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 4
NCBI: 230676
Homologene: 49413
Clec4b1
Name: C-type lectin domain family 4, member b1
Synonyms: 1810046I24Rik, 1810046I24Rik, mDcar2, DCARbeta, DCAR
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 6
NCBI: 69810
Homologene: 130350
Sez6l
Name: seizure related 6 homolog like
Synonyms: Acig1
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 5
NCBI: 56747
Homologene: 10895
Sohlh1
Name: spermatogenesis and oogenesis specific basic helix-loop-helix 1
Synonyms: NOHLH, LOC227631
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 2
NCBI: 227631
Homologene: 45955
Tek
Name: TEK receptor tyrosine kinase
Synonyms: Tie2, tie-2, Cd202b, Hyk
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 4
NCBI: 21687
Homologene: 397
Tab2
Name: TGF-beta activated kinase 1/MAP3K7 binding protein 2
Synonyms: A530078N03Rik, 1110030N06Rik, Map3k7ip2, Tak1 binding protein 2
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 10
NCBI: 68652
Homologene: 9019
Vwa3b
Name: von Willebrand factor A domain containing 3B
Synonyms: 4921511C04Rik, A230074B11Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 1
NCBI: 70853
Homologene: 27053
Spta1
Name: spectrin alpha, erythrocytic 1
Synonyms: ihj, Spna1, erythroid, Spna-1
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 1
NCBI: 20739
Homologene: 74460
Mylk3
Name: myosin light chain kinase 3
Synonyms: D830007F02Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 8
NCBI: 213435
Homologene: 35278
Sema6b
Name: sema domain, transmembrane domain (TM), and cytoplasmic domain, (semaphorin) 6B
Synonyms: Sema, semaZ, VIb, Seman
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 17
NCBI: 20359
VEGA: 17
Homologene: 8428
Tbx15
Name: T-box 15
Synonyms: de, Tbx8, Tbx14
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 3
NCBI: 21384
Homologene: 7967
Ptprh
Name: protein tyrosine phosphatase receptor type H
Synonyms: SAP-1
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 7
NCBI: 545902
HGNC: HGNC:9672
Homologene: 37693
Otog
Name: otogelin
Synonyms: Otgn
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 7
NCBI: 18419
HGNC: HGNC:8516
Homologene: 8421
Myh2
Name: myosin, heavy polypeptide 2, skeletal muscle, adult
Synonyms: Myhsf1, MHC2A, MyHC-IIa, Myhs-f1, Myhs-f
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 11
NCBI: 17882
HGNC: HGNC:7572
Homologene: 23019
Slco1a1
Name: solute carrier organic anion transporter family, member 1a1
Synonyms: Oatp1, Oatp1a1, Slc21a1
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 6
NCBI: 28248
Homologene: 137261
Insr
Name: insulin receptor
Synonyms: CD220, 4932439J01Rik, IR-B, IR-A, IR, D630014A15Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 8
NCBI: 16337
HGNC: HGNC:6091
Homologene: 20090
Crybg1
Name: crystallin beta-gamma domain containing 1
Synonyms: Aim1
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 10
NCBI: 11630
HGNC: HGNC:356
Homologene: 18168
Cyp2d11
Name: cytochrome P450, family 2, subfamily d, polypeptide 11
Synonyms: P450-2D, Cyp2d
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 15
NCBI: 545123
VEGA: 15
HGNC: HGNC:2625
Homologene: 86099
Tulp4
Name: tubby like protein 4
Synonyms: 1110057P05Rik, 2210038L17Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 17
NCBI: 68842
Homologene: 32467
Rgl3
Name: ral guanine nucleotide dissociation stimulator-like 3
Synonyms: 1300003D20Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 9
NCBI: 71746
VEGA: 9
Homologene: 11363
Cd53
Name: CD53 antigen
Synonyms: Tspan25, Ox-44
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 3
NCBI: 12508
HGNC: HGNC:1686
Homologene: 20152
Zfp541
Name: zinc finger protein 541
Synonyms: EG666528
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 7
NCBI: 666528
Homologene: 12991
Prorp
Name: protein only RNase P catalytic subunit
Synonyms: 1110008L16Rik, Mrpp3
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 12
NCBI: 66132
Homologene: 45935
Tex10
Name: testis expressed gene 10
Synonyms: 2810462N03Rik, 2610206N19Rik, clone 18330
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 4
NCBI: 269536
Homologene: 32361
Aass
Name: aminoadipate-semialdehyde synthase
Synonyms: LOR/SDH, Lorsdh
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 6
NCBI: 30956
Homologene: 4212
Aim2
Name: absent in melanoma 2
Synonyms: LOC383619, Ifi210
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 1
NCBI: 383619
HGNC: HGNC:357
Homologene: 83226
Ptprr
Name: protein tyrosine phosphatase receptor type R
Synonyms: PTPBR7, RPTPRR, PTP-SL
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 10
NCBI: 19279
HGNC: HGNC:9680
Homologene: 2135
Kcnh8
Name: potassium voltage-gated channel, subfamily H (eag-related), member 8
Synonyms: ELK1, Kv12.1, C130090D05Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 17
NCBI: 211468
Homologene: 14332
Klk14
Name: kallikrein related-peptidase 14
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 7
NCBI: 317653
HGNC: HGNC:6362
Homologene: 69348
Vmn1r66
Name: vomeronasal 1 receptor 66
Synonyms: V1re11
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 7
NCBI: 171264
Vmn2r106
Name: vomeronasal 2, receptor 106
Synonyms: EG224576
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 17
NCBI: 224576
Homologene: 135824
Ifit1bl1
Name: interferon induced protein with tetratricpeptide repeats 1B like 1
Synonyms: Gm14446
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 19
NCBI: 667373
Homologene: 78213
Stard13
Name: StAR-related lipid transfer (START) domain containing 13
Synonyms: DLC2, GT650
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 5
NCBI: 243362
Homologene: 64844
Plod3
Name: procollagen-lysine, 2-oxoglutarate 5-dioxygenase 3
Synonyms: LH3, lysyl hydroxylase 3
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 5
NCBI: 26433
HGNC: HGNC:9083
Homologene: 843
Snph
Name: syntaphilin
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 2
NCBI: 241727
Homologene: 8817
Cpa5
Name: carboxypeptidase A5
Synonyms: 4930430M09Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 6
NCBI: 74649
Homologene: 62246
Cwc25
Name: CWC25 spliceosome-associated protein
Synonyms: R75228, Ccdc49, 1300013D05Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 11
NCBI: 67480
Homologene: 135922
Tex11
Name: testis expressed gene 11
Synonyms: 4930565P14Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: X
NCBI: 83558
Homologene: 49962
Gm12531
Name: predicted gene 12531
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 3
Gm5436
Name: predicted pseudogene 5436
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 12
NCBI: 432676
VEGA: 12
Genetic Alterations
ENU-induced transitions at the following base pair locations (GRCm38):
  • C to T, chromosome 1 at 37,035,824 bp
  • T to C, chromosome 1 at 173,459,851 bp
  • A to G, chromosome 1 at 174,214,066 bp
  • T to C, chromosome 1 at 189,839,478 bp
  • A to G, chromosome 2 at 25,845,722 bp
  • C to A, chromosome 2 at 35,161,926 bp
  • A to G, chromosome 2 at 35,175,125 bp
  • T to A, chromosome 2 at 69,513,273 bp
  • T to C, chromosome 2 at 151,593,802 bp
  • A to G, chromosome 3 at 37,064,363 bp
  • A to G, chromosome 3 at 99,313,054 bp
  • T to C, chromosome 3 at 106,762,145 bp
  • A to G, chromosome 4 at 11,221,196 bp
  • T to C, chromosome 4 at 48,468,873 bp
  • A to G, chromosome 4 at 94,820,133 bp
  • A to G, chromosome 4 at 118,373,567 bp
  • C to T, chromosome 4 at 146,467,519 bp
  • A to G, chromosome 5 at 107,842,265 bp
  • T to C, chromosome 5 at 112,461,166 bp
  • G to T, chromosome 5 at 115,948,050 bp
  • G to C, chromosome 5 at 136,988,146 bp
  • C to A, chromosome 5 at 151,092,829 bp
  • A to T, chromosome 6 at 23,109,498 bp
  • T to C, chromosome 6 at 30,631,229 bp
  • T to A, chromosome 6 at 108,391,835 bp
  • T to C, chromosome 6 at 123,069,774 bp
  • T to C, chromosome 6 at 141,935,962 bp
  • T to A, chromosome 7 at 4,580,988 bp
  • A to G, chromosome 7 at 10,274,806 bp
  • G to A, chromosome 7 at 16,072,135 bp
  • G to T, chromosome 7 at 24,925,846 bp
  • G to A, chromosome 7 at 43,692,077 bp
  • T to C, chromosome 7 at 46,288,299 bp
  • T to C, chromosome 7 at 141,259,057 bp
  • A to T, chromosome 8 at 3,211,391 bp
  • G to A, chromosome 8 at 85,328,682 bp
  • T to A, chromosome 9 at 21,987,675 bp
  • T to C, chromosome 9 at 99,875,224 bp
  • G to T, chromosome 9 at 119,339,987 bp
  • G to A, chromosome 10 at 7,919,831 bp
  • A to T, chromosome 10 at 43,975,039 bp
  • A to T, chromosome 10 at 116,236,710 bp
  • T to C, chromosome 11 at 67,190,430 bp
  • G to T, chromosome 11 at 97,753,918 bp
  • G to T, chromosome 12 at 55,304,613 bp
  • T to A, chromosome 12 at 84,258,715 bp
  • T to A, chromosome 13 at 3,548,866 bp
  • T to A, chromosome 13 at 49,446,376 bp
  • A to T, chromosome 15 at 82,391,801 bp
  • C to T, chromosome 17 at 6,231,780 bp
  • A to T, chromosome 17 at 20,267,556 bp
  • T to C, chromosome 17 at 24,223,898 bp
  • GAGACCAACGAGCAGCTGATGCTTCAGA to GAGA, chromosome 17 at 52,725,906 bp
  • A to G, chromosome 17 at 56,128,307 bp
  • T to C, chromosome 19 at 34,594,640 bp
  • C to A, chromosome X at 100,933,415 bp
Genotype Determination
Phenotype
G1 male heterozygous mice are viable and fertile. The G1 mice were not characterized prior to archiving.
Strain Development
C57BL/6J mice were injected with ENU, resulting in G0 mice that were bred back to C57BL/6J. Sperm was archived from G1 male mice that produced viable G2 mice.
Suggested Control Mice
Wild-type littermates or C57BL/6J mice
MMRRC Genetic QC Summary
The MMRRC Centers have developed a genetic QC pipeline using MiniMUGA array genotyping to provide additional information on strain backgrounds for MMRRC congenic and inbred strains. For more information on when data may be available, or to request genotyping for a strain of interest, please contact mmrrc@missouri.edu. Older strains may not have this information.
Donor
Bruce Beutler, M.D., University of Texas Southwestern Medical Center.
Primary Reference
MUTAGENETIX record for R4081 (G1). B. Beutler and colleagues, Center for the Genetics of Host Defense, UT Southwestern, Dallas, TX.

Colony and Husbandry Information

Colony Surveillance Program and Current Health Reports

Mice recovered from a cryo-archive will have health surveillance performed on recipient females. Health reports will be provided prior to shipment. If you require additional health status information, please email mmrrc@missouri.edu .
Coat Color
Black
MMRRC Breeding System
Random intra-strain mating
Breeding Scheme(s)
When maintaining a live colony, heterozygous mice may be bred together, bred with wild-type siblings, or bred with C57BL/6J inbred mice.
Overall Breeding Performance
Undetermined; during development, mating was done with heterozygous males; viability, fertility and other breeding statistics for heterozygous females and homozygotes are unverified, but presumably would be similar to the C57BL/6J background strain
Average litter size
Undetermined
Recommended wean age
3 weeks

Order Request Information

Limited quantities of breeder mice (recovered litter) are available from a cryoarchive; recovered litter usually available to ship in 3 to 4 months.

Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

Distribution of this strain requires submission of the MMRRC Conditions of Use (COU). A link to the COU web form will be provided via email after an order has been placed; the form should be completed then or the email forwarded to your institutional official for completion.

The donor or their institution limits the distribution to non-profit institutions only.

Additional charges may apply for any special requests. Shipping costs are in addition to the basic distribution/resuscitation fees. Information on shipping costs and any additional charges will be provided by the supplying MMRRC facility.

Click button to Request this one strain. (Use the MMRRC Catalog Search to request more than one strain.)
MMRRC Item # Description Distribution Fee / Unit (US $)
*Shipping & Handling not included*
Units Notes
040977-MU-RESUS Litter recovered from cryo-archive $5,475.00 / Non-Profit Litter Recovered litter4; additional fees for any special requests.
Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

Some MMRRC strains were submitted by the donor as cryopreserved germplasm, and because these strains were not cryopreserved by the MMRRC, we have not assessed the quality of this material. We have extensive experience with recovery of mice from cryopreserved sperm and embryos of varying quality, including using techniques such as IVF and ICSI, and are confident that we will have success in most, if not all, cases. However, because of the unknown quality of these frozen samples, we will restrict recovery efforts to two attempts for each order. Subsequent attempts can be performed on a fee-for-service basis, in addition to the standard fees, upon request.

1 The distribution fee covers the expense of rederiving mice from a live mouse; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

2 An aliquot contains a sufficient number of embryos (in one or more vials or straws and based on the transfer success rate of the MMRRC facility) to transfer into one to three recipients. The MMRRC makes no guarantee concerning embryo transfer success experienced in the recipient investigator's laboratory. Neither gender nor genotype ratios are guaranteed.

3 An aliquot is one straw or vial with sufficient sperm to recover at least one litter of mice, as per provided protocols, when performed at the MMRRC facility. The MMRRC makes no guarantee concerning the success of these procedures when performed outside the MMRRC facilities.

4 The distribution fee covers the expense of resuscitating mice from the cryo-archive; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

To request material from the MMRRC: Please fill out our on-line request form (accessible from the catalog search results page, or click the Request this Strain button in the fees section). If you have questions or need assistance completing this form, you may call Customer Service at (800) 910-2291 (in USA or Canada) or (530) 757-5710 (international calls). Before you call, please have with you: the MMRRC item number, quantity needed, Bill-to and Ship-to contact information.